Mercurial > repos > rnateam > viennarna_rnafold
changeset 2:84aad99aca1f draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit b'bd13ffd1c3e126a6dc59dd3c478347ec1b5824a3\n'
| author | rnateam |
|---|---|
| date | Tue, 16 May 2017 16:30:38 -0400 |
| parents | f87325531be8 |
| children | fcf2463f85c1 |
| files | macros.xml rnafold.xml rnafold_SHAPE.py test-data/sample_3.fa test-data/sample_3.react test-data/sample_3_result.txt |
| diffstat | 6 files changed, 579 insertions(+), 56 deletions(-) [+] |
line wrap: on
line diff
--- a/macros.xml Wed Dec 21 17:33:12 2016 -0500 +++ b/macros.xml Tue May 16 16:30:38 2017 -0400 @@ -2,6 +2,7 @@ <xml name="requirements"> <requirements> <requirement type="package" version="2.2.10">viennarna</requirement> + <yield/> </requirements> </xml> <token name="@VERSION@">2.2.10</token>
--- a/rnafold.xml Wed Dec 21 17:33:12 2016 -0500 +++ b/rnafold.xml Tue May 16 16:30:38 2017 -0400 @@ -1,23 +1,31 @@ -<tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.0"> +<tool id="viennarna_rnafold" name="@EXECUTABLE@" version="@VERSION@.1"> <description>Calculate minimum free energy secondary structures and partition function of RNAs</description> <macros> <token name="@EXECUTABLE@">RNAfold</token> <import>macros.xml</import> </macros> - <expand macro="requirements" /> + <expand macro="requirements"> + <requirement type="package" version="1.65">biopython</requirement> + </expand> <expand macro="stdio" /> <expand macro="version_command" /> <command> <![CDATA[ #if str($input_source.select_fasta) == "false" #if str($input_source.input_sequence).lstrip()[0] == ">" - echo "${input_source.input_sequence}" > "input.fasta" && + echo '${input_source.input_sequence}' > "input.fasta" && #else echo ">Sequence" > "input.fasta" && - echo "${input_source.input_sequence}" >> "input.fasta" && + echo '${input_source.input_sequence}' >> "input.fasta" && #end if - #end if - RNAfold + #end if + + #if str($constraints.shapeOption.shapeSelector) == "isUsed" + python '$__tool_directory__/rnafold_SHAPE.py' + #else + RNAfold + #end if + -T $temperature --dangles=$dangling #if $layout_type ==0 @@ -33,7 +41,7 @@ #if $measelect.pfScale <> 1.07 --pfScale=$measelect.pfScale #end if - #end if + #end if $advancedOptions.noconversion $advancedOptions.gquad $advancedOptions.nolp @@ -49,7 +57,7 @@ #end if #if $advancedOptions.betaScale <> 1.0 --betaScale=$advancedOptions.betaScale - #end if + #end if #if $constraints.maxBPspan <> -1 --maxBPspan=$constraints.maxBPspan #end if @@ -69,7 +77,7 @@ --shapeMethod=$s #else if str($constraints.shapeOption.shapeMethod.methodSelector) == "Z" #set $s="Zb"+str($constraints.shapeOption.shapeMethod.b) - --shapeMethod=$s + --shapeMethod=$s #if str($constraints.shapeOption.shapeMethod.shapeConversion.conversionSelector) == "C" #set $c="C"+str($constraints.shapeOption.shapeMethod.shapeConversion.c) --shapeConversion=$c @@ -90,8 +98,8 @@ #end if #if $constraints.motif --motif='$constraints.motif' - #end if - < + #end if + < #if str($input_source.select_fasta) == "false" "input.fasta" #else @@ -120,11 +128,11 @@ <option value="1">1: unpaired bases participate in one dangling end only</option> <option value="2" selected="True">2: unpaired bases participate in all dangling ends</option> <option value="3">3: allow coaxial stacking</option> - </param> + </param> <param name="layout_type" type="select" label="Layout algorithm" argument="--layout_type" > <option value="1" selected="true">Default: Naview layout</option> <option value="0">Simple radial layout</option> - </param> + </param> <conditional name="measelect"> <param name="mea" type="select" label="Calculate Maximum Expected accuracy" argument="--MEA"> <option value="no">No</option> @@ -138,7 +146,7 @@ <param name="pf" type="boolean" checked="false" truevalue="--partfunc" falsevalue="" label="Calculate Partition Function" help="--partfunc"/> <param argument="--pfScale" type="float" value="1.07" label="Scaling factor" help="In the calculation of the pf use scale*mfe as an estimate for the ensemble free energy (used to avoid overflows). The default is 1.07, useful values are 1.0 to 1.2. Occasionally needed for long sequences."/> </when> - </conditional> + </conditional> <section name="advancedOptions" title="Advanced options"> <param name="nolp" type="boolean" truevalue="" falsevalue="--noLP" checked="true" label="Allow lonely base-pairs" help="(--noLP)"/> <param name="nogu" type="boolean" truevalue="" falsevalue="--noGU" checked="true" label="Allow GU pairing" help="--noGU"/> @@ -159,25 +167,25 @@ checked="false" label="Model as circular RNA structure" argument="--circ"/> - <param name="bppmThreshold" - type="float" - value="1e-5" - label="Threshold for base pair probabilities" - help="By setting the threshold the base pair probabilities that are included in the output can be varied. By default only those exceeding 1e−5 in probability will be shown as squares in the dot plot. Changing the threshold to any other value allows for increase or decrease of data." + <param name="bppmThreshold" + type="float" + value="1e-5" + label="Threshold for base pair probabilities" + help="By setting the threshold the base pair probabilities that are included in the output can be varied. By default only those exceeding 1e−5 in probability will be shown as squares in the dot plot. Changing the threshold to any other value allows for increase or decrease of data." argument="--bppmThreshold"/> - <param name="nsp" - type="text" + <param name="nsp" + type="text" value="" label="Allow other pairs in addition to the usual AU,GC,and GU pairs." - help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy." + help="Its argument is a comma separated list of additionally allowed pairs. If the first character is '-' then AB will imply that AB and BA are allowed pairs. e.g. RNAfold -nsp -GA will allow GA and AG pairs. Nonstandard pairs are given 0 stacking energy." argument="--nsp"/> - <param name="betaScale" - type="float" - value="1.0" - label="Scaling of Boltzman factors" - help=" The argument provided with this option enables to scale the thermodynamic temperature used in the Boltzmann factors independently from the temperature used to scale the individual energy contributions of the loop types." + <param name="betaScale" + type="float" + value="1.0" + label="Scaling of Boltzman factors" + help=" The argument provided with this option enables to scale the thermodynamic temperature used in the Boltzmann factors independently from the temperature used to scale the individual energy contributions of the loop types." argument="--betaScale"/> - </section> + </section> <section name="constraints" title="Structure constraints"> <param name="maxBPspan" type="integer" value="-1" label="Set the maximum base pair span" help="" argument="--maxBPspan"/> <conditional name="constraintLocation"> @@ -192,14 +200,14 @@ <when value="inFile"></when> <when value="fromFile"> <param name="constraintsFile" type="data" format="*" label="Constraints file" argument="--constraint"/> - <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue="" - label="Use constraints for all alignment records" - help="Usually, constraints provided from input file are only applied to a single sequence alignment. Therefore, RNAalifold will stop its computation and quit after the first input alignment was processed. Using this switch, RNAfold processes all sequence alignments in the input and applies the same provided constraints to each of them." + <param name="batch" type="boolean" checked="false" truevalue="--batch" falsevalue="" + label="Use constraints for all alignment records" + help="Usually, constraints provided from input file are only applied to a single sequence alignment. Therefore, RNAalifold will stop its computation and quit after the first input alignment was processed. Using this switch, RNAfold processes all sequence alignments in the input and applies the same provided constraints to each of them." argument="--batch"/> <param argument="--canonicalBPonly" type="boolean" truevalue="--canonicalBPonly" falsevalue="" checked="false" label="Remove non-canonical base pairs from he structure constraint" /> <param argument="--enforceConstraint" type="boolean" truevalue="--enforceConstraint" falsevalue="" checked="false" label="Enforce base pair given by round brackets () in structure constraint" /> </when> - </conditional> + </conditional> <conditional name="shapeOption"> <param name="shapeSelector" type="select" label="Shape reactivity data"> <option value="isUsed">Use shape reactivity data</option> @@ -243,38 +251,38 @@ <param name="i" type="float" value="-2.29" label="Intercept"/> </when> </conditional> - </when> + </when> <when value="W"> </when> </conditional> </when> <when value="notUsed"> </when> - </conditional> + </conditional> <param argument="--motif" type="text" value="" label="Sequence structure energy" help="Specify stabilizing effect of ligand binding to a particular sequence/structure motif. Some ligands binding to RNAs require and/or induce particular sequence and structure motifs. For instance they bind to an interior loop, or small hairpin loop. If for such cases a binding free energy is known, the binding and therefore stabilizing effect of the ligand can be included in the folding recursions. Interior loop motifs are specified as concatenations of 5’ and 3’ motif, separated by an ’&’ character. Energy contributions must be specified in kcal/mol."/> - </section> - <section name="IDs" title="Naming Conventions"> - <param name="auto_id" - type="boolean" truevalue="--auto-id" falsevalue="" checked="false" - label="Automatically generate an ID for each alignment." - help="If this flag is active, RNAfold ignores any IDs retrieved from the input and automatically generates an ID for each sequence." + </section> + <section name="IDs" title="Naming Conventions"> + <param name="auto_id" + type="boolean" truevalue="--auto-id" falsevalue="" checked="false" + label="Automatically generate an ID for each alignment." + help="If this flag is active, RNAfold ignores any IDs retrieved from the input and automatically generates an ID for each sequence." argument="--auto-id"/> - <param name="id_prefix" - type="text" value="sequence" - label="Prefix for automatically generated IDs (as used in output file names)" - help="If this parameter is set, each sequence will be prefixed with the provided string. Hence, the output files will obey the following naming scheme: 'prefix_xxxx_ss.ps' (secondary structure plot), 'prefix_xxxx_dp.ps' (dot−plot), 'prefix_xxxx_aln.ps' (annotated sequence), etc. where xxxx is the sequence number beginning with the second sequence in the input. Use this setting in conjunction with the −−continuous−ids flag to assign IDs beginning with the first input sequence." + <param name="id_prefix" + type="text" value="sequence" + label="Prefix for automatically generated IDs (as used in output file names)" + help="If this parameter is set, each sequence will be prefixed with the provided string. Hence, the output files will obey the following naming scheme: 'prefix_xxxx_ss.ps' (secondary structure plot), 'prefix_xxxx_dp.ps' (dot−plot), 'prefix_xxxx_aln.ps' (annotated sequence), etc. where xxxx is the sequence number beginning with the second sequence in the input. Use this setting in conjunction with the −−continuous−ids flag to assign IDs beginning with the first input sequence." argument="--id-prefix"/> - <param name="id_digits" - type="integer" value="4" min="1" max="18" - label="The number of digits of the counter in automatically generated sequence IDs" - help="When sequences IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left−padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]." + <param name="id_digits" + type="integer" value="4" min="1" max="18" + label="The number of digits of the counter in automatically generated sequence IDs" + help="When sequences IDs are automatically generated, they receive an increasing number, starting with 1. This number will always be left−padded by leading zeros, such that the number takes up a certain width. Using this parameter, the width can be specified to the users need. We allow numbers in the range [1:18]." argument="--id-digits"/> - <param name="id_start" - type="integer" value="1" min="0" - label="First number in automatically generated sequence IDs" - help="When sequence IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous sequence IDs, i.e. it activates the −−continuous−ids flag.." + <param name="id_start" + type="integer" value="1" min="0" + label="First number in automatically generated sequence IDs" + help="When sequence IDs are automatically generated, they receive an increasing number, usually starting with 1. Using this parameter, the first number can be specified to the users requirements. Note: negative numbers are not allowed. Note: Setting this parameter implies continuous sequence IDs, i.e. it activates the −−continuous−ids flag.." argument="--id-start"/> - </section> + </section> </inputs> <outputs> <data format="dbn" name="tabular_file"/> @@ -292,19 +300,26 @@ <param name="fasta_input" value="rnafold_input1.fa"/> <output name="out_file1" file="rnafold_result1.txt"/> </test> - <test> <param name="select_fasta" value="true" /> <param name="fasta_input" value="rnafold_input2.fa"/> <param name="temperature" value="75"/> <output name="out_file1" file="rnafold_result2.txt"/> </test> - <test> <param name="select_fasta" value="false" /> <param name="input_sequence" value="TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA"/> <output name="out_file1" file="rnafold_result3.txt"/> </test> + <test> + <param name="select_fasta" value="true" /> + <param name="fasta_input" value="sample_3.fa"/> + <conditional name="shapeOption"> + <param name="shapeSelector" value="isUsed"/> + </conditional> + <param name="shapeFile" value="sample_3.react"/> + <output name="out_file1" file="sample_3_result.txt"/> + </test> </tests> <help> <![CDATA[ @@ -343,7 +358,7 @@ - several possible postscript images bundled together in a tar file - secondary structure for each sequence in the input file - - if partition function is calculated (--MEA or --partfunc is set) then also the pairing probabilty matrix is generated for each sequence + - if partition function is calculated (--MEA or --partfunc is set) then also the pairing probabilty matrix is generated for each sequence ]]> </help>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/rnafold_SHAPE.py Tue May 16 16:30:38 2017 -0400 @@ -0,0 +1,45 @@ +### overcoming the problem of SHAPE data working with a single line. +### creating multiple multiple files containg SHAPE data for a single sequence and running RNAfold for every +### single sequence. + +import os +import sys +from os import system +from Bio import SeqIO +import re +from subprocess import Popen, PIPE + +params_list = sys.argv[1:] +param_list_no_shape = [s for s in params_list if not "--shape=" in s ] +shape_file = [s for s in params_list if "--shape=" in s ] +assert (len(shape_file) == 1) + +shape_file = shape_file[0] +shape_file = shape_file.replace('--shape=', '') + +params_no_shape = " ".join(str(x) for x in param_list_no_shape) + +pattern = re.compile("^>.*$") +id_line = "" +with open(shape_file, 'r') as f: + content = f.read() + lines = content.split('\n') + for line in lines: + if pattern.match(line): + id_line = line.split()[0] + id_line = id_line[1:] + continue + else: + with open(id_line +'.tmp', "a") as clFile: + clFile.write(line + "\n") + +input_file = sys.stdin + +for record in SeqIO.parse(input_file, "fasta"): + seq = ">{}\n{}".format(record.id,record.seq) + cmd = " RNAfold --shape=" + record.id + '.tmp ' + params_no_shape + p = Popen(cmd , stdin=PIPE, shell=True, stdout=PIPE, stderr=PIPE) + out,err = p.communicate(seq.encode()) + if err: + raise RuntimeError("Error in calling RNAfold\n{}\n{}\n".format(out, err)) + print (out.decode('utf-8').strip())
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample_3.fa Tue May 16 16:30:38 2017 -0400 @@ -0,0 +1,6 @@ +>SECIS_1 test +AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU +>6S_1 test1 +GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU +>6S_2 +UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample_3.react Tue May 16 16:30:38 2017 -0400 @@ -0,0 +1,447 @@ +>SECIS_1 +1 0.0657466222 +2 0.1280448842 +3 0.2786665403 +4 0.1391216354 +5 0.0272299574 +6 0.1717063095 +7 0.488732281 +8 3.3015172695 +9 0.414494604 +10 0.1957445189 +11 0.4670328791 +12 0.1943420556 +13 0.2099109521 +14 0.5846784488 +15 0.1296563697 +16 0.0359267698 +17 0.0438238841 +18 1.6364597431 +19 1.72206594665E-17 +20 0.0099928394 +21 0.0475042774 +22 0.0065948845 +23 0.0574522715 +24 0.2126102485 +25 1.2006488448 +26 0.6040825271 +27 0.4114049219 +28 1.1514597937 +29 1.216707413 +30 0.0186005737 +31 0.0841609069 +32 0.086771667 +33 1.1672973211 +34 0.8144419625 +35 0.2583987716 +36 0.0182542709 +37 0.0875979754 +38 0.094456587 +39 0.5206337515 +40 0.000517531 +41 0.0253820905 +42 0.2076338063 +43 0.0087295599 +44 0.0129264641 +45 0.0127365182 +46 0.1193338151 +47 0.0186183812 +48 0.3581141112 +49 0.0941009884 +50 0.2050905673 +51 0.0209195644 +52 0.6030952711 +53 5.2129588113 +54 0.1747678483 +55 1.2231479801 +56 0.4978854319 +57 0.5711590135 +58 0.2793524314 +59 0.0037936012 +60 0.2158137729 +61 0.5646393912 +62 0.6229186627 +63 0.0193621982 +>6S_1 +1 0.1158690877 +2 0.0774028501 +3 0.2349947573 +4 1.72206594665E-17 +5 0.0926174169 +6 0.0505177415 +7 0.0457131819 +8 0.0194615986 +9 2.1495069267 +10 0.0409639397 +11 0.2185631969 +12 0.1776745985 +13 0.0086422926 +14 0.0241577615 +15 0.0092855631 +16 0.3453240509 +17 0.1535840586 +18 0.0180643958 +19 0.1188776616 +20 0.3091581196 +21 0.3748109806 +22 0.6187506508 +23 0.3511511383 +24 0.6512026704 +25 0.3096370415 +26 0.5283368492 +27 0.7500060952 +28 0.0352720444 +29 0.3776026196 +30 0.3489100484 +31 1.3035405919 +32 0.1023638167 +33 0.133082988 +34 0.0024118398 +35 0.0281166587 +36 0.2818828676 +37 0.1316060603 +38 0.1813992598 +39 0.0047490217 +40 0.0204058553 +41 0.0675891142 +42 0.045119933 +43 0.0266727645 +44 0.0673921107 +45 0.0085752561 +46 0.495476266 +47 0.8224799434 +48 0.5574272341 +49 0.2431151153 +50 0.256015696 +51 0.0386339787 +52 0.6618567864 +53 0.0707284393 +54 1.1215284869 +55 0.0463423016 +56 0.3338809513 +57 0.3987796157 +58 1.1046527917 +59 0.6156154318 +60 0.1179259769 +61 2.0333569471 +62 0.1224421595 +63 0.0266055429 +64 0.0298356423 +65 0.3004015135 +66 2.1966900004 +67 0.0222153137 +68 0.0095300422 +69 0.0503009918 +70 0.0418994997 +71 0.0384566069 +72 2.6211662666 +73 0.1704872628 +74 0.8386436572 +75 0.6961218859 +76 0.1995308419 +77 0.0552442152 +78 0.1937915065 +79 0.1239592493 +80 0.0782601391 +81 0.0138965117 +82 0.0231978646 +83 0.0150709773 +84 0.4084290821 +85 0.0792668417 +86 1.0630476211 +87 0.2524739666 +88 0.0229636507 +89 0.1153934877 +90 0.2693801005 +91 0.0071337145 +92 1.0279231796 +93 0.0574241281 +94 0.103312087 +95 0.2100864561 +96 0.0252070712 +97 0.6067864142 +98 0.0607860625 +99 0.5416948523 +100 0.7090251541 +101 2.0470096713 +102 0.0368697578 +103 0.1221648319 +104 0.0484836208 +105 0.7188621431 +106 0.2405585888 +107 0.1071170724 +108 0.6859305671 +109 0.0997679124 +110 0.0342400356 +111 0.0201635 +112 0.4527960874 +113 0.7018417748 +114 0.2561295384 +115 0.2788440973 +116 0.2437240042 +117 0.0984135237 +118 0.1146045041 +119 0.2116296362 +120 0.0360702095 +121 0.2006613525 +122 0.0635994434 +123 0.8384420629 +124 0.3546527057 +125 0.014380068 +126 0.0041004554 +127 0.2404132813 +128 0.0016204246 +129 0.016365643 +130 0.0025333389 +131 0.0207130798 +132 0.2199275512 +133 0.2973627433 +134 1.7680018464 +135 0.3120917444 +136 0.854288287 +137 0.4309335923 +138 2.3003988746 +139 0.047166557 +140 0.7391255635 +141 0.1357653755 +142 0.4672659386 +143 0.3601080698 +144 0.9111911856 +145 0.7435427597 +146 0.3353115579 +147 1.0513358906 +148 0.1406855309 +149 0.3543459659 +150 0.0561408821 +151 0.563013834 +152 0.1549691284 +153 0.7460309808 +154 0.0486849156 +155 0.1080587915 +156 0.0699642772 +157 0.4423435657 +158 0.0171555252 +159 0.0064557797 +160 0.4739275466 +161 0.2617128164 +162 0.0879369647 +163 0.0062762841 +164 0.1060085461 +165 0.0971932081 +166 0.3139785044 +167 0.0771649003 +168 0.0753029618 +169 0.5676607679 +170 0.9836368904 +171 0.6193661835 +172 0.3890022353 +173 0.3304911731 +174 0.9354752573 +175 2.5683088408 +176 0.6777050636 +177 0.0195000778 +178 0.0532349161 +179 0.0993391181 +180 0.0667310411 +181 0.0123690861 +182 0.0165201319 +183 0.2056431695 +184 0.0114477122 +185 0.1684423923 +186 0.6236165725 +187 0.2533573459 +188 7.4644850979 +189 1.72206594665E-17 +190 0.0510513818 +191 0.071993023 +192 0.093087642 +193 0.026770297 +194 0.1003921418 +195 0.731799564 +196 0.3882654324 +>6S_2 +1 5.135077189 +2 0.0137794619 +3 0.0198585136 +4 0.0394762621 +5 0.1032256038 +6 0.0124879331 +7 0.050343991 +8 0.0266906427 +9 0.0867862234 +10 0.0250443701 +11 0.1241682715 +12 0.0888505404 +13 1.72206594665E-17 +14 0.0443782398 +15 0.0331749933 +16 1.190843321 +17 0.0083605324 +18 0.1025127456 +19 0.0318835351 +20 0.6764653014 +21 1.6659553696 +22 0.0532195755 +23 0.1306535914 +24 3.2368938797 +25 0.2999875752 +26 0.1771608894 +27 0.0735275063 +28 1.1463641343 +29 0.3436951718 +30 0.6339043401 +31 0.8229568123 +32 0.0567986298 +33 0.3413998482 +34 0.1291037675 +35 0.561127074 +36 0.0076983354 +37 0.147000237 +38 0.0214390185 +39 0.5304305785 +40 0.0785507542 +41 0.0483731004 +42 0.0976091996 +43 1.2125480978 +44 0.1865263845 +45 0.6312459899 +46 0.1817958047 +47 2.8617198725 +48 0.2055922577 +49 1.3068827801 +50 0.2629492567 +51 0.8571308379 +52 0.2726647331 +53 1.129084224 +54 0.275119436 +55 0.5874419445 +56 0.3657294569 +57 0.2500734975 +58 1.0443534711 +59 4.5331285532 +60 0.2551985691 +61 0.1800315837 +62 1.2079574507 +63 0.1377332438 +64 0.034281766 +65 0.0098202871 +66 0.9938878178 +67 0.0331980613 +68 0.2884058117 +69 0.1471099733 +70 0.0250835628 +71 0.0040433138 +72 2.1207460501 +73 0.7413016698 +74 0.2856087978 +75 0.1043896327 +76 2.5426831833 +77 0.024753755 +78 0.0197741979 +79 0.0256614712 +80 0.0931195919 +81 0.2341548619 +82 0.9442989 +83 0.6902004027 +84 0.2615426874 +85 0.1968596889 +86 0.1317761893 +87 0.3101105886 +88 0.3109082689 +89 0.6036478733 +90 0.1383132052 +91 1.72206594665E-17 +92 1.3701244222 +93 0.0259262955 +94 0.0427849321 +95 0.0059202715 +96 0.4620195968 +97 1.1627066739 +98 0.1193652803 +99 0.5039174355 +100 0.7685843498 +101 3.3504451177 +102 0.0156110762 +103 0.0405202895 +104 0.0448853051 +105 0.1130352336 +106 0.0128895533 +107 0.0140152443 +108 0.8487385272 +109 0.5411302314 +110 0.1921994675 +111 0.0804367301 +112 2.1393979849 +113 0.657192459 +114 0.9680746376 +115 0.0181673032 +116 0.1293355582 +117 0.0385348779 +118 0.0599847607 +119 0.0286153267 +120 0.0529816257 +121 0.0738905329 +122 1.9826160191 +123 0.6850277412 +124 0.0240149916 +125 0.1003714264 +126 0.0282377438 +127 0.016091267 +128 0.0654324545 +129 1.3672926211 +130 0.3123897874 +131 0.0125997931 +132 0.0326682275 +133 0.8141700098 +134 2.7208263459 +135 0.9376426669 +136 0.2104407859 +137 0.9213456642 +138 0.9496557623 +139 0.0158974709 +140 1.0394051723 +141 3.395502997 +142 0.2786545217 +143 0.0944673368 +144 0.1658691067 +145 1.5138095878 +146 0.2388473327 +147 0.0071582802 +148 0.0399196127 +149 0.0269685694 +150 0.0343298406 +151 0.0260244978 +152 0.1131275763 +153 0.0217325853 +154 0.1015784545 +155 0.0991349861 +156 1.4195713543 +157 0.5085589945 +158 0.1250938659 +159 0.788081555 +160 0.1135816768 +161 0.0633806979 +162 2.7826494 +163 1.8003487205 +164 0.7686439584 +165 0.0397996113 +166 0.8340757785 +167 0.0060961894 +168 0.0003936337 +169 0.0179660084 +170 0.033466093 +171 0.0469772809 +172 0.1070226766 +173 0.3447929483 +174 0.8559366126 +175 0.1279778477 +176 0.2188243998 +177 0.0449863446 +178 0.0382790499 +179 0.0022221768 +180 0.0311889472 +181 0.0257878168 +182 0.0172539125 +183 0.2710934097 +184 0.0914500662 +185 0.208503114 \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample_3_result.txt Tue May 16 16:30:38 2017 -0400 @@ -0,0 +1,9 @@ +>SECIS_1 +AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU +.((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. (-27.97) +>6S_1 +GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU +(((((((...(((((.((.....((((((....((((((((((...................(((.((((.....((.((((.(..((((.(.((((.....))))).))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))))......)))))))....))))))). (-110.38) +>6S_2 +UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC +.((.(((((((((((.(((.(...((((...((.((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))))..)))).).))))))).))))))))).. (-129.27)