Mercurial > repos > rnateam > viennarna_rnaplot
changeset 3:6e4f1b0b25db draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 3103ebed1a420c7d3415b67ef532ea579edf9faa
| author | rnateam |
|---|---|
| date | Wed, 12 Jul 2017 14:24:45 -0400 |
| parents | c1dfaaa48261 |
| children | cad59d5ec4bb |
| files | test-data/mfe_struct_result.fasta test-data/test_sequence_input.fasta test-data/trajectory_result.tabular |
| diffstat | 3 files changed, 15 insertions(+), 0 deletions(-) [+] |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/mfe_struct_result.fasta Wed Jul 12 14:24:45 2017 -0400 @@ -0,0 +1,3 @@ +>test_seq mfe: -13.6 +ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG +.(((((((((.......)))))))))........
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test_sequence_input.fasta Wed Jul 12 14:24:45 2017 -0400 @@ -0,0 +1,2 @@ +>test_seq +ACAGGUUCGCCUGUGUUGCGAACCUGCGGGUUCG
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/trajectory_result.tabular Wed Jul 12 14:24:45 2017 -0400 @@ -0,0 +1,10 @@ +..(((....))) -0.4 0.0550686 3.9 6.46108 12 +.((((....)))) -3 0.0600001 5.96046e-09 6.46108 13 +(((((....))))) -4.7 0.065 0 6.46108 14 +(((((....)))))..((((....)))) -5.3 0.135069 3.9 6.46108 28 +(((((....))))).(((((....))))) -5.8 0.14 1.90735e-07 6.46108 29 +(((((....))))).......(((....)))... -6.9 0.17246 6.7 7.46108 34 +(((((....)))))......((((....)))).. -7.8 0.17246 9.53674e-08 7.46108 34 +(((((....))))).....(((((....))))). -10.7 0.17246 1.90735e-07 7.46108 34 +(((((....)))))....((((((....)))))) -13.1 0.17246 -1.90735e-07 7.46108 34 +.(((((((((.......)))))))))........ -13.6 123.457 12.5 13 34
