# HG changeset patch
# User rnateam
# Date 1513777083 18000
# Node ID 61e51eabbb95b3436554855470977d512328efad
# Parent  16d733b920d8378ddc1863a4e27e5c49a217886c
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 36681a08c6e44c663169caaefd964781c43d0d29

diff -r 16d733b920d8 -r 61e51eabbb95 test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_dp.ps	Wed Dec 20 08:38:03 2017 -0500
@@ -0,0 +1,370 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%BoundingBox: 66 211 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+% 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343207.trna3_AlaAGC) show
+
+/sequence { (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) } def
+/len { sequence length } bind def
+
+72 216 translate
+72 6 mul len 1 add div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+drawseq
+0.5 dup translate
+% draw diagonal
+0.04 setlinewidth
+0 len moveto len 0 lineto stroke
+
+/min { 2 copy gt { exch } if pop } bind def
+
+/utri{ % i j prob utri
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.33
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/uHmotif{ % i j uHmotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/lHmotif{ % i j lHmotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/uImotif{ % i j k l uImotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup
+  5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll
+  moveto lineto lineto lineto closepath fill
+  grestore
+} bind def
+/lImotif{ % i j k l lImotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch
+  5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll
+  moveto lineto lineto lineto closepath fill
+  grestore
+} bind def
+
+%data starts here
+
+%start of quadruplex data
+
+%start of Hmotif data
+
+%start of Imotif data
+
+%draw the grid
+drawgrid
+
+%start of base pair probability data
+1 71 0.011137621 ubox
+1 72 0.998618513 ubox
+2 70 0.011249479 ubox
+2 71 0.999343269 ubox
+2 72 0.029380302 ubox
+3 69 0.016278852 ubox
+3 70 0.998657995 ubox
+3 71 0.029349731 ubox
+3 72 0.013044031 ubox
+4 68 0.015570075 ubox
+4 69 0.999660285 ubox
+4 70 0.006500567 ubox
+4 71 0.013063530 ubox
+5 67 0.017184802 ubox
+5 68 0.995393993 ubox
+5 70 0.012116272 ubox
+6 20 0.003683136 ubox
+6 47 0.007871866 ubox
+6 67 0.961997835 ubox
+6 68 0.010641824 ubox
+7 19 0.003963646 ubox
+7 22 0.016669769 ubox
+7 23 0.006395271 ubox
+7 26 0.010803708 ubox
+7 45 0.003325342 ubox
+7 46 0.008388346 ubox
+7 66 0.889354167 ubox
+8 18 0.004993356 ubox
+8 21 0.043576199 ubox
+8 22 0.009051039 ubox
+8 23 0.003412982 ubox
+8 26 0.053349931 ubox
+8 44 0.006391561 ubox
+8 45 0.009575801 ubox
+8 46 0.006511628 ubox
+8 48 0.044296110 ubox
+8 66 0.051228716 ubox
+9 17 0.005076838 ubox
+9 20 0.044973880 ubox
+9 47 0.045851242 ubox
+9 67 0.006907131 ubox
+10 20 0.031947572 ubox
+10 25 0.993218795 ubox
+10 47 0.003684611 ubox
+10 61 0.005362683 ubox
+11 18 0.045881626 ubox
+11 19 0.032788757 ubox
+11 22 0.010762380 ubox
+11 24 0.996351171 ubox
+11 43 0.031784396 ubox
+11 45 0.044997253 ubox
+11 46 0.003273388 ubox
+11 60 0.005393685 ubox
+12 18 0.028759750 ubox
+12 19 0.007591504 ubox
+12 21 0.010602364 ubox
+12 23 0.996289342 ubox
+12 42 0.031993047 ubox
+12 44 0.044989514 ubox
+12 58 0.005409282 ubox
+13 18 0.016589428 ubox
+13 19 0.009128152 ubox
+13 22 0.996158882 ubox
+13 41 0.032010508 ubox
+13 43 0.044839517 ubox
+13 57 0.005483356 ubox
+14 20 0.079642667 ubox
+14 56 0.005446527 ubox
+15 20 0.129735024 ubox
+15 55 0.005085787 ubox
+16 20 0.018529841 ubox
+16 38 0.051862141 ubox
+17 21 0.010497970 ubox
+17 26 0.003797728 ubox
+17 37 0.052295806 ubox
+17 39 0.003520191 ubox
+17 42 0.004660118 ubox
+17 52 0.004889289 ubox
+18 25 0.005375323 ubox
+18 36 0.051745231 ubox
+18 38 0.003387544 ubox
+19 25 0.004215070 ubox
+19 36 0.018363451 ubox
+19 40 0.005479857 ubox
+19 50 0.005352275 ubox
+20 24 0.003956630 ubox
+20 34 0.049426221 ubox
+20 35 0.019676299 ubox
+20 39 0.005488315 ubox
+20 49 0.005308891 ubox
+21 33 0.037607150 ubox
+21 38 0.005407841 ubox
+22 32 0.023047831 ubox
+22 33 0.039236028 ubox
+23 32 0.049874318 ubox
+23 47 0.036867639 ubox
+24 31 0.055184372 ubox
+24 47 0.041474959 ubox
+25 30 0.055108050 ubox
+25 41 0.003625640 ubox
+25 45 0.072422399 ubox
+25 46 0.047506335 ubox
+26 36 0.020612775 ubox
+26 40 0.011634581 ubox
+26 47 0.044476135 ubox
+27 35 0.020631543 ubox
+27 39 0.011645626 ubox
+27 43 0.992061337 ubox
+27 45 0.025461226 ubox
+27 46 0.039850990 ubox
+28 34 0.019643833 ubox
+28 42 0.996960401 ubox
+28 44 0.021374269 ubox
+28 45 0.024434496 ubox
+29 41 0.997917003 ubox
+29 43 0.018395309 ubox
+29 45 0.003166236 ubox
+30 36 0.012434123 ubox
+30 40 0.998065717 ubox
+30 47 0.007404570 ubox
+31 35 0.012393915 ubox
+31 39 0.997764981 ubox
+31 41 0.005414838 ubox
+31 43 0.003645699 ubox
+31 46 0.007622516 ubox
+32 37 0.068093187 ubox
+32 39 0.013599795 ubox
+32 42 0.003678913 ubox
+32 45 0.007610493 ubox
+33 37 0.102337630 ubox
+33 39 0.003720007 ubox
+33 41 0.003538594 ubox
+33 44 0.007538047 ubox
+34 38 0.013851913 ubox
+36 41 0.007501659 ubox
+38 48 0.018700348 ubox
+39 47 0.020533473 ubox
+40 46 0.020625702 ubox
+44 68 0.005576608 ubox
+44 70 0.006111196 ubox
+45 50 0.003800521 ubox
+45 62 0.010043051 ubox
+45 65 0.003484260 ubox
+45 67 0.009783316 ubox
+45 68 0.032579696 ubox
+45 69 0.007408521 ubox
+46 61 0.010086460 ubox
+46 65 0.005780351 ubox
+46 67 0.077112938 ubox
+46 68 0.006873266 ubox
+47 60 0.010092967 ubox
+47 64 0.003785455 ubox
+47 66 0.084736602 ubox
+48 59 0.008724857 ubox
+48 67 0.019275395 ubox
+49 65 0.998806957 ubox
+50 57 0.009062054 ubox
+50 64 0.999848265 ubox
+51 56 0.007052370 ubox
+51 62 0.010700667 ubox
+51 63 0.999834583 ubox
+52 61 0.014860342 ubox
+52 62 0.999778783 ubox
+52 63 0.005533111 ubox
+53 61 0.998254922 ubox
+53 62 0.007658167 ubox
+54 59 0.156536412 ubox
+55 60 0.324268739 ubox
+56 60 0.024269416 ubox
+1 72 0.9500000 lbox
+2 71 0.9500000 lbox
+3 70 0.9500000 lbox
+4 69 0.9500000 lbox
+5 68 0.9500000 lbox
+6 67 0.9500000 lbox
+7 66 0.9500000 lbox
+10 25 0.9500000 lbox
+11 24 0.9500000 lbox
+12 23 0.9500000 lbox
+13 22 0.9500000 lbox
+27 43 0.9500000 lbox
+28 42 0.9500000 lbox
+29 41 0.9500000 lbox
+30 40 0.9500000 lbox
+31 39 0.9500000 lbox
+49 65 0.9500000 lbox
+50 64 0.9500000 lbox
+51 63 0.9500000 lbox
+52 62 0.9500000 lbox
+53 61 0.9500000 lbox
+showpage
+end
+%%EOF
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343207.trna3_AlaAGC_ss.ps	Wed Dec 20 08:38:03 2017 -0500
@@ -0,0 +1,231 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%Title: RNA Secondary Structure Plot
+%%BoundingBox: 66 210 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+% to switch off outline pairs of sequence comment or
+% delete the appropriate line near the end of the file
+
+%%BeginProlog
+/RNAplot 100 dict def
+RNAplot begin
+/fsize  14 def
+/outlinecolor {0.2 setgray} bind def
+/paircolor    {0.2 setgray} bind def
+/seqcolor     {0   setgray} bind def
+/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
+/min { 2 copy gt { exch } if pop } bind def
+/max { 2 copy lt { exch } if pop } bind def
+/arccoords { % i j arccoords
+  % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
+  % onto the stack
+  dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
+  dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
+  4 -2 roll 5 -1 roll {exch} if 4 2 roll
+  sequence length dup 2 div exch 3 1 roll lt 
+  {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
+  { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
+    4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
+    exch add 4 -1 roll dup 5 1 roll sub 1 sub
+    5 -1 roll not {4 -2 roll exch 4 2 roll} if
+  }ifelse
+   % compute the scalingfactor and prepare (1-sf) and sf*r
+  2 mul exch cpr 3 1 roll div dup
+  3 -1 roll mul exch 1 exch sub exch
+   % compute the coordinates
+  3 -1 roll 1 sub coor exch get aload pop % get coord for i
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
+  5 -1 roll 1 sub coor exch get aload pop % get coord for j
+  % duplicate j coord
+  dup 3 -1 roll dup 4 1 roll exch 8 2 roll
+  6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
+  6 -1 roll mul 5 -1 roll add exch % calculate x2
+  6 -2 roll % reorder
+} bind def
+/drawoutline {
+  gsave outlinecolor newpath
+  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
+  currentdict /cutpoint known        % check if cutpoint is defined
+  {coor 0 cutpoint getinterval
+   {aload pop lineto} forall         % draw outline of 1st sequence
+   coor cutpoint 1 add get aload pop
+   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
+   coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
+   {aload pop lineto} forall}        % draw outline of 2nd sequence
+  {coor {aload pop lineto} forall}   % draw outline as a whole
+  ifelse
+  stroke grestore
+} bind def
+/drawpairs {
+  paircolor
+  0.7 setlinewidth
+  [9 3.01] 9 setdash
+  newpath
+  pairs {aload pop
+      currentdict (cpr) known
+      { exch dup
+        coor  exch 1 sub get aload pop moveto
+        exch arccoords curveto
+      }
+      { coor exch 1 sub get aload pop moveto
+        coor exch 1 sub get aload pop lineto
+      }ifelse
+  } forall
+  stroke
+} bind def
+% draw bases
+/drawbases {
+  [] 0 setdash
+  seqcolor
+  0
+  coor {
+    aload pop moveto
+    dup sequence exch 1 getinterval cshow
+    1 add
+  } forall
+  pop
+} bind def
+
+/init {
+  /Helvetica findfont fsize scalefont setfont
+  1 setlinejoin
+  1 setlinecap
+  0.8 setlinewidth
+  72 216 translate
+  % find the coordinate range
+  /xmax -1000 def /xmin 10000 def
+  /ymax -1000 def /ymin 10000 def
+  coor {
+      aload pop
+      dup ymin lt {dup /ymin exch def} if
+      dup ymax gt {/ymax exch def} {pop} ifelse
+      dup xmin lt {dup /xmin exch def} if
+      dup xmax gt {/xmax exch def} {pop} ifelse
+  } forall
+  /size {xmax xmin sub ymax ymin sub max} bind def
+  72 6 mul size div dup scale
+  size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
+  translate
+} bind def
+end
+%%EndProlog
+RNAplot begin
+% data start here
+/sequence (\
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
+) def
+/coor [
+[111.04756165 225.82804871]
+[110.41094971 210.84155273]
+[109.77433014 195.85507202]
+[109.13771057 180.86859131]
+[108.50109100 165.88211060]
+[107.86447144 150.89561462]
+[107.22785950 135.90913391]
+[90.28739166 133.48460388]
+[77.11851501 123.91786957]
+[70.32070923 110.05319977]
+[55.37474823 111.32528687]
+[40.42878342 112.59737396]
+[25.48282242 113.86946106]
+[17.57515907 127.22043610]
+[3.31690264 133.34266663]
+[-11.80935574 129.88204956]
+[-21.98726082 118.16923523]
+[-23.30319977 102.70806122]
+[-15.25116920 89.44365692]
+[-0.92733771 83.47645569]
+[14.16048908 87.10096741]
+[24.21073341 98.92350006]
+[39.15669632 97.65141296]
+[54.10265732 96.37932587]
+[69.04862213 95.10723114]
+[75.20735168 80.83619690]
+[87.46604156 71.28019714]
+[84.93103027 56.49596024]
+[82.39601898 41.71172333]
+[79.86100006 26.92748451]
+[77.32598877 12.14324570]
+[63.73017883 4.41744947]
+[58.32971573 -10.25800610]
+[63.67453384 -24.95381927]
+[77.24097443 -32.73107910]
+[92.62337494 -29.91759682]
+[102.55863953 -17.84181786]
+[102.35564423 -2.20555139]
+[92.11022949 9.60823345]
+[94.64524078 24.39247131]
+[97.18025208 39.17671204]
+[99.71526337 53.96094894]
+[102.25028229 68.74518585]
+[111.61898041 69.95008087]
+[120.45154572 73.97383881]
+[127.89853668 80.59681702]
+[133.19635010 89.34370422]
+[135.74378967 99.51597595]
+[135.16680908 110.24712372]
+[150.04531860 112.15238953]
+[164.92382812 114.05766296]
+[179.80232239 115.96292877]
+[194.68083191 117.86819458]
+[206.04914856 107.13062286]
+[221.66270447 106.26418304]
+[234.14927673 115.67798615]
+[237.61306763 130.92712402]
+[230.41859436 144.81141663]
+[215.96286011 150.77513123]
+[201.07142639 146.00236511]
+[192.77557373 132.74670410]
+[177.89706421 130.84143066]
+[163.01855469 128.93617249]
+[148.14004517 127.03089905]
+[133.26153564 125.12563324]
+[122.21434021 135.27252197]
+[122.85095978 150.25900269]
+[123.48757935 165.24548340]
+[124.12419128 180.23197937]
+[124.76081085 195.21846008]
+[125.39743042 210.20494080]
+[126.03404999 225.19142151]
+[129.04023743 244.33856201]
+] def
+/pairs [
+[1 72]
+[2 71]
+[3 70]
+[4 69]
+[5 68]
+[6 67]
+[7 66]
+[10 25]
+[11 24]
+[12 23]
+[13 22]
+[27 43]
+[28 42]
+[29 41]
+[30 40]
+[31 39]
+[49 65]
+[50 64]
+[51 63]
+[52 62]
+[53 61]
+] def
+
+init
+
+% switch off outline pairs or bases by removing these lines
+drawoutline
+drawpairs
+drawbases
+% show it
+showpage
+end
+%%EOF
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_dp.ps	Wed Dec 20 08:38:03 2017 -0500
@@ -0,0 +1,507 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Title: RNA Dot Plot
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%BoundingBox: 66 211 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+% 
+%This file contains the square roots of the base pair probabilities in the form
+% i  j  sqrt(p(i,j)) ubox
+
+%%BeginProlog
+/DPdict 100 dict def
+DPdict begin
+/logscale false def
+/lpmin 1e-05 log def
+
+/box { %size x y box - draws box centered on x,y
+   2 index 0.5 mul sub            % x -= 0.5
+   exch 2 index 0.5 mul sub exch  % y -= 0.5
+   3 -1 roll dup rectfill
+} bind def
+
+/ubox {
+   logscale {
+      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
+   } if
+   3 1 roll
+   exch len exch sub 1 add box
+} bind def
+
+/lbox {
+   3 1 roll
+   len exch sub 1 add box
+} bind def
+
+/drawseq {
+% print sequence along all 4 sides
+[ [0.7 -0.3 0 ]
+  [0.7 0.7 len add 0]
+  [-0.3 len sub -0.4 -90]
+  [-0.3 len sub 0.7 len add -90]
+] {
+   gsave
+    aload pop rotate translate
+    0 1 len 1 sub {
+     dup 0 moveto
+     sequence exch 1 getinterval
+     show
+    } for
+   grestore
+  } forall
+} bind def
+
+/drawgrid{
+  0.01 setlinewidth
+  len log 0.9 sub cvi 10 exch exp  % grid spacing
+  dup 1 gt {
+     dup dup 20 div dup 2 array astore exch 40 div setdash
+  } { [0.3 0.7] 0.1 setdash } ifelse
+  0 exch len {
+     dup dup
+     0 moveto
+     len lineto
+     dup
+     len exch sub 0 exch moveto
+     len exch len exch sub lineto
+     stroke
+  } for
+  [] 0 setdash
+  0.04 setlinewidth
+  currentdict /cutpoint known {
+    cutpoint 1 sub
+    dup dup -1 moveto len 1 add lineto
+    len exch sub dup
+    -1 exch moveto len 1 add exch lineto
+    stroke
+  } if
+  0.5 neg dup translate
+} bind def
+
+end
+%%EndProlog
+DPdict begin
+%delete next line to get rid of title
+270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_caro_chrUn_GL343590.trna2_AlaAGC) show
+
+/sequence { (\
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
+) } def
+/len { sequence length } bind def
+
+72 216 translate
+72 6 mul len 1 add div dup scale
+/Helvetica findfont 0.95 scalefont setfont
+
+drawseq
+0.5 dup translate
+% draw diagonal
+0.04 setlinewidth
+0 len moveto len 0 lineto stroke
+
+/min { 2 copy gt { exch } if pop } bind def
+
+/utri{ % i j prob utri
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.33
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/uHmotif{ % i j uHmotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  exch 1 sub dup len exch sub dup 4 -1 roll dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/lHmotif{ % i j lHmotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  dup len exch sub dup 4 -1 roll 1 sub dup 3 1 roll dup len exch sub
+  moveto lineto lineto closepath fill
+  grestore
+} bind def
+/uImotif{ % i j k l uImotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  1 sub dup 5 1 roll exch len exch sub dup 5 1 roll 3 -1 roll dup
+  5 1 roll exch 4 1 roll 3 1 roll exch 1 sub len exch sub dup 3 1 roll
+  moveto lineto lineto lineto closepath fill
+  grestore
+} bind def
+/lImotif{ % i j k l lImotif
+  gsave
+  1 min 2 div
+  0.85 mul 0.15 add 0.95  0.99
+  3 1 roll % prepare hsb color
+  sethsbcolor
+  % now produce the coordinates for lines
+  4 -1 roll 1 sub dup 5 1 roll exch 1 sub len exch sub dup 3 -1 roll exch
+  5 -1 roll len exch sub dup 6 -1 roll dup 3 1 roll 7 4 roll
+  moveto lineto lineto lineto closepath fill
+  grestore
+} bind def
+
+%data starts here
+
+%start of quadruplex data
+
+%start of Hmotif data
+
+%start of Imotif data
+
+%draw the grid
+drawgrid
+
+%start of base pair probability data
+1 6 0.004632238 ubox
+1 9 0.006654223 ubox
+1 14 0.116131258 ubox
+1 15 0.005506901 ubox
+1 30 0.009716645 ubox
+1 34 0.073740324 ubox
+1 37 0.006701873 ubox
+1 64 0.004871484 ubox
+1 73 0.570925214 ubox
+2 8 0.007083382 ubox
+2 11 0.008406236 ubox
+2 12 0.007044803 ubox
+2 13 0.129102832 ubox
+2 27 0.003166551 ubox
+2 29 0.016103198 ubox
+2 31 0.059809132 ubox
+2 32 0.018860727 ubox
+2 33 0.080458349 ubox
+2 36 0.007548805 ubox
+2 63 0.005718318 ubox
+2 69 0.007556179 ubox
+2 70 0.028650384 ubox
+2 71 0.546628270 ubox
+2 72 0.773685839 ubox
+3 7 0.004749417 ubox
+3 11 0.010358730 ubox
+3 12 0.129015255 ubox
+3 13 0.003933689 ubox
+3 28 0.016108727 ubox
+3 29 0.005358837 ubox
+3 31 0.020535925 ubox
+3 32 0.083122889 ubox
+3 62 0.005713974 ubox
+3 68 0.006646921 ubox
+3 69 0.031485159 ubox
+3 70 0.558919532 ubox
+3 71 0.770984265 ubox
+3 72 0.215962264 ubox
+4 8 0.003846249 ubox
+4 11 0.128681370 ubox
+4 13 0.011210848 ubox
+4 25 0.004019121 ubox
+4 27 0.015919907 ubox
+4 28 0.004907639 ubox
+4 29 0.064014656 ubox
+4 31 0.083429550 ubox
+4 61 0.005688924 ubox
+4 67 0.004381706 ubox
+4 68 0.030984314 ubox
+4 69 0.928667711 ubox
+4 70 0.171363563 ubox
+4 71 0.216620666 ubox
+4 72 0.007349484 ubox
+5 12 0.010780540 ubox
+5 28 0.062660548 ubox
+5 47 0.006856414 ubox
+5 67 0.030480480 ubox
+5 68 0.927409033 ubox
+5 70 0.201662161 ubox
+6 17 0.003163375 ubox
+6 20 0.004307680 ubox
+6 28 0.008183017 ubox
+6 47 0.073508582 ubox
+6 50 0.015670251 ubox
+6 59 0.003724079 ubox
+6 67 0.895370856 ubox
+6 68 0.033940401 ubox
+6 70 0.008321205 ubox
+7 16 0.003361849 ubox
+7 19 0.004518445 ubox
+7 22 0.015784771 ubox
+7 23 0.006061468 ubox
+7 26 0.014487017 ubox
+7 44 0.005844573 ubox
+7 45 0.012806982 ubox
+7 46 0.076342752 ubox
+7 48 0.020848970 ubox
+7 49 0.018126701 ubox
+7 58 0.004549362 ubox
+7 66 0.827624872 ubox
+8 15 0.003431379 ubox
+8 18 0.005204581 ubox
+8 21 0.036410380 ubox
+8 22 0.007907851 ubox
+8 26 0.044491013 ubox
+8 44 0.019732249 ubox
+8 45 0.085065889 ubox
+8 46 0.073831467 ubox
+8 48 0.244628685 ubox
+8 57 0.004318992 ubox
+8 64 0.004391699 ubox
+8 66 0.049191061 ubox
+9 17 0.005251011 ubox
+9 20 0.037521120 ubox
+9 47 0.253722300 ubox
+9 67 0.010690853 ubox
+9 68 0.010096246 ubox
+9 70 0.004399209 ubox
+10 20 0.026215970 ubox
+10 25 0.829289356 ubox
+10 36 0.006465083 ubox
+10 47 0.027737796 ubox
+10 63 0.004597663 ubox
+10 65 0.005017003 ubox
+10 67 0.005447271 ubox
+10 69 0.005544437 ubox
+11 18 0.038327522 ubox
+11 19 0.026908727 ubox
+11 22 0.008733209 ubox
+11 24 0.831795780 ubox
+11 35 0.006471634 ubox
+11 43 0.468132693 ubox
+11 45 0.252989051 ubox
+11 46 0.024187195 ubox
+12 18 0.023602891 ubox
+12 19 0.006232645 ubox
+12 21 0.008604981 ubox
+12 23 0.831740817 ubox
+12 34 0.006375561 ubox
+12 42 0.472749007 ubox
+12 44 0.251590986 ubox
+12 45 0.014945041 ubox
+13 18 0.013723928 ubox
+13 19 0.007497427 ubox
+13 22 0.831631273 ubox
+13 39 0.003427828 ubox
+13 41 0.473909293 ubox
+13 43 0.250370719 ubox
+14 20 0.066488520 ubox
+14 38 0.003182944 ubox
+14 40 0.457844605 ubox
+15 20 0.108308493 ubox
+15 38 0.011419523 ubox
+15 40 0.051301522 ubox
+16 20 0.015471478 ubox
+16 38 0.470000855 ubox
+16 40 0.178550335 ubox
+17 21 0.008767749 ubox
+17 26 0.003387803 ubox
+17 37 0.496886199 ubox
+17 39 0.177094176 ubox
+17 73 0.045173900 ubox
+18 25 0.004902375 ubox
+18 36 0.492816130 ubox
+18 38 0.121851863 ubox
+18 72 0.055748796 ubox
+19 25 0.003883170 ubox
+19 36 0.239923237 ubox
+19 38 0.005417278 ubox
+19 71 0.055691551 ubox
+20 24 0.003644610 ubox
+20 34 0.470810526 ubox
+20 35 0.247657199 ubox
+20 37 0.005831255 ubox
+21 32 0.009783764 ubox
+21 33 0.358241990 ubox
+21 70 0.054635624 ubox
+22 29 0.006362768 ubox
+22 31 0.013177914 ubox
+22 32 0.219551670 ubox
+22 33 0.403084545 ubox
+22 68 0.003789411 ubox
+22 69 0.055392027 ubox
+23 28 0.006024870 ubox
+23 32 0.500859862 ubox
+23 33 0.004324443 ubox
+23 47 0.031904991 ubox
+23 67 0.003787974 ubox
+23 68 0.052636256 ubox
+24 29 0.008474011 ubox
+24 31 0.549100761 ubox
+24 47 0.049197557 ubox
+24 67 0.030536001 ubox
+25 30 0.548338702 ubox
+25 41 0.004144135 ubox
+25 45 0.067140277 ubox
+25 46 0.053750180 ubox
+26 36 0.057394616 ubox
+26 40 0.012772171 ubox
+26 47 0.064315077 ubox
+26 50 0.004714852 ubox
+27 35 0.057448226 ubox
+27 39 0.013170691 ubox
+27 43 0.815569764 ubox
+27 45 0.049009957 ubox
+27 46 0.063413875 ubox
+27 49 0.005262423 ubox
+27 53 0.004564973 ubox
+28 34 0.054697757 ubox
+28 42 0.820379890 ubox
+28 44 0.048191892 ubox
+28 45 0.035895579 ubox
+28 46 0.029285776 ubox
+28 48 0.006599916 ubox
+28 52 0.004579520 ubox
+29 41 0.821245880 ubox
+29 43 0.046763735 ubox
+29 45 0.057920583 ubox
+29 46 0.006457134 ubox
+29 51 0.004606001 ubox
+30 36 0.024024302 ubox
+30 40 0.821070294 ubox
+30 47 0.027558338 ubox
+30 50 0.004615290 ubox
+31 35 0.023900118 ubox
+31 39 0.821259198 ubox
+31 41 0.031662456 ubox
+31 43 0.068739658 ubox
+31 45 0.005088084 ubox
+31 46 0.028387067 ubox
+31 49 0.004618779 ubox
+32 37 0.056070394 ubox
+32 39 0.007808716 ubox
+32 41 0.004679327 ubox
+32 42 0.069668252 ubox
+32 44 0.005113833 ubox
+32 45 0.028339924 ubox
+32 48 0.003694275 ubox
+33 37 0.084188349 ubox
+33 39 0.012554387 ubox
+33 41 0.069738589 ubox
+33 43 0.004988753 ubox
+33 44 0.028077519 ubox
+33 48 0.005052659 ubox
+34 38 0.015647295 ubox
+34 40 0.068716940 ubox
+34 47 0.005883003 ubox
+35 72 0.003223293 ubox
+36 41 0.028025736 ubox
+36 45 0.006071525 ubox
+37 47 0.004492398 ubox
+37 67 0.004929165 ubox
+38 46 0.004623641 ubox
+38 66 0.005612639 ubox
+38 73 0.096471321 ubox
+39 65 0.006372388 ubox
+39 72 0.134387529 ubox
+40 64 0.006366003 ubox
+40 73 0.044296160 ubox
+41 63 0.006315212 ubox
+41 71 0.157425382 ubox
+41 72 0.055795571 ubox
+42 47 0.003279277 ubox
+42 70 0.158258676 ubox
+43 63 0.003504831 ubox
+43 69 0.159460464 ubox
+43 71 0.083592343 ubox
+43 72 0.004963441 ubox
+44 67 0.003632562 ubox
+44 68 0.157762054 ubox
+44 70 0.122775573 ubox
+45 56 0.003216980 ubox
+45 62 0.033079448 ubox
+45 63 0.006333865 ubox
+45 65 0.005683413 ubox
+45 67 0.142807045 ubox
+45 68 0.102004762 ubox
+45 69 0.139542279 ubox
+45 70 0.038496405 ubox
+45 71 0.007227554 ubox
+45 72 0.051023600 ubox
+46 55 0.003223253 ubox
+46 61 0.033233869 ubox
+46 62 0.005934201 ubox
+46 65 0.014068389 ubox
+46 67 0.151344698 ubox
+46 68 0.117431569 ubox
+46 69 0.048110592 ubox
+46 70 0.005932615 ubox
+46 71 0.051023157 ubox
+47 60 0.033207628 ubox
+47 64 0.011567823 ubox
+47 66 0.169443202 ubox
+48 59 0.032419774 ubox
+48 67 0.054982355 ubox
+48 68 0.015912705 ubox
+48 70 0.010752649 ubox
+49 56 0.003800040 ubox
+49 59 0.006023614 ubox
+49 63 0.008508712 ubox
+49 65 0.996813137 ubox
+49 67 0.013145831 ubox
+49 69 0.007555919 ubox
+50 57 0.025044897 ubox
+50 58 0.008142900 ubox
+50 64 0.998396751 ubox
+50 66 0.013239028 ubox
+51 56 0.028984258 ubox
+51 62 0.014992485 ubox
+51 63 0.999154389 ubox
+51 65 0.013340412 ubox
+52 56 0.007696861 ubox
+52 61 0.018442907 ubox
+52 62 0.999085217 ubox
+52 63 0.014927477 ubox
+52 72 0.003975401 ubox
+53 61 0.997430929 ubox
+53 62 0.015882748 ubox
+53 71 0.003986825 ubox
+54 59 0.163009340 ubox
+54 70 0.003908232 ubox
+55 60 0.162646810 ubox
+56 60 0.056948332 ubox
+57 68 0.004617988 ubox
+58 67 0.004981508 ubox
+59 66 0.005078979 ubox
+60 65 0.005070973 ubox
+2 71 0.9500000 lbox
+3 70 0.9500000 lbox
+4 69 0.9500000 lbox
+5 68 0.9500000 lbox
+6 67 0.9500000 lbox
+7 66 0.9500000 lbox
+10 25 0.9500000 lbox
+11 24 0.9500000 lbox
+12 23 0.9500000 lbox
+13 22 0.9500000 lbox
+27 43 0.9500000 lbox
+28 42 0.9500000 lbox
+29 41 0.9500000 lbox
+30 40 0.9500000 lbox
+31 39 0.9500000 lbox
+49 65 0.9500000 lbox
+50 64 0.9500000 lbox
+51 63 0.9500000 lbox
+52 62 0.9500000 lbox
+53 61 0.9500000 lbox
+showpage
+end
+%%EOF
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Anolis_caro_chrUn_GL343590.trna2_AlaAGC_ss.ps	Wed Dec 20 08:38:03 2017 -0500
@@ -0,0 +1,230 @@
+%!PS-Adobe-3.0 EPSF-3.0
+%%Creator: ViennaRNA-2.2.10
+%%CreationDate: Tue Dec 19 19:42:58 2017
+%%Title: RNA Secondary Structure Plot
+%%BoundingBox: 66 210 518 662
+%%DocumentFonts: Helvetica
+%%Pages: 1
+%%EndComments
+
+%Options: 
+% to switch off outline pairs of sequence comment or
+% delete the appropriate line near the end of the file
+
+%%BeginProlog
+/RNAplot 100 dict def
+RNAplot begin
+/fsize  14 def
+/outlinecolor {0.2 setgray} bind def
+/paircolor    {0.2 setgray} bind def
+/seqcolor     {0   setgray} bind def
+/cshow  { dup stringwidth pop -2 div fsize -3 div rmoveto show} bind def
+/min { 2 copy gt { exch } if pop } bind def
+/max { 2 copy lt { exch } if pop } bind def
+/arccoords { % i j arccoords
+  % puts optimal x1 y1 x2 y2 coordinates used in bezier curves from i to j
+  % onto the stack
+  dup 3 -1 roll dup 4 -1 roll lt dup dup 5 2 roll {exch} if
+  dup 3 -1 roll dup 3 -1 roll exch sub 1 sub dup
+  4 -2 roll 5 -1 roll {exch} if 4 2 roll
+  sequence length dup 2 div exch 3 1 roll lt 
+  {exch 5 -1 roll pop 4 -2 roll exch 4 2 roll}
+  { 4 2 roll 5 -1 roll dup 6 1 roll {exch} if
+    4 -2 roll exch pop dup 3 -1 roll dup 4 1 roll
+    exch add 4 -1 roll dup 5 1 roll sub 1 sub
+    5 -1 roll not {4 -2 roll exch 4 2 roll} if
+  }ifelse
+   % compute the scalingfactor and prepare (1-sf) and sf*r
+  2 mul exch cpr 3 1 roll div dup
+  3 -1 roll mul exch 1 exch sub exch
+   % compute the coordinates
+  3 -1 roll 1 sub coor exch get aload pop % get coord for i
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate y1
+  4 -1 roll dup 5 1 roll mul 3 -1 roll dup 4 1 roll add exch % calculate x1
+  5 -1 roll 1 sub coor exch get aload pop % get coord for j
+  % duplicate j coord
+  dup 3 -1 roll dup 4 1 roll exch 8 2 roll
+  6 -1 roll dup 7 1 roll mul 5 -1 roll dup 6 1 roll add exch % calculate y2
+  6 -1 roll mul 5 -1 roll add exch % calculate x2
+  6 -2 roll % reorder
+} bind def
+/drawoutline {
+  gsave outlinecolor newpath
+  coor 0 get aload pop 0.8 0 360 arc % draw 5' circle of 1st sequence
+  currentdict /cutpoint known        % check if cutpoint is defined
+  {coor 0 cutpoint getinterval
+   {aload pop lineto} forall         % draw outline of 1st sequence
+   coor cutpoint 1 add get aload pop
+   2 copy moveto 0.8 0 360 arc       % draw 5' circle of 2nd sequence
+   coor cutpoint 1 add coor length cutpoint 1 add sub getinterval
+   {aload pop lineto} forall}        % draw outline of 2nd sequence
+  {coor {aload pop lineto} forall}   % draw outline as a whole
+  ifelse
+  stroke grestore
+} bind def
+/drawpairs {
+  paircolor
+  0.7 setlinewidth
+  [9 3.01] 9 setdash
+  newpath
+  pairs {aload pop
+      currentdict (cpr) known
+      { exch dup
+        coor  exch 1 sub get aload pop moveto
+        exch arccoords curveto
+      }
+      { coor exch 1 sub get aload pop moveto
+        coor exch 1 sub get aload pop lineto
+      }ifelse
+  } forall
+  stroke
+} bind def
+% draw bases
+/drawbases {
+  [] 0 setdash
+  seqcolor
+  0
+  coor {
+    aload pop moveto
+    dup sequence exch 1 getinterval cshow
+    1 add
+  } forall
+  pop
+} bind def
+
+/init {
+  /Helvetica findfont fsize scalefont setfont
+  1 setlinejoin
+  1 setlinecap
+  0.8 setlinewidth
+  72 216 translate
+  % find the coordinate range
+  /xmax -1000 def /xmin 10000 def
+  /ymax -1000 def /ymin 10000 def
+  coor {
+      aload pop
+      dup ymin lt {dup /ymin exch def} if
+      dup ymax gt {/ymax exch def} {pop} ifelse
+      dup xmin lt {dup /xmin exch def} if
+      dup xmax gt {/xmax exch def} {pop} ifelse
+  } forall
+  /size {xmax xmin sub ymax ymin sub max} bind def
+  72 6 mul size div dup scale
+  size xmin sub xmax sub 2 div size ymin sub ymax sub 2 div
+  translate
+} bind def
+end
+%%EndProlog
+RNAplot begin
+% data start here
+/sequence (\
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA\
+) def
+/coor [
+[102.34599304 225.12051392]
+[110.41094971 210.84155273]
+[109.77433014 195.85507202]
+[109.13771057 180.86859131]
+[108.50109100 165.88211060]
+[107.86447144 150.89561462]
+[107.22785950 135.90913391]
+[90.28739166 133.48460388]
+[77.11851501 123.91786957]
+[70.32070923 110.05319977]
+[55.37474823 111.32528687]
+[40.42878342 112.59737396]
+[25.48282242 113.86946106]
+[17.57515907 127.22043610]
+[3.31690264 133.34266663]
+[-11.80935574 129.88204956]
+[-21.98726082 118.16923523]
+[-23.30319977 102.70806122]
+[-15.25116920 89.44365692]
+[-0.92733771 83.47645569]
+[14.16048908 87.10096741]
+[24.21073341 98.92350006]
+[39.15669632 97.65141296]
+[54.10265732 96.37932587]
+[69.04862213 95.10723114]
+[75.20735168 80.83619690]
+[87.46604156 71.28019714]
+[84.93103027 56.49596024]
+[82.39601898 41.71172333]
+[79.86100006 26.92748451]
+[77.32598877 12.14324570]
+[63.73017883 4.41744947]
+[58.32971573 -10.25800610]
+[63.67453384 -24.95381927]
+[77.24097443 -32.73107910]
+[92.62337494 -29.91759682]
+[102.55863953 -17.84181786]
+[102.35564423 -2.20555139]
+[92.11022949 9.60823345]
+[94.64524078 24.39247131]
+[97.18025208 39.17671204]
+[99.71526337 53.96094894]
+[102.25028229 68.74518585]
+[111.61898041 69.95008087]
+[120.45154572 73.97383881]
+[127.89853668 80.59681702]
+[133.19635010 89.34370422]
+[135.74378967 99.51597595]
+[135.16680908 110.24712372]
+[150.04531860 112.15238953]
+[164.92382812 114.05766296]
+[179.80232239 115.96292877]
+[194.68083191 117.86819458]
+[206.04914856 107.13062286]
+[221.66270447 106.26418304]
+[234.14927673 115.67798615]
+[237.61306763 130.92712402]
+[230.41859436 144.81141663]
+[215.96286011 150.77513123]
+[201.07142639 146.00236511]
+[192.77557373 132.74670410]
+[177.89706421 130.84143066]
+[163.01855469 128.93617249]
+[148.14004517 127.03089905]
+[133.26153564 125.12563324]
+[122.21434021 135.27252197]
+[122.85095978 150.25900269]
+[123.48757935 165.24548340]
+[124.12419128 180.23197937]
+[124.76081085 195.21846008]
+[125.39743042 210.20494080]
+[134.64427185 223.74850464]
+[127.29573059 238.40902710]
+] def
+/pairs [
+[2 71]
+[3 70]
+[4 69]
+[5 68]
+[6 67]
+[7 66]
+[10 25]
+[11 24]
+[12 23]
+[13 22]
+[27 43]
+[28 42]
+[29 41]
+[30 40]
+[31 39]
+[49 65]
+[50 64]
+[51 63]
+[52 62]
+[53 61]
+] def
+
+init
+
+% switch off outline pairs or bases by removing these lines
+drawoutline
+drawpairs
+drawbases
+% show it
+showpage
+end
+%%EOF
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnaalifold_input1.fa
--- a/test-data/rnaalifold_input1.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnaalifold_input1.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL34
+>Anolis_caro_chrUn_GL34
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL35
+>Anolis_caro_chrUn_GL35
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnaduplex_input1.fa
--- a/test-data/rnaduplex_input1.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnaduplex_input1.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnaduplex_result1.txt
--- a/test-data/rnaduplex_result1.txt	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnaduplex_result1.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -1,3 +1,3 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC
 .((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))).   1,73  :   1,72  (-40.70)
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnafold_input1.fa
--- a/test-data/rnafold_input1.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnafold_input1.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2_AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3_AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnafold_input2.fa
--- a/test-data/rnafold_input2.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnafold_input2.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnafold_result1.txt
--- a/test-data/rnafold_result1.txt	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnafold_result1.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -1,14 +1,6 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-A
+>Anolis_caro_chrUn_GL343590.trna2_AlaAGC
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
-,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
-.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
-.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88}
- frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 
->Anolis_carolinensis_chrUn_GL343207.trna3-A
+>Anolis_caro_chrUn_GL343207.trna3_AlaAGC
 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
 (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
-(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88]
-(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64}
-(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 MEA=71.81}
- frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15  
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnafold_result1_mea.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result1_mea.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -0,0 +1,14 @@
+>Anolis_caro_chrUn_GL343590.trna2_AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88}
+ frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 
+>Anolis_caro_chrUn_GL343207.trna3_AlaAGC
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88]
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64}
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 MEA=71.81}
+ frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15  
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnafold_result1_pf.txt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/rnafold_result1_pf.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -0,0 +1,12 @@
+>Anolis_caro_chrUn_GL343590.trna2_AlaAGC
+UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
+,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
+.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
+ frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 
+>Anolis_caro_chrUn_GL343207.trna3_AlaAGC
+GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). (-29.60)
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). [-29.88]
+(((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). {-29.60 d=0.64}
+ frequency of mfe structure in ensemble 0.63265; ensemble diversity 1.15  
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnafold_result2.txt
--- a/test-data/rnafold_result2.txt	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnafold_result2.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -1,14 +1,6 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-A
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
 ..(((.....((((....((..(((....)))..))...)))).....(((((.......)))))....))). ( -3.37)
-.{((,..,..{(({.,{,.{,.(((....)))},.}},.}}}},,..,(((((.......)))))..,,})). [ -7.81]
-...........((...(.....(((....)))....)...))......(((((.......)))))........ {  2.85 d=11.83}
-.((........(((..(.....(((....)))....)..)))......(((((.......))))).....)). {  1.96 MEA=51.92}
- frequency of mfe structure in ensemble 0.00162209; ensemble diversity 17.27 
->Anolis_carolinensis_chrUn_GL343207.trna3-A
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC
 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
 (((((..((.(((.....((..(((....)))..))......))).))(((((.......)))))..))))). ( -5.02)
-(((((..,..{({...{,.{.,{((....))),..},,..,.}},.,,(((((.......))))).,))))). [ -9.30]
-(((((.................(((....)))................(((((.......)))))..))))). { -4.42 d=10.17}
-(((((......((.........(((....)))..........))....(((((.......)))))..))))). { -2.50 MEA=54.73}
- frequency of mfe structure in ensemble 0.00205781; ensemble diversity 15.91 
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnafold_result3.txt
--- a/test-data/rnafold_result3.txt	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnafold_result3.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -1,7 +1,3 @@
 >Sequence
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. (-22.00)
-,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)), [-23.20]
-.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 d=9.72}
-.((((((..((((........)))).(((((.......))))).....(((((.......))))))))).)). {-21.90 MEA=58.88}
- frequency of mfe structure in ensemble 0.142309; ensemble diversity 14.51 
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnalfold_input1.fa
--- a/test-data/rnalfold_input1.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnalfold_input1.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnalfold_result1.txt
--- a/test-data/rnalfold_result1.txt	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnalfold_result1.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 .((((....)))).	( -0.10)	56
 .(((..((((....)))).))).	( -3.40)	51
 .(((((.......))))).	( -7.70)	48
@@ -13,7 +13,7 @@
 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).	(-22.00)	1
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
  (-22.00)
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 .(((..((((....)))).))).	( -3.40)	51
 .(((((.......))))).	( -9.20)	48
 .((((..(((((.......)))))..)))).	(-11.80)	42
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnapaln_input1.fa
--- a/test-data/rnapaln_input1.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnapaln_input1.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnapaln_result1.txt
--- a/test-data/rnapaln_result1.txt	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnapaln_result1.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -1,5 +1,5 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 68.8844
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
 ,((((((..((((........)))).(((((.......))))).....(((((.......))))))))),)),
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnapdist_input1.fa
--- a/test-data/rnapdist_input1.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnapdist_input1.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnapdist_result1.txt
--- a/test-data/rnapdist_result1.txt	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnapdist_result1.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -1,3 +1,3 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 8.66253
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnapkplex_input1.fa
--- a/test-data/rnapkplex_input1.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnapkplex_input1.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnapkplex_result1.txt
--- a/test-data/rnapkplex_result1.txt	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnapkplex_result1.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -1,6 +1,6 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA
 .((((((..((((........)))).(((((.......))))).[[[.(((((]]]....))))))))))).. (-31.90)
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA
 (((((((..((((..[[[.[[)))).(((((.]].]]]))))).....(((((.......)))))))))))). (-38.54)
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnaplex_input1.fa
--- a/test-data/rnaplex_input1.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnaplex_input1.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnaplex_result1.txt
--- a/test-data/rnaplex_result1.txt	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnaplex_result1.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 .((((((..((......((((...((((..(((.((((((.......((((((..(..((((...(((((((.&)))))))..........))))..)..))))))..))))))..)))..)))).......)))).)))))))).   1,73  :   1,72  (-40.70) i:72,j:1 <-41.26>
 
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnaplfold_input1.fa
--- a/test-data/rnaplfold_input1.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnaplfold_input1.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-A (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-A (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnaplot_input1.fa
--- a/test-data/rnaplot_input1.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnaplot_input1.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnasubopt_input1.fa
--- a/test-data/rnasubopt_input1.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnasubopt_input1.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnasubopt_result1.txt
--- a/test-data/rnasubopt_result1.txt	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnasubopt_result1.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -1,7 +1,7 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-A [0]
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC [0]
 UGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGUGAGAGGUAGUGGGAUCGAUGCCCACAUUCUCCA -22.00   0.00
 (((((((..((((........)))).(((((.......))))).....(((((.......))))))))).))) -22.00
 .((((((..((((........)))).(((((.......))))).....(((((.......))))))))))).. -22.00
->Anolis_carolinensis_chrUn_GL343207.trna3-A [0]
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC [0]
 GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA -29.60   0.00
 (((((((..((((........)))).(((((.......))))).....(((((.......)))))))))))). -29.60
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnaup_input1.fa
--- a/test-data/rnaup_input1.fa	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnaup_input1.fa	Wed Dec 20 08:38:03 2017 -0500
@@ -1,4 +1,4 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC (218800-218872)  Ala (AGC) 73 bp  Sc: 49.55
 TGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGTGAGAGGTAGTGGGATCGATGCCCACATTCTCCA
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC (1513626-1513698)  Ala (AGC) 73 bp  Sc: 56.15
 GGGGAATTAGCTCAAATGGTAGAGCGCTCGCTTAGCATGCGAGAGGTAGCGGGATTGATGCCCGCATTCTCCA
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/rnaup_result1.txt
--- a/test-data/rnaup_result1.txt	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/rnaup_result1.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -1,6 +1,6 @@
->Anolis_carolinensis_chrUn_GL343590.trna2-AlaAGC
+>Anolis_caro_chrUn_GL343590.trna2-AlaAGC
   55,  58 	 (0.019) 	 for u=  4
-RNAup output in file: Anolis_carolinensis_chrUn_GL343590.trna2-A_u1.out
->Anolis_carolinensis_chrUn_GL343207.trna3-AlaAGC
+RNAup output in file: Anolis_caro_chrUn_GL343590.trna2-AlaAGC_u1.out
+>Anolis_caro_chrUn_GL343207.trna3-AlaAGC
   16,  19 	 (0.004) 	 for u=  4
-RNAup output in file: Anolis_carolinensis_chrUn_GL343207.trna3-A_u1.out
+RNAup output in file: Anolis_caro_chrUn_GL343207.trna3-AlaAGC_u1.out
diff -r 16d733b920d8 -r 61e51eabbb95 test-data/sample_3_result.txt
--- a/test-data/sample_3_result.txt	Thu Sep 28 16:27:10 2017 -0400
+++ b/test-data/sample_3_result.txt	Wed Dec 20 08:38:03 2017 -0500
@@ -1,21 +1,9 @@
 >SECIS_1
 AUUUUAUCCAUGAAAGUGUUUCCUCUAAACCUAUGUGGAGGAACACCUGAUGUCCAGGAAAAU
 .((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. (-27.97)
-.((((...(((.{..(((.((((((((........))))))))))).}.))).....)))}.. [-29.13]
-..(((...(((....(((.((((((((........)))))))))))...))).....)))... {-26.59 d=5.82}
-.((((...(((.(..(((.((((((((........))))))))))).).))).....)))).. {-27.97 MEA=54.87}
- frequency of mfe structure in ensemble 0.151171; ensemble diversity 8.50
 >6S_1
 GAAACCCUAAUGUAUUCGAUAUAGUUCCUGAUAUUUUUGAACCGAACAAUUUUUUAUACCUAGGGAGCUUGGAGUUCCGGCGCGGCGCACAUGCCUUCACACGAGGAAGUGCAAACCGUUAGACAGAGCACCCACCUGCUUUAAUUGAGAGCGGGUUCAAAGGAAGGGAAUCCUAAACGGUACGAUUGGGGUUUCU
 (((((((...(((((.((.....((((((....((((((((((...................(((.((((.....((.((((.(..((((.(.((((.....))))).))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))))......)))))))....))))))). (-110.38)
-(((((((,,{(((((,((.....{(((((....(((((((((({{{....,},.........(((.((((.....((.((((.(..((((.{.((((.....)))),.))))...))))).))}.)))).)))....(((((.....))))).))))))))))..))))),......))))))).}.,))))))). [-115.12]
-(((((((..((((((.((......(((((....((((((((((...................(((.((((.....((.((((.(..((((...((((.....))))..))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))).......))))))).)..))))))). {-109.37 d=10.73}
-(((((((..((((((.((......(((((....((((((((((...................(((.((((.....((.((((.(..((((...((((.....))))..))))...))))).))..)))).)))....(((((.....))))).))))))))))..))))).......))))))).)..))))))). {-109.37 MEA=177.59}
- frequency of mfe structure in ensemble 0.000456946; ensemble diversity 17.02
 >6S_2
 UUGUCCCUGCCGUGCUCGUGACUUGGCCAUACAUUCUCUGAACCUAUGUCUUACGGCAUAUGGGUUGCGGGAGUGUAGAGCUGGAGUGAUCGUCUACUCGUAGACGAACCCGAUGCUCUUCGGAUCGCGACCACCUUGAACCUCAGGGUUCGAGAUGCCGGCCUUGACGGCACAGGCGGGGCAUC
 .((.(((((((((((.(((.(...((((...((.((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))))..)))).).))))))).))))))))).. (-129.27)
-.((,(((((((((((.(((.{...((((...,,.((((.((((((..(((....))).....((((((((...{(.(((((.((.((..((((((,....,))))))))))...))))).)}..)))))))).....,,...,,.)))))))))),}..)))).}.))))))).))))))))).. [-132.48]
-.((.(((((((((((.(((.(...((((......((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............))))))))))....)))).).))))))).))))))))).. {-129.23 d=10.34}
-.((.(((((((((((.(((.(...((((...(..((((.((((((..(((....))).....((((((((...((.(((((.((.((..((((((......))))))))))...))))).))..)))))))).............)))))))))).)..)))).).))))))).))))))))).. {-128.23 MEA=168.16}
- frequency of mfe structure in ensemble 0.00547171; ensemble diversity 14.91