view test-data/rnaplfold_result2.ps @ 4:ca3bcfa20101 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/rna_tools/vienna_rna commit 746497a64b955f6b9afc1944d1c1d8d877e53267

%!PS-Adobe-3.0 EPSF-3.0
%%Title: RNA Dot Plot
%%Creator: ViennaRNA-2.2.10
%%CreationDate: Tue Oct  4 14:45:55 2016
%%BoundingBox: 66 530 520 650
%%DocumentFonts: Helvetica
%%Pages: 1
%%EndComments

%Options: 
%This file contains the square roots of the base pair probabilities in the form
% i  j  sqrt(p(i,j)) ubox

%%BeginProlog
/DPdict 100 dict def
DPdict begin
/logscale false def
/lpmin 1e-05 log def

/box { %size x y box - draws box centered on x,y
   2 index 0.5 mul sub            % x -= 0.5
   exch 2 index 0.5 mul sub exch  % y -= 0.5
   3 -1 roll dup rectfill
} bind def

/ubox {
   logscale {
      log dup add lpmin div 1 exch sub dup 0 lt { pop 0 } if
   } if
   3 1 roll
   exch len exch sub 1 add box
} bind def

/lbox {
   3 1 roll
   len exch sub 1 add box
} bind def

/drawseq {
% print sequence along all 4 sides
[ [0.7 -0.3 0 ]
  [0.7 0.7 len add 0]
  [-0.3 len sub -0.4 -90]
  [-0.3 len sub 0.7 len add -90]
] {
   gsave
    aload pop rotate translate
    0 1 len 1 sub {
     dup 0 moveto
     sequence exch 1 getinterval
     show
    } for
   grestore
  } forall
} bind def

/drawgrid{
  0.01 setlinewidth
  len log 0.9 sub cvi 10 exch exp  % grid spacing
  dup 1 gt {
     dup dup 20 div dup 2 array astore exch 40 div setdash
  } { [0.3 0.7] 0.1 setdash } ifelse
  0 exch len {
     dup dup
     0 moveto
     len lineto
     dup
     len exch sub 0 exch moveto
     len exch len exch sub lineto
     stroke
  } for
  [] 0 setdash
  0.04 setlinewidth
  currentdict /cutpoint known {
    cutpoint 1 sub
    dup dup -1 moveto len 1 add lineto
    len exch sub dup
    -1 exch moveto len 1 add exch lineto
    stroke
  } if
  0.5 neg dup translate
} bind def

end
%%EndProlog
DPdict begin
%delete next line to get rid of title
270 665 moveto /Helvetica findfont 14 scalefont setfont (Anolis_carolinensis_chrUn_GL343207.trna3-A) show

/sequence { (\
GGGGAAUUAGCUCAAAUGGUAGAGCGCUCGCUUAGCAUGCGAGAGGUAGCGGGAUUGAUGCCCGCAUUCUCCA\
) } def
/winSize 70 def
/len { sequence length } bind def

292 416 translate
72 6 mul len 1 add winSize add 2 sqrt mul div dup scale
/Helvetica findfont 0.95 scalefont setfont

/drawseq_turn {% print sequence at bottom
   gsave
   len 2 sqrt div dup neg 0.28 add exch 0.78 sub translate
    0 1 len 1 sub {
     dup dup 2 sqrt mul 0 moveto
     sequence exch 1 getinterval
     show
    } for
   grestore
} bind def
/drawgrid_turn{
  0.01 setlinewidth
  len log 0.9 sub cvi 10 exch exp  % grid spacing
  dup 1 gt {
     dup dup 20 div dup 2 array astore exch 40 div setdash
  } { [0.3 0.7] 0.1 setdash } ifelse
  0 exch len {    %for (0, gridspacing, len) 
     dup dup      %duplicate what - gridspacing??
     dup len exch sub moveto     %moveto diagonal?
     dup winSize gt
     {dup dup len exch sub winSize add lineto}
     {dup len lineto}ifelse
     dup len exch sub moveto  %moveto diagonal?
     dup len winSize sub le
     {dup dup len exch sub dup winSize exch sub len add exch lineto}
     {dup dup len exch sub len exch lineto}ifelse     stroke pop pop
  } for
  len log 0.9 sub cvi 10 exch exp  % grid spacing
      dup 1 gt {
          dup dup 20 div dup 2 array astore exch 40 div setdash
      } { [0.3 0.7] 0.1 setdash } ifelse
      0 exch len {    %for (0, gridspacing, len) 
     dup dup      %duplicate what - gridspacing??
     dup len exch sub moveto     %moveto diagonal?
     len exch sub 0.7 sub exch 0.7 sub exch lineto
     stroke
   }for
 winSize len moveto  len winSize  lineto stroke
  [] 0 setdash
  0.04 setlinewidth 
  currentdict /cutpoint known {
    cutpoint 1 sub
    dup dup -1 moveto len 1 add lineto
    len exch sub dup
    -1 exch moveto len 1 add exch lineto
   stroke
  } if
  0.5 neg dup translate
} bind def 

0.5 dup translate
drawseq_turn
45 rotate


%draw the grid
drawgrid_turn

%start of base pair probability data
2 70 0.1914 ubox
2 71 0.9787 ubox
3 69 0.1660 ubox
3 70 0.7676 ubox
3 72 0.8449 ubox
4 68 0.1377 ubox
4 69 0.7113 ubox
4 71 0.4928 ubox
5 67 0.1266 ubox
5 68 0.7090 ubox
5 70 0.3955 ubox
6 67 0.6860 ubox
7 66 0.6345 ubox
10 25 0.9888 ubox
11 24 0.9915 ubox
12 23 0.9914 ubox
13 22 0.9913 ubox
15 20 0.1291 ubox
17 73 0.1217 ubox
18 72 0.1091 ubox
27 43 0.9522 ubox
28 42 0.9836 ubox
29 41 0.9874 ubox
30 40 0.9886 ubox
31 39 0.9883 ubox
33 37 0.1014 ubox
38 73 0.1170 ubox
39 72 0.1080 ubox
41 71 0.1523 ubox
42 70 0.1341 ubox
43 69 0.1387 ubox
43 71 0.2800 ubox
44 68 0.1392 ubox
44 70 0.3364 ubox
45 67 0.1266 ubox
45 68 0.1838 ubox
45 69 0.3586 ubox
45 72 0.3252 ubox
46 67 0.2524 ubox
46 68 0.3007 ubox
46 69 0.1142 ubox
46 71 0.2655 ubox
47 66 0.2807 ubox
48 67 0.1394 ubox
49 65 0.9981 ubox
50 64 0.9997 ubox
51 63 0.9997 ubox
52 62 0.9997 ubox
53 61 0.9981 ubox
54 59 0.1565 ubox
55 60 0.3242 ubox
showpage
end
%%EOF