Mercurial > repos > shians > shrnaseq
diff hairpinTool.xml @ 13:7aaa9bc23e3c
Added support for paired end reads
- Changed terminology to generalise to sgRNA CRISPR experiments.
- Added option to include second factor for statistical power
- Added option to filter out samples with low counts
- Added support for paired end reads
- Added option to highlight only positive or negative fold change in smear plot
- Fixed bug that caused tool to stop if more than enough sample annotations
were supplied
| author | shian_su <registertonysu@gmail.com> |
|---|---|
| date | Tue, 14 Oct 2014 17:05:07 +1100 |
| parents | c0a76e30d61b |
| children | 44130e484a97 |
line wrap: on
line diff
--- a/hairpinTool.xml Wed Oct 01 16:00:43 2014 +1000 +++ b/hairpinTool.xml Tue Oct 14 17:05:07 2014 +1100 @@ -1,12 +1,13 @@ -<tool id="shRNAseq" name="shRNAseq Tool" version="1.0.13"> +<tool id="shRNAseq" name="shRNAseq Tool" version="1.2.0"> <description> - Analyse hairpin differential representation using edgeR + Analyse differential representation for shRNAseq and sgRNA based procedures + using edgeR package from Bioconductor. </description> <requirements> - <requirement type="R-module" version="3.6.2">edgeR</requirement> - <requirement type="R-module" version="3.20.7">limma</requirement> - <requirement type="package" version="3.0.3">R_3_0_3</requirement> + <requirement type="R-module" version="3.7.17">edgeR</requirement> + <requirement type="R-module" version="3.21.16">limma</requirement> + <requirement type="package" version="3.1.1">R_3_0_3</requirement> </requirements> <stdio> @@ -14,43 +15,90 @@ </stdio> <command interpreter="Rscript"> - hairpinTool.R $inputOpt.inputType + ampliconTool.R $inputOpt.inputType #if $inputOpt.inputType=="fastq": + #for $i, $fas in enumerate($inputOpt.fastq): fastq::$fas.file #end for $inputOpt.hairpin $inputOpt.samples + + #if $inputOpt.positions.posOption=="yes": + $inputOpt.positions.barstart + $inputOpt.positions.barend + 0 + 0 + $inputOpt.positions.hpstart + $inputOpt.positions.hpend + #else: + 1 + 5 + 0 + 0 + 37 + 57 + #end if + #elif $inputOpt.inputType=="pairedFastq": + + #for $i, $fas in enumerate($inputOpt.fastq): + fastq::$fas.file + #end for + + #for $i, $fas in enumerate($inputOpt.fastq): + fastqRev::$fas.fileRev + #end for + + $inputOpt.hairpin + $inputOpt.samples #if $inputOpt.positions.posOption=="yes": $inputOpt.positions.barstart $inputOpt.positions.barend + $inputOpt.positions.barstartRev + $inputOpt.positions.barendRev $inputOpt.positions.hpstart $inputOpt.positions.hpend #else: 1 5 + 0 + 0 37 57 #end if - #else: + + #elif $inputOpt.inputType=="counts": $inputOpt.counts $inputOpt.hairpin $inputOpt.samples - 0 0 0 + 0 + 0 + 0 + 0 + 0 #end if - + + #if $inputOpt.secondaryFactor.secFactorOpt=="yes": + $inputOpt.secondaryFactor.secFactName + #else: + "none" + #end if + #if $filterCPM.filtOption=="yes": $filterCPM.cpmReq $filterCPM.sampleReq + $filterCPM.readReq #else: -Inf -Inf + -Inf #end if $fdr $lfc + $direction $workMode.mode $outFile $outFile.files_path @@ -61,6 +109,7 @@ #elif $workMode.mode=="glm": "$workMode.contrast" $workMode.roast.roastOption + #if $workMode.roast.roastOption=="yes": $workMode.roast.hairpinReq $workMode.roast.select.selOption @@ -70,20 +119,22 @@ 0 0 #end if + #end if </command> <inputs> <conditional name="inputOpt"> + <param name="inputType" type="select" label="Input File Type"> <option value="fastq">FastQ File</option> + <option value="pairedFastq">Paired FastQ File</option> <option value="counts">Table of Counts</option> </param> - + <when value="fastq"> <param name="hairpin" type="data" format="tabular" - label="Hairpin Annotation"/> - + label="Target Annotation"/> <param name="samples" type="data" format="tabular" label="Sample Annotation"/> @@ -91,47 +142,171 @@ <repeat name="fastq" title="FastQ Files"> <param name="file" type="data" format="fastq"/> </repeat> + + <conditional name="secondaryFactor"> + <param name="secFactorOpt" type="select" + label="Include Secondary Factor"> + + <option value="no" selected="True">No</option> + + <option value="yes">Yes</option> + + </param> + + <when value="yes"> + + <param name="secFactName" type="text" label="Secondary Factor Name" + size="80"/> + + </when> + + <when value="no"> + </when> + </conditional> + <conditional name="positions"> <param name="posOption" type="select" - label="Specify Barcode and Hairpin Locations?" - help="Default Positions: Barcode: 1 to 5, Hairpin: 37 to 57."> + label="Specify Sample Index and Target Sequence Locations?" + help="Default Positions: Index: 1 to 5, Target: 37 to 57."> <option value="no" selected="True">No</option> <option value="yes">Yes</option> </param> <when value="yes"> <param name="barstart" type="integer" value="1" - label="Barcode Starting Position"/> + label="Index Starting Position"/> <param name="barend" type="integer" value="5" - label="Barcode Ending Position"/> + label="Index Ending Position"/> <param name="hpstart" type="integer" value="37" - label="Hairpin Starting Position"/> + label="Target Starting Position"/> <param name="hpend" type="integer" value="57" - label="Hairpin Ending Position"/> + label="Target Ending Position"/> </when> <when value="no"/> </conditional> </when> - + + <when value="pairedFastq"> + <param name="hairpin" type="data" format="tabular" + label="Target Sequence Annotation"/> + + <param name="samples" type="data" format="tabular" + label="Sample Annotation"/> + + <repeat name="fastq" title="FastQ Files"> + <param name="file" type="data" format="fastq"/> + <param name="fileRev" type="data" format="fastq"/> + </repeat> + + <conditional name="secondaryFactor"> + + <param name="secFactorOpt" type="select" + label="Include Secondary Factor"> + + <option value="no" selected="True">No</option> + + <option value="yes">Yes</option> + + </param> + + <when value="yes"> + + <param name="secFactName" type="text" label="Secondary Factor Name" + size="80"/> + + </when> + + <when value="no"> + </when> + </conditional> + + <conditional name="positions"> + + <param name="posOption" type="select" + label="Specify Sample Index and Target Sequence Locations?" + help="Default Positions: Index: 1 to 5, Input required for + reverse end, Target: 37 to 57."> + + <option value="no" selected="True">No</option> + + <option value="yes">Yes</option> + + </param> + + <when value="yes"> + <param name="barstart" type="integer" value="1" + label="Index Starting Position"/> + + <param name="barend" type="integer" value="5" + label="Index Ending Position"/> + + <param name="barstartRev" type="integer" value="0" + label="Reverse Index Starting Position"/> + + <param name="barendRev" type="integer" value="0" + label="Reverse Index Ending Position"/> + + <param name="hpstart" type="integer" value="37" + label="Target Starting Position"/> + + <param name="hpend" type="integer" value="57" + label="Target Ending Position"/> + </when> + + <when value="no"> + </when> + + </conditional> + + </when> + <when value="counts"> + <param name="counts" type="data" format="tabular" label="Counts Table"/> + <param name="hairpin" type="data" format="tabular" - label="Hairpin Annotation"/> + label="Target Sequence Annotation"/> + <param name="samples" type="data" format="tabular" label="Sample Annotation"/> + + <conditional name="secondaryFactor"> + + <param name="secFactorOpt" type="select" + label="Include Secondary Factor"> + + <option value="no" selected="True">No</option> + + <option value="yes">Yes</option> + + </param> + + <when value="yes"> + + <param name="secFactName" type="text" label="Secondary Factor Name" + size="80"/> + + </when> + + <when value="no"> + </when> + + </conditional> + </when> + </conditional> <conditional name="filterCPM"> <param name="filtOption" type="select" label="Filter Low CPM?" - help="Ignore hairpins with very low representation when performing - analysis."> + help="Ignore target sequences with very low representation when + performing analysis."> <option value="yes">Yes</option> - <option value="no">No</option> + <option value="no">No</option> </param> <when value="yes"> @@ -142,6 +317,12 @@ label="Minimum Samples" help="Filter out all the genes that do not meet the minimum CPM in at least this many samples."/> + + <param name="readReq" type="integer" value="1000" min="0" + label="Minimum Reads" + help="Filter out all samples that do not have the minimum + number of reads."/> + </when> <when value="no"/> @@ -175,17 +356,18 @@ <conditional name="roast"> <param name="roastOption" type="select" label="Perform Gene Level Analysis?" - help="Analyse LogFC tendencies for hairpins belonging - to the same gene."> + help="Analyse LogFC tendencies for target sequences belonging + to the same gene. NOTE: this is a slow procedure that + scales badly with the number of genes analysed."> <option value="no">No</option> <option value="yes">Yes</option> </param> <when value="yes"> <param name="hairpinReq" type="integer" value="2" min="2" - label="Minimum Hairpins" - help="Only genes with at least this many hairpins will - be analysed."/> + label="Minimum Targets Found" + help="Only genes with at least this many target sequences + found will be analysed."/> <conditional name="select"> <param name="selOption" type="select" @@ -223,25 +405,33 @@ label="FDR Threshold" help="All observations below this threshold will be highlighted in the smear plot."/> + <param name="lfc" type="float" value="0" min="0" label="Absolute LogFC Threshold" help="In additional to meeting the FDR requirement, the absolute value of the log-fold-change of the observation must be above this threshold to be highlighted."/> + + <param name="direction" type="select" label="Highlight Option" + help="Only hightlight positive or negative fold changes in smear plot?"> + <option value="all">Default</option> + <option value="up">Positive Only</option> + <option value="down">Negative Only</option> + </param> </inputs> <outputs> - <data format="html" name="outFile" label="shRNAseq Analysis"/> + <data format="html" name="outFile" label="TagSeq Analysis"/> </outputs> <help> .. class:: infomark **What it does** -Given tables containing information about the hairpins and their associated -barcodes, information about the samples and fastq file containing the hairpin -reads. This tool will generate plots and tables for the analysis of differential -representation. +Given tables containing information about the hairpins/sgRNA and their +associated sample indices, information about the samples and fastq file +containing the sequencing reads. This tool will generate plots and tables for +the analysis of differential representation. .. class:: infomark @@ -257,14 +447,15 @@ **Input File Type:** This tool is able to either generate counts from a raw FastQ file given the -information regarding the samples and hairpins. Alternatively if a table of -counts has already been generated it can also be used. +information regarding the samples and hairpins/sgRNA. Alternatively if a table +of counts has already been generated it can also be used. **Counts Table (Counts Input):** -A tab delimited text table of information regarding the counts of hairpins. -Should have a column 'ID' to denote the hairpins that counts correspond to. Each -additional column should have titles corresponding to the label for the sample. +A tab delimited text table of information regarding the counts of +hairpins/sgRNA. Should have a column 'ID' to denote the hairpins/sgRNA that +counts correspond to. Each additional column should have titles corresponding to +the label for the sample. Example:: @@ -281,62 +472,80 @@ Hairpin7 49501 49076 47611 ... -**Hairpin Annotation:** +**Target Sequence Annotation:** -A tab delimited text table of information regarding the hairpins. Should have -columns 'ID', 'Sequences' and 'Gene' to uniquely identify the hairpin, align it -with the reads to produce counts and identify which gene the hairpin acts on. +A tab delimited text table of information regarding the targetted +hairpins/sgRNA sequence. Should have columns 'ID', 'Sequences' and 'Gene' to +uniquely identify the target, align it with the reads to produce counts and +identify which gene the target acts on. NOTE: the column names are case sensitive and should be input exactly as they are shown here. Example:: - ID Sequences Gene - Control1 TCTCGCTTGGGCGAGAGTAAG 2 - Control2 CCGCCTGAAGTCTCTGATTAA 2 - Control3 AGGAATTATAATGCTTATCTA 2 - Hairpin1 AAGGCAGAGACTGACCACCTA 4 - Hairpin2 GAGCGACCTGGTGTTACTCTA 4 - Hairpin3 ATGGTGTAAATAGAGCTGTTA 4 - Hairpin4 CAGCTCATCTTCTGTGAAGAA 4 - Hairpin5 CAGCTCTGTGGGTCAGAAGAA 4 - Hairpin6 CCAGGCACAGATCTCAAGATA 4 - Hairpin7 ATGACAAGAAAGACATCTCAA 7 + ID Sequences Gene + Control1 TCTCGCTTGGGCGAGAGTAAG 2 + Control2 CCGCCTGAAGTCTCTGATTAA 2 + Control3 AGGAATTATAATGCTTATCTA 2 + Hairpin1 AAGGCAGAGACTGACCACCTA 4 + Hairpin2 GAGCGACCTGGTGTTACTCTA 4 + Hairpin3 ATGGTGTAAATAGAGCTGTTA 4 + Hairpin4 CAGCTCATCTTCTGTGAAGAA 4 + Hairpin5 CAGCTCTGTGGGTCAGAAGAA 4 + Hairpin6 CCAGGCACAGATCTCAAGATA 4 + Hairpin7 ATGACAAGAAAGACATCTCAA 7 ... **Sample Annotation (FastQ Input):** A tab delimited text table of information regarding the samples. Should have columns 'ID', 'Sequences' and 'group' to uniquely identify each sample, identify -the sample in the reads by its barcode sequence and correctly group replicates -for analysis. Additional columns may inserted for annotation purposes and will -not interfere with analysis as long as the necessary columns are present. +the sample in the reads by its sample index sequence and correctly group +replicates for analysis. Additional columns may inserted for annotation purposes +and will not interfere with analysis as long as the necessary columns are +present. -NOTE: the column names are case sensitive and should be input exactly as they -are shown here. +NOTE: With the exception of other_group, column names are case sensitive and +should be input exactly as they are shown here. The other_group column can be +named by the user and specified in the "Include Secondary Factor" option of the +tool. Example:: - ID Sequences group Replicate - 3 GAAAG Day 2 1 - 6 GAACC Day 10 1 - 9 GAAGA Day 5 GFP neg 1 - 16 GAATT Day 5 GFP pos 1 - 18 GACAC Day 2 2 - 21 GACCA Day 10 2 - 28 GACGT Day 5 GFP neg 2 - 31 GACTG Day 5 GFP pos 2 - 33 GAGAA Day 2 3 - 40 GAGCT Day 10 3 + ID Sequences group other_group Replicate + 3 GAAAG Day 2 male 1 + 6 GAACC Day 10 female 1 + 9 GAAGA Day 5 GFP neg male 1 + 16 GAATT Day 5 GFP pos male 1 + 18 GACAC Day 2 female 2 + 21 GACCA Day 10 male 2 + 28 GACGT Day 5 GFP neg male 2 + 31 GACTG Day 5 GFP pos female 2 + 33 GAGAA Day 2 male 3 + 40 GAGCT Day 10 female 3 ... -**Specify Barcode and Hairpin Locations (FastQ Input):** +**Include Secondary Factor** +If there are two factors involved in the experiment (i.e. Age and Gender) then +then secondary factor should be included to improve the statistical analysis. +The secondary factor should be specified as a column in the sample annotation +file and the corresponding column name should be input exactly as it is into +the provided field in the tool. + +NOTE: Currently the secondary factor is used only to improve statistical +analysis, comparisons can only be made in the primary factor specified as +"group" in the sample annotation. + +**Specify Sample Index and Target Sequence Locations (FastQ Input):** It is assumed that in the sequencing reads that the first 5 bases are the -barcodes and that bases 37-57 are the hairpins. If this is not the case then the -values of the positions can be changed, however it still requires the barcodes -and hairpins to be in a consistent location an in a continuous sequence. +sample index sequence and that bases 37-57 are the hairpins/sgRNA. If this is +not the case then the values of the positions can be changed, however it still +requires the sample indices and hairpins/sgRNA to be in a consistent location an +in a continuous sequence. + +NOTE: position values start at 1 for the first base. **Filter Low CPM?:** @@ -346,21 +555,21 @@ **Analysis Type:** - * **Classic Exact Test:** This allows two experimental groups to be compared and - p-values for differential representation derivec for each hairpin. Simple and - fast for straightforward comparisons. In this option you will have the option of - "*Compare* x *To* y" which implicitly subtracts the data from y from that of x - to produce the comparison. + * **Classic Exact Test:** This allows two experimental groups to be compared + and p-values for differential representation derivec for each target + sequence. Simple and fast for straightforward comparisons. In this option you + will have the option of "*Compare* x *To* y" which implicitly subtracts the + data from y from that of x to produce the comparison. - * **Generalised Linear Model:** This allow for complex contrasts to be specified - and also gene level analysis to be performed. If this option is chosen then - contrasts must be explicitly stated in equations and multiple contrasts can be - made. In addition there will be the option to analyse hairpins on a per-gene - basis to see if hairpins belonging to a particular gene have any overall - tendencies for the direction of their log-fold-change. + * **Generalised Linear Model:** This allow for complex contrasts to be specified + and also gene level analysis to be performed. If this option is chosen then + contrasts must be explicitly stated in equations and multiple contrasts can + be made. In addition there will be the option to analyse hairpins/sgRNA on a + per-gene basis to see if hairpins/sgRNA belonging to a particular gene have + any overall tendencies for the direction of their log-fold-change. **FDR Threshold:** -The smear plot in the output will have hairpins highlighted to signify +The smear plot in the output will have hairpins/sgRNA highlighted to signify significant differential representation. The significance is determined by contorlling the false discovery rate, only those with a FDR lower than the threshold will be highlighted in the plot. @@ -379,10 +588,10 @@ using. The methodology articles are listed in Section 2.1 of the limma User's Guide. - * Smyth, GK (2005). Limma: linear models for microarray data. In: - 'Bioinformatics and Computational Biology Solutions using R and - Bioconductor'. R. Gentleman, V. Carey, S. Dudoit, R. Irizarry, - W. Huber (eds), Springer, New York, pages 397-420. + * Smyth, GK (2005). Limma: linear models for microarray data. In: + 'Bioinformatics and Computational Biology Solutions using R and + Bioconductor'. R. Gentleman, V. Carey, S. Dudoit, R. Irizarry, + W. Huber (eds), Springer, New York, pages 397-420. .. class:: infomark @@ -392,25 +601,24 @@ the various original statistical methods implemented in edgeR. See Section 1.2 in the User's Guide for more detail. - * Robinson MD, McCarthy DJ and Smyth GK (2010). edgeR: a Bioconductor - package for differential expression analysis of digital gene expression - data. Bioinformatics 26, 139-140 - - * Robinson MD and Smyth GK (2007). Moderated statistical tests for assessing - differences in tag abundance. Bioinformatics 23, 2881-2887 - - * Robinson MD and Smyth GK (2008). Small-sample estimation of negative - binomial dispersion, with applications to SAGE data. - Biostatistics, 9, 321-332 - - * McCarthy DJ, Chen Y and Smyth GK (2012). Differential expression analysis - of multifactor RNA-Seq experiments with respect to biological variation. - Nucleic Acids Research 40, 4288-4297 - + * Robinson MD, McCarthy DJ and Smyth GK (2010). edgeR: a Bioconductor + package for differential expression analysis of digital gene expression + data. Bioinformatics 26, 139-140 + + * Robinson MD and Smyth GK (2007). Moderated statistical tests for assessing + differences in tag abundance. Bioinformatics 23, 2881-2887 + + * Robinson MD and Smyth GK (2008). Small-sample estimation of negative + binomial dispersion, with applications to SAGE data. + Biostatistics, 9, 321-332 + + * McCarthy DJ, Chen Y and Smyth GK (2012). Differential expression analysis + of multifactor RNA-Seq experiments with respect to biological variation. + Nucleic Acids Research 40, 4288-4297 + Report problems to: su.s@wehi.edu.au .. _edgeR: http://www.bioconductor.org/packages/release/bioc/html/edgeR.html .. _limma: http://www.bioconductor.org/packages/release/bioc/html/limma.html </help> </tool> -