changeset 0:a33c3356b8cf draft default tip

"planemo upload for repository https://github.com/quadram-institute-bioscience/galaxy-tools/tree/master/tools/centrifuge commit e7a2d92dc14da78e7ba641c603de75a985d037b6-dirty"
author thanhlv
date Mon, 31 Jan 2022 11:17:00 +0000
parents
children
files CHANGELOG README centrifuge.xml test-data/both.report test-data/both.tsv test-data/centrifuge_indices.loc test-data/db/centrifuge_test.1.cf test-data/db/centrifuge_test.2.cf test-data/db/centrifuge_test.3.cf test-data/defaults.report test-data/defaults.tsv test-data/exclude.report test-data/exclude.tsv test-data/host.report test-data/host.tsv test-data/input_f.fq test-data/input_r.fq test-data/input_u.fq test-data/minlen83.report test-data/minlen83.tsv test-data/nofw.report test-data/nofw.tsv test-data/norc.report test-data/norc.tsv test-data/paired.report test-data/paired.sam test-data/paired.tsv test-data/seed123.report test-data/seed123.tsv test-data/skip3.report test-data/skip3.tsv test-data/trim3_5.report test-data/trim3_5.tsv test-data/trim5_10.report test-data/trim5_10.tsv test-data/upto6.report test-data/upto6.tsv tool-data/centrifuge_indices.loc tool-data/centrifuge_indices.loc.sample tool_data_table_conf.xml.sample tool_data_table_conf.xml.test
diffstat 40 files changed, 797 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/CHANGELOG	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,3 @@
+Edited based on the original version at https://github.com/jvolkening/galaxy-tools
+- 2022-01-31
+    - Added k parameter
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/centrifuge.xml	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,436 @@
+<tool id="centrifuge" name="Centrifuge" version="1.0.4_beta">
+
+    <description>Read-based metagenome characterization</description>
+
+    <!-- ***************************************************************** -->
+
+    <requirements>
+        <requirement type="package" version="1.0.4_beta">centrifuge</requirement>
+    </requirements>
+
+    <!-- ***************************************************************** -->
+
+    <version_command>centrifuge --version | perl -wnE'print "$1\n" for /centrifuge\S+ version (\S+)/g'</version_command>
+
+    <!-- ***************************************************************** -->
+
+    <command detect_errors="aggressive">
+    <![CDATA[
+
+    centrifuge
+
+    ##--Output Options------------------------------
+
+        --out-fmt      $outputs.out_fmt
+        --tab-fmt-cols $outputs.tab_fmt_cols
+
+    ##--General Options-----------------------------
+
+        --threads      \${GALAXY_SLOTS:-1}
+
+        #if $general.skip != "":
+            --skip $general.skip
+        #end if
+        #if $general.upto != "":
+            --upto $general.upto
+        #end if
+        #if $general.trim5 != "":
+            --trim5 $general.trim5
+        #end if
+        #if $general.trim3 != "":
+            --trim3 $general.trim3
+        #end if
+
+        $general.ignore_quals
+        $general.nofw
+        $general.norc
+        $general.non_deterministic
+
+        #if $general.seed != "":
+            --seed $general.seed
+        #end if
+            
+    ##--Classification------------------------------
+
+        --min-hitlen $classification.min_hitlen
+        -k $classification.k_distinct
+        
+        #if $classification.min_totallen != "":
+            --min-totallen $classification.min_totallen
+        #end if
+
+        #if $classification.host_taxids != "":
+            --host-taxids $classification.host_taxids
+        #end if
+
+        #if $classification.exclude_taxids != "":
+            --exclude-taxids $classification.exclude_taxids
+        #end if
+
+    ##--Inputs--------------------------------------
+
+        -x '${inputs.db.fields.path}'
+
+        #for $s in $inputs.unpaired
+            -U '${s.u_reads}'
+        #end for
+
+        #for $s in $inputs.paired
+            -1 '${s.p_reads.forward}'
+            -2 '${s.p_reads.reverse}'
+        #end for
+
+        #if $inputs.sra:
+            --sra-acc $inputs.sra
+        #end if
+
+        #if $outputs.out_fmt == "tab":
+            -S $out_tab
+        #elif $outputs.out_fmt == "sam":
+            -S $out_sam
+        #end if
+
+        --report-file $report
+
+    ]]>
+    </command>
+
+    <!-- ***************************************************************** -->
+
+    <inputs>
+
+    <section name="inputs" title="Inputs" expanded="True">
+
+        <repeat name="unpaired" title="Unpaired reads" min="0" default="0">
+            <param name="u_reads" type="data" format="fastq" label="Unpaired reads"/>
+        </repeat>
+
+        <repeat name="paired" title="Paired reads" min="0" default="0">
+            <param name="p_reads" type="data_collection" collection_type="paired" format="fastq" label="Paired read collection"/>
+        </repeat>
+
+        <param name="sra" type="text" label="SRA accession">
+            <sanitizer invalid_char="">
+                <valid initial="string.letters,string.digits">
+                    <add value="," />
+                </valid>
+            </sanitizer>
+        </param>
+
+        <param name="db" type="select" label="Select a reference database">
+            <options from_data_table="centrifuge_indices">
+                <filter type="sort_by" column="2"/>
+                <validator type="no_options" message="No indexes are available for the selected input dataset"/>
+            </options>
+        </param>
+
+    </section>
+
+    <section name="outputs" title="Outputs" expanded="False">
+
+        <param argument="--out-fmt" name="out_fmt" type="select" label="Output format">
+            <option value="tab" selected="true">tabular</option>
+            <option value="sam">SAM</option>
+        </param>
+
+        <param argument="--tab-fmt-cols" name="tab_fmt_cols" type="text" label="Output columns" value="readID,seqID,taxID,score,2ndBestScore,hitLength,queryLength,numMatches">
+            <sanitizer invalid_char="">
+                <valid initial="string.letters,string.digits">
+                    <add value="," />
+                </valid>
+            </sanitizer>
+        </param>
+
+    </section>
+
+    <section name="general" title="General options" expanded="False">
+
+        <param argument="--skip"  type="integer" value="" optional="true" label="Initial reads to skip" />
+        <param argument="--upto"  type="integer" value="" optional="true" label="Stop after reads" />
+        <param argument="--trim5" type="integer" value="" optional="true" label="Trim 5' bases" />
+        <param argument="--trim3" type="integer" value="" optional="true" label="Trim 3' bases" />
+
+        <param argument="--ignore-quals" name="ignore_quals" type="boolean" truevalue="--ignore-quals" falsevalue="" checked="no" label="Ignore qualities" />
+
+        <param argument="--nofw" type="boolean" truevalue="--nofw" falsevalue="" checked="no" label="Don't map forward strand" />
+        <param argument="--norc" type="boolean" truevalue="--norc" falsevalue="" checked="no" label="Don't map rev-com strand" />
+
+        <param argument="--seed" type="integer" value="" min="0" optional="true" label="Starting seed" />
+        <param argument="--non-deterministic" name="non_deterministic" type="boolean" truevalue="--non-deterministic" falsevalue="" checked="no" label="Use non-deterministic seeding" />
+
+    </section>
+
+    <section name="classification" title="Classification" expanded="True">
+
+        <param argument="--min-hitlen" name="min_hitlen" type="integer" value="22" min="16" label="Minimum hit length" />
+        <param name="k_distinct" type="integer" value="5" min="5" label="Searching for at most k distinct, primary assignments for each read or pair." help="Primary assignments mean assignments whose assignment score is equal or higher than any other assignments. If there are more primary assignments than this value, the search will merge some of the assignments into a higher taxonomic rank. The assignment score for a paired-end assignment equals the sum of the assignment scores of the individual mates"/>
+        <param argument="--min-totallen" name="min_totallen" type="integer" optional="true"  min="0" label="Minimum summed length" />
+
+        <param argument="--host-taxids" name="host_taxids" type="text" label="Host taxonomic IDs">
+            <sanitizer invalid_char="">
+                <valid initial="string.digits">
+                    <add value="," />
+                </valid>
+            </sanitizer>
+        </param>
+        <param argument="--exclude-taxids" name="exclude_taxids" type="text" label="Excluded taxonomic IDs">
+            <sanitizer invalid_char="">
+                <valid initial="string.digits">
+                    <add value="," />
+                </valid>
+            </sanitizer>
+        </param>
+
+    </section>
+
+    </inputs>
+
+    <!-- ***************************************************************** -->
+
+    <outputs>
+
+        <data name="out_tab" format="tabular" label="Centrifuge on ${on_string}: Output">
+            <filter>(outputs['out_fmt'] == "tab")</filter>
+        </data>
+        <data name="out_sam" format="sam" label="Centrifuge on ${on_string}: Output">
+            <filter>(outputs['out_fmt'] == "sam")</filter>
+        </data>
+        <data name="report" format="tabular" label="Centrifuge on ${on_string}: Report" />
+
+    </outputs>
+
+    <!-- ***************************************************************** -->
+
+    <tests>
+        <!-- default unpaired -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+            <output name="out_tab" file="defaults.tsv" sort="true" />
+            <output name="report" file="defaults.report" />
+        </test>
+        <!-- default paired -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="p_reads">
+                <collection type="paired">
+                    <element name="forward" value="input_f.fq" />
+                    <element name="reverse" value="input_r.fq" />
+                </collection>
+            </param>
+            <output name="out_tab" file="paired.tsv" sort="true" />
+            <output name="report" file="paired.report" />
+        </test>
+        <!-- default combined -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+            <param name="p_reads">
+                <collection type="paired">
+                    <element name="forward" value="input_f.fq" />
+                    <element name="reverse" value="input_r.fq" />
+                </collection>
+            </param>
+            <output name="out_tab" file="both.tsv" sort="true" />
+            <output name="report" file="both.report" />
+        </test>
+        <!-- exclude IDs -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="exclude_taxids"  value="9913" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+            <output name="out_tab" file="exclude.tsv" sort="true" />
+            <output name="report" file="exclude.report" />
+        </test>
+        <!-- specify host -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="host_taxids"  value="9913" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+            <output name="out_tab" file="host.tsv" sort="true" />
+            <output name="report" file="host.report" />
+        </test>
+        <!-- minimum length -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="min_hitlen"  value="83" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+            <output name="out_tab" file="minlen83.tsv" sort="true" />
+            <output name="report" file="minlen83.report" />
+        </test>
+        <!-- norc -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="norc"  value="true" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+            <output name="out_tab" file="norc.tsv" sort="true" />
+            <output name="report" file="norc.report" />
+        </test>
+        <!-- nofw -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="nofw"  value="true" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+            <output name="out_tab" file="nofw.tsv" sort="true" />
+            <output name="report" file="nofw.report" />
+        </test>
+        <!-- set seed -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="seed"  value="123" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+            <output name="out_tab" file="seed123.tsv" sort="true" />
+            <output name="report" file="seed123.report" />
+        </test>
+        <!-- 5' trim -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="trim5"  value="10" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+            <output name="out_tab" file="trim5_10.tsv" sort="true" />
+            <output name="report" file="trim5_10.report" />
+        </test>
+        <!-- 3' trim -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="trim3"  value="5" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+            <output name="out_tab" file="trim3_5.tsv" sort="true" />
+            <output name="report" file="trim3_5.report" />
+        </test>
+        <!-- skip start -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="skip"  value="3" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+            <output name="out_tab" file="skip3.tsv" sort="true" />
+            <output name="report" file="skip3.report" />
+        </test>
+        <!-- skip end -->
+        <test>
+            <param name="db" value="test_db" />
+            <param name="upto"  value="6" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+            <output name="out_tab" file="upto6.tsv" sort="true" />
+            <output name="report" file="upto6.report" />
+        </test>
+        <!-- invalid parameter value -->
+        <test expect_failure="true">
+            <param name="db" value="test_db" />
+            <param name="tab_fmt_cols"  value="FooBar" />
+            <param name="u_reads" ftype="fastq" value="input_u.fq" />
+        </test>
+
+    </tests>
+
+    <!-- ***************************************************************** -->
+
+    <help>
+    <![CDATA[
+
+Overview
+--------
+
+**Credit**
+This wrapper was modified from the original version at https://github.com/jvolkening/galaxy-tools
+
+**Centrifuge** is a very rapid and memory-efficient system for the
+classification of DNA sequences from microbial samples, with better
+sensitivity than and comparable accuracy to other leading systems. The system
+uses a novel indexing scheme based on the Burrows-Wheeler transform (BWT) and
+the Ferragina-Manzini (FM) index, optimized specifically for the metagenomic
+classification problem. Centrifuge requires a relatively small index (e.g.,
+4.3 GB for ~4,100 bacterial genomes) yet provides very fast classification
+speed, allowing it to process a typical DNA sequencing run within an hour.
+Together these advances enable timely and accurate analysis of large
+metagenomics data sets on conventional desktop computers.
+
+Usage
+-----
+
+Following is the manpage for `centrifuge`, which can be linked with the
+options above using the help text. Note that not all options are available in
+the Galaxy wrapper.
+
+::
+
+    centrifuge [options]* -x <cf-idx> {-1 <m1> -2 <m2> | -U <r> | --sra-acc <SRA accession number>} [-S <filename>] [--report-file <report>]
+  
+    <cf-idx>   Index filename prefix (minus trailing .X.cf).
+    <m1>       Files with #1 mates, paired with files in <m2>.
+               Could be gzip'ed (extension: .gz) or bzip2'ed (extension: .bz2).
+    <m2>       Files with #2 mates, paired with files in <m1>.
+               Could be gzip'ed (extension: .gz) or bzip2'ed (extension: .bz2).
+    <r>        Files with unpaired reads.
+               Could be gzip'ed (extension: .gz) or bzip2'ed (extension: .bz2).
+    <SRA accession number>        Comma-separated list of SRA accession numbers, e.g. --sra-acc SRR353653,SRR353654.
+    <filename>      File for classification output (default: stdout)
+    <report>   File for tabular report output (default: centrifuge_report.tsv)
+  
+    <m1>, <m2>, <r> can be comma-separated lists (no whitespace) and can be
+    specified many times.  E.g. '-U file1.fq,file2.fq -U file3.fq'.
+  
+  Options (defaults in parentheses):
+  
+   Input:
+    -q                 query input files are FASTQ .fq/.fastq (default)
+    --qseq             query input files are in Illumina's qseq format
+    -f                 query input files are (multi-)FASTA .fa/.mfa
+    -r                 query input files are raw one-sequence-per-line
+    -c                 <m1>, <m2>, <r> are sequences themselves, not files
+    -s/--skip <int>    skip the first <int> reads/pairs in the input (none)
+    -u/--upto <int>    stop after first <int> reads/pairs (no limit)
+    -5/--trim5 <int>   trim <int> bases from 5'/left end of reads (0)
+    -3/--trim3 <int>   trim <int> bases from 3'/right end of reads (0)
+    --phred33          qualities are Phred+33 (default)
+    --phred64          qualities are Phred+64
+    --int-quals        qualities encoded as space-delimited integers
+    --ignore-quals     treat all quality values as 30 on Phred scale (off)
+    --nofw             do not align forward (original) version of read (off)
+    --norc             do not align reverse-complement version of read (off)
+    --sra-acc          SRA accession ID
+  
+  Classification:
+    --min-hitlen <int>    minimum length of partial hits (default 22, must be greater than 15)
+    --min-totallen <int>  minimum summed length of partial hits per read (default 0)
+    --host-taxids <taxids> comma-separated list of taxonomic IDs that will be preferred in classification
+    --exclude-taxids <taxids> comma-separated list of taxonomic IDs that will be excluded in classification
+  
+   Output:
+    --out-fmt <str>       define output format, either 'tab' or 'sam' (tab)
+    --tab-fmt-cols <str>  columns in tabular format, comma separated 
+                            default: readID,seqID,taxID,score,2ndBestScore,hitLength,queryLength,numMatches
+    -t/--time             print wall-clock time taken by search phases
+    --un <path>           write unpaired reads that didn't align to <path>
+    --al <path>           write unpaired reads that aligned at least once to <path>
+    --un-conc <path>      write pairs that didn't align concordantly to <path>
+    --al-conc <path>      write pairs that aligned concordantly at least once to <path>
+    (Note: for --un, --al, --un-conc, or --al-conc, add '-gz' to the option name, e.g.
+    --un-gz <path>, to gzip compress output, or add '-bz2' to bzip2 compress output.)
+    --quiet               print nothing to stderr except serious errors
+    --met-file <path>     send metrics to file at <path> (off)
+    --met-stderr          send metrics to stderr (off)
+    --met <int>           report internal counters & metrics every <int> secs (1)
+  
+   Performance:
+    -o/--offrate <int> override offrate of index; must be >= index's offrate
+    -p/--threads <int> number of alignment threads to launch (1)
+    --mm               use memory-mapped I/O for index; many 'bowtie's can share
+  
+   Other:
+    --qc-filter        filter out reads that are bad according to QSEQ filter
+    --seed <int>       seed for random number generator (0)
+    --non-deterministic seed rand. gen. arbitrarily instead of using read attributes
+    --version          print version information and quit
+    -h/--help          print this usage message
+
+    ]]>
+    </help>
+
+    <!-- ***************************************************************** -->
+    
+    <citations>
+        <citation type="doi">10.1101/gr.210641.116</citation>
+    </citations>
+
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/both.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,3 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
+Ailuropoda melanoleuca	9646	species	556	8	4	0.312231
+Bos taurus	9913	species	517	12	8	0.687769
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/both.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,21 @@
+1	gi|4	9646	4050	0	120	120	1
+1_1	gi|4	9646	4225	0	80	80	1
+1_2	gi|4	9646	4225	0	80	80	1
+2	gi|4	9646	4050	2025	120	120	1
+2_1	gi|7	9913	4225	0	80	80	1
+2_2	gi|7	9913	4225	0	80	80	1
+2_3	gi|7	9913	4225	0	80	80	1
+2_4	gi|7	9913	4225	0	80	80	1
+2_5	gi|7	9913	4225	0	80	80	1
+2_6	gi|7	9913	4225	0	80	80	1
+3	gi|7	9913	4050	0	120	120	1
+4	gi|7	9913	4050	2025	120	120	1
+C_1	gi|4	9646	4225	4225	80	80	2
+C_1	gi|7	9913	4225	4225	80	80	2
+C_2	gi|4	9646	4225	4225	80	80	2
+C_2	gi|7	9913	4225	4225	80	80	2
+C_3	gi|4	9646	4225	4225	80	80	2
+C_3	gi|7	9913	4225	4225	80	80	2
+C_4	gi|4	9646	4225	4225	80	80	2
+C_4	gi|7	9913	4225	4225	80	80	2
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/centrifuge_indices.loc	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,1 @@
+test_db	test_db	${__HERE__}/db/centrifuge_test
Binary file test-data/db/centrifuge_test.1.cf has changed
Binary file test-data/db/centrifuge_test.2.cf has changed
Binary file test-data/db/centrifuge_test.3.cf has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/defaults.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,3 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
+Ailuropoda melanoleuca	9646	species	556	6	2	0.230286
+Bos taurus	9913	species	517	10	6	0.769714
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/defaults.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,17 @@
+1_1	gi|4	9646	4225	0	80	80	1
+1_2	gi|4	9646	4225	0	80	80	1
+2_1	gi|7	9913	4225	0	80	80	1
+2_2	gi|7	9913	4225	0	80	80	1
+2_3	gi|7	9913	4225	0	80	80	1
+2_4	gi|7	9913	4225	0	80	80	1
+2_5	gi|7	9913	4225	0	80	80	1
+2_6	gi|7	9913	4225	0	80	80	1
+C_1	gi|4	9646	4225	4225	80	80	2
+C_1	gi|7	9913	4225	4225	80	80	2
+C_2	gi|4	9646	4225	4225	80	80	2
+C_2	gi|7	9913	4225	4225	80	80	2
+C_3	gi|4	9646	4225	4225	80	80	2
+C_3	gi|7	9913	4225	4225	80	80	2
+C_4	gi|4	9646	4225	4225	80	80	2
+C_4	gi|7	9913	4225	4225	80	80	2
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/exclude.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,2 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
+Ailuropoda melanoleuca	9646	species	556	6	6	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/exclude.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,13 @@
+1_1	gi|4	9646	4225	0	80	80	1
+1_2	gi|4	9646	4225	0	80	80	1
+2_1	unclassified	0	0	0	0	80	1
+2_2	unclassified	0	0	0	0	80	1
+2_3	unclassified	0	0	0	0	80	1
+2_4	unclassified	0	0	0	0	80	1
+2_5	unclassified	0	0	0	0	80	1
+2_6	unclassified	0	0	0	0	80	1
+C_1	gi|4	9646	4225	0	80	80	1
+C_2	gi|4	9646	4225	0	80	80	1
+C_3	gi|4	9646	4225	0	80	80	1
+C_4	gi|4	9646	4225	0	80	80	1
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/host.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,3 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
+Ailuropoda melanoleuca	9646	species	556	2	2	0.156809
+Bos taurus	9913	species	517	10	10	0.843191
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/host.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,13 @@
+1_1	gi|4	9646	4225	0	80	80	1
+1_2	gi|4	9646	4225	0	80	80	1
+2_1	gi|7	9913	4225	0	80	80	1
+2_2	gi|7	9913	4225	0	80	80	1
+2_3	gi|7	9913	4225	0	80	80	1
+2_4	gi|7	9913	4225	0	80	80	1
+2_5	gi|7	9913	4225	0	80	80	1
+2_6	gi|7	9913	4225	0	80	80	1
+C_1	gi|7	9913	4225	0	80	80	1
+C_2	gi|7	9913	4225	0	80	80	1
+C_3	gi|7	9913	4225	0	80	80	1
+C_4	gi|7	9913	4225	0	80	80	1
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/input_f.fq	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,16 @@
+@1
+GGCGCTGAATCCTCGAAAATCCTGACCCTTTTAATTCATGCTCCCTTACTCACGAGAGAT
++
+555555555555555555555555555555555555555555555555555555555555
+@2
+CAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGA
++
+555555555555555555555555555555555555555555555555555555555555
+@3
+GAGAACCCCCATGCTGCTCGCCCTGCTGGCCCTGGCCACACTCTGCCTCGCTGGCCGGGC
++
+555555555555555555555555555555555555555555555555555555555555
+@4
+CAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGA
++
+555555555555555555555555555555555555555555555555555555555555
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/input_r.fq	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,16 @@
+@1
+AAGCCTGACGAGAGTGCCCCATAGTGGTCTCTGAGACCCCACACAGTCCAGGGAAATATC
++
+555555555555555555555555555555555555555555555555555555555555
+@2
+CCGTCTTAGCACTATCATCACCCTTCGTTAATAGGGAAACATGAGGGAACGTGGTCGCGA
++
+555555555555555555555555555555555555555555555555555555555555
+@3
+CTCGCTGCCCTCCTGCTTGGACACGAAGGCTGCGCCTTTGCCCGACTCTGCATCACCAGG
++
+555555555555555555555555555555555555555555555555555555555555
+@4
+TGGGTAGGGGGCTGGGGCTCCCAGCCAGTGGTCCAGGTAGCGCCTGAGTCTCTTCACCAA
++
+555555555555555555555555555555555555555555555555555555555555
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/input_u.fq	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,48 @@
+@C_1
+GATCCTCCCCAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGAGGTGTTTTCCT
++
+55555555555555555555555555555555555555555555555555555555555555555555555555555555
+@C_2
+GATCCTCCCCAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGAGGTGTTTTCCT
++
+55555555555555555555555555555555555555555555555555555555555555555555555555555555
+@C_3
+GATCCTCCCCAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGAGGTGTTTTCCT
++
+55555555555555555555555555555555555555555555555555555555555555555555555555555555
+@C_4
+GATCCTCCCCAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGAGGTGTTTTCCT
++
+55555555555555555555555555555555555555555555555555555555555555555555555555555555
+@1_1
+GGACGCTCTGCTTTGTTACCAATGAGAAGGGCGCTGAATCCTCGAAAATCCTGACCCTTTTAATTCATGCTCCCTTACTC
++
+55555555555555555555555555555555555555555555555555555555555555555555555555555555
+@1_2
+ACGAGAGATGATGATCGTTGATATTTCCCTGGACTGTGTGGGGTCTCAGAGACCACTATGGGGCACTCTCGTCAGGCTTC
++
+55555555555555555555555555555555555555555555555555555555555555555555555555555555
+@2_1
+TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG
++
+55555555555555555555555555555555555555555555555555555555555555555555555555555555
+@2_2
+TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG
++
+55555555555555555555555555555555555555555555555555555555555555555555555555555555
+@2_3
+TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG
++
+55555555555555555555555555555555555555555555555555555555555555555555555555555555
+@2_4
+TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG
++
+55555555555555555555555555555555555555555555555555555555555555555555555555555555
+@2_5
+TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG
++
+55555555555555555555555555555555555555555555555555555555555555555555555555555555
+@2_6
+TGGCCGGGCAGATGCAAAGCCTGGTGATGCAGAGTCGGGCAAAGGCGCAGCCTTCGTGTCCAAGCAGGAGGGCAGCGAGG
++
+55555555555555555555555555555555555555555555555555555555555555555555555555555555
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/minlen83.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,1 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/minlen83.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,13 @@
+1_1	unclassified	0	0	0	0	80	1
+1_2	unclassified	0	0	0	0	80	1
+2_1	unclassified	0	0	0	0	80	1
+2_2	unclassified	0	0	0	0	80	1
+2_3	unclassified	0	0	0	0	80	1
+2_4	unclassified	0	0	0	0	80	1
+2_5	unclassified	0	0	0	0	80	1
+2_6	unclassified	0	0	0	0	80	1
+C_1	unclassified	0	0	0	0	80	1
+C_2	unclassified	0	0	0	0	80	1
+C_3	unclassified	0	0	0	0	80	1
+C_4	unclassified	0	0	0	0	80	1
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nofw.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,3 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
+Ailuropoda melanoleuca	9646	species	556	6	2	0.230286
+Bos taurus	9913	species	517	10	6	0.769714
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/nofw.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,17 @@
+1_1	gi|4	9646	4225	0	80	80	1
+1_2	gi|4	9646	4225	0	80	80	1
+2_1	gi|7	9913	4225	0	80	80	1
+2_2	gi|7	9913	4225	0	80	80	1
+2_3	gi|7	9913	4225	0	80	80	1
+2_4	gi|7	9913	4225	0	80	80	1
+2_5	gi|7	9913	4225	0	80	80	1
+2_6	gi|7	9913	4225	0	80	80	1
+C_1	gi|4	9646	4225	4225	80	80	2
+C_1	gi|7	9913	4225	4225	80	80	2
+C_2	gi|4	9646	4225	4225	80	80	2
+C_2	gi|7	9913	4225	4225	80	80	2
+C_3	gi|4	9646	4225	4225	80	80	2
+C_3	gi|7	9913	4225	4225	80	80	2
+C_4	gi|4	9646	4225	4225	80	80	2
+C_4	gi|7	9913	4225	4225	80	80	2
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/norc.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,3 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
+Ailuropoda melanoleuca	9646	species	556	6	2	0.230286
+Bos taurus	9913	species	517	10	6	0.769714
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/norc.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,17 @@
+1_1	gi|4	9646	4225	0	80	80	1
+1_2	gi|4	9646	4225	0	80	80	1
+2_1	gi|7	9913	4225	0	80	80	1
+2_2	gi|7	9913	4225	0	80	80	1
+2_3	gi|7	9913	4225	0	80	80	1
+2_4	gi|7	9913	4225	0	80	80	1
+2_5	gi|7	9913	4225	0	80	80	1
+2_6	gi|7	9913	4225	0	80	80	1
+C_1	gi|4	9646	4225	4225	80	80	2
+C_1	gi|7	9913	4225	4225	80	80	2
+C_2	gi|4	9646	4225	4225	80	80	2
+C_2	gi|7	9913	4225	4225	80	80	2
+C_3	gi|4	9646	4225	4225	80	80	2
+C_3	gi|7	9913	4225	4225	80	80	2
+C_4	gi|4	9646	4225	4225	80	80	2
+C_4	gi|7	9913	4225	4225	80	80	2
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/paired.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,3 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
+Ailuropoda melanoleuca	9646	species	556	2	2	0.481827
+Bos taurus	9913	species	517	2	2	0.518173
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/paired.sam	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,4 @@
+1	0	9646	0	0	*0	gi|4	0	0	GGCGCTGAATCCTCGAAAATCCTGACCCTTTTAATTCATGCTCCCTTACTCACGAGAGATNAAGCCTGACGAGAGTGCCCCATAGTGGTCTCTGAGACCCCACACAGTCCAGGGAAATATC	555555555555555555555555555555555555555555555555555555555555I555555555555555555555555555555555555555555555555555555555555
+2	0	9646	0	0	*0	gi|4	0	0	CAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGANCCGTCTTAGCACTATCATCACCCTTCGTTAATAGGGAAACATGAGGGAACGTGGTCGCGA	555555555555555555555555555555555555555555555555555555555555I555555555555555555555555555555555555555555555555555555555555
+3	0	9913	0	0	*0	gi|7	0	0	GAGAACCCCCATGCTGCTCGCCCTGCTGGCCCTGGCCACACTCTGCCTCGCTGGCCGGGCNCTCGCTGCCCTCCTGCTTGGACACGAAGGCTGCGCCTTTGCCCGACTCTGCATCACCAGG	555555555555555555555555555555555555555555555555555555555555I555555555555555555555555555555555555555555555555555555555555
+4	0	9913	0	0	*0	gi|7	0	0	CAGGCCCCTACACCCAATGTGGAACCGGGGTCCCGAATGAAAATGCTGCTGTTCCCTGGANTGGGTAGGGGGCTGGGGCTCCCAGCCAGTGGTCCAGGTAGCGCCTGAGTCTCTTCACCAA	555555555555555555555555555555555555555555555555555555555555I555555555555555555555555555555555555555555555555555555555555
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/paired.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,5 @@
+1	gi|4	9646	4050	0	120	120	1
+2	gi|4	9646	4050	2025	120	120	1
+3	gi|7	9913	4050	0	120	120	1
+4	gi|7	9913	4050	2025	120	120	1
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/seed123.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,3 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
+Ailuropoda melanoleuca	9646	species	556	6	2	0.230286
+Bos taurus	9913	species	517	10	6	0.769714
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/seed123.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,17 @@
+1_1	gi|4	9646	4225	0	80	80	1
+1_2	gi|4	9646	4225	0	80	80	1
+2_1	gi|7	9913	4225	0	80	80	1
+2_2	gi|7	9913	4225	0	80	80	1
+2_3	gi|7	9913	4225	0	80	80	1
+2_4	gi|7	9913	4225	0	80	80	1
+2_5	gi|7	9913	4225	0	80	80	1
+2_6	gi|7	9913	4225	0	80	80	1
+C_1	gi|4	9646	4225	4225	80	80	2
+C_1	gi|7	9913	4225	4225	80	80	2
+C_2	gi|4	9646	4225	4225	80	80	2
+C_2	gi|7	9913	4225	4225	80	80	2
+C_3	gi|4	9646	4225	4225	80	80	2
+C_3	gi|7	9913	4225	4225	80	80	2
+C_4	gi|4	9646	4225	4225	80	80	2
+C_4	gi|7	9913	4225	4225	80	80	2
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/skip3.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,3 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
+Ailuropoda melanoleuca	9646	species	556	3	2	0.235009
+Bos taurus	9913	species	517	7	6	0.764991
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/skip3.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,11 @@
+1_1	gi|4	9646	4225	0	80	80	1
+1_2	gi|4	9646	4225	0	80	80	1
+2_1	gi|7	9913	4225	0	80	80	1
+2_2	gi|7	9913	4225	0	80	80	1
+2_3	gi|7	9913	4225	0	80	80	1
+2_4	gi|7	9913	4225	0	80	80	1
+2_5	gi|7	9913	4225	0	80	80	1
+2_6	gi|7	9913	4225	0	80	80	1
+C_4	gi|4	9646	4225	4225	80	80	2
+C_4	gi|7	9913	4225	4225	80	80	2
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/trim3_5.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,3 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
+Ailuropoda melanoleuca	9646	species	556	6	2	0.230286
+Bos taurus	9913	species	517	10	6	0.769714
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/trim3_5.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,17 @@
+1_1	gi|4	9646	3600	0	75	75	1
+1_2	gi|4	9646	3600	0	75	75	1
+2_1	gi|7	9913	3600	0	75	75	1
+2_2	gi|7	9913	3600	0	75	75	1
+2_3	gi|7	9913	3600	0	75	75	1
+2_4	gi|7	9913	3600	0	75	75	1
+2_5	gi|7	9913	3600	0	75	75	1
+2_6	gi|7	9913	3600	0	75	75	1
+C_1	gi|4	9646	3600	3600	75	75	2
+C_1	gi|7	9913	3600	3600	75	75	2
+C_2	gi|4	9646	3600	3600	75	75	2
+C_2	gi|7	9913	3600	3600	75	75	2
+C_3	gi|4	9646	3600	3600	75	75	2
+C_3	gi|7	9913	3600	3600	75	75	2
+C_4	gi|4	9646	3600	3600	75	75	2
+C_4	gi|7	9913	3600	3600	75	75	2
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/trim5_10.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,3 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
+Ailuropoda melanoleuca	9646	species	556	6	2	0.230286
+Bos taurus	9913	species	517	10	6	0.769714
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/trim5_10.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,17 @@
+1_1	gi|4	9646	3025	0	70	70	1
+1_2	gi|4	9646	3025	0	70	70	1
+2_1	gi|7	9913	3025	0	70	70	1
+2_2	gi|7	9913	3025	0	70	70	1
+2_3	gi|7	9913	3025	0	70	70	1
+2_4	gi|7	9913	3025	0	70	70	1
+2_5	gi|7	9913	3025	0	70	70	1
+2_6	gi|7	9913	3025	0	70	70	1
+C_1	gi|4	9646	3025	3025	70	70	2
+C_1	gi|7	9913	3025	3025	70	70	2
+C_2	gi|4	9646	3025	3025	70	70	2
+C_2	gi|7	9913	3025	3025	70	70	2
+C_3	gi|4	9646	3025	3025	70	70	2
+C_3	gi|7	9913	3025	3025	70	70	2
+C_4	gi|4	9646	3025	3025	70	70	2
+C_4	gi|7	9913	3025	3025	70	70	2
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/upto6.report	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,3 @@
+name	taxID	taxRank	genomeSize	numReads	numUniqueReads	abundance
+Ailuropoda melanoleuca	9646	species	556	6	2	1
+Bos taurus	9913	species	517	4	0	7.1246e-13
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/upto6.tsv	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,11 @@
+1_1	gi|4	9646	4225	0	80	80	1
+1_2	gi|4	9646	4225	0	80	80	1
+C_1	gi|4	9646	4225	4225	80	80	2
+C_1	gi|7	9913	4225	4225	80	80	2
+C_2	gi|4	9646	4225	4225	80	80	2
+C_2	gi|7	9913	4225	4225	80	80	2
+C_3	gi|4	9646	4225	4225	80	80	2
+C_3	gi|7	9913	4225	4225	80	80	2
+C_4	gi|4	9646	4225	4225	80	80	2
+C_4	gi|7	9913	4225	4225	80	80	2
+readID	seqID	taxID	score	2ndBestScore	hitLength	queryLength	numMatches
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/centrifuge_indices.loc	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,17 @@
+# centrifuge_indices.loc.sample
+# This is a *.loc.sample file distributed with Galaxy that enables tools
+# to use a directory of indexed data files. This one is for GOTTCHA.
+# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup
+# First create these data files and save them in your own data directory structure.
+# Then, create a bowtie_indices.loc file to use those indexes with tools.
+# Copy this file, save it with the same name (minus the .sample), 
+# follow the format examples, and store the result in this directory.
+# The file should include an one line entry for each index set.
+# The path points to the "basename" for the set, not a specific file.
+# It has three text columns seperated by TABS.
+#
+# <unique_id>	<display_name>	<file_base_path>
+#
+#bacteria_v20150825	Bacteria	/depot/data2/galaxy/gottcha/GOTTCHA_BACTERIA_c4937_k24_u30_xHUMAN3x.species
+#viruses_v20150825	Viruses	/depot/data2/galaxy/gottcha/GOTTCHA_VIRUSES_c5900_k24_u30_xHUMAN3x.species
+test	test	foo/bar/baz
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool-data/centrifuge_indices.loc.sample	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,17 @@
+# centrifuge_indices.loc.sample
+# This is a *.loc.sample file distributed with Galaxy that enables tools
+# to use a directory of indexed data files. This one is for GOTTCHA.
+# See the wiki: http://wiki.galaxyproject.org/Admin/NGS%20Local%20Setup
+# First create these data files and save them in your own data directory structure.
+# Then, create a bowtie_indices.loc file to use those indexes with tools.
+# Copy this file, save it with the same name (minus the .sample), 
+# follow the format examples, and store the result in this directory.
+# The file should include an one line entry for each index set.
+# The path points to the "basename" for the set, not a specific file.
+# It has three text columns seperated by TABS.
+#
+# <unique_id>	<display_name>	<file_base_path>
+#
+#bacteria_v20150825	Bacteria	/depot/data2/galaxy/gottcha/GOTTCHA_BACTERIA_c4937_k24_u30_xHUMAN3x.species
+#viruses_v20150825	Viruses	/depot/data2/galaxy/gottcha/GOTTCHA_VIRUSES_c5900_k24_u30_xHUMAN3x.species
+test	test	foo/bar/baz
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.sample	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,8 @@
+<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc-->
+<tables>
+    <!-- Locations of indexes in the GOTTCHA format -->
+    <table name="centrifuge_indices" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="tool-data/centrifuge_indices.loc" />
+    </table>
+</tables>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_data_table_conf.xml.test	Mon Jan 31 11:17:00 2022 +0000
@@ -0,0 +1,6 @@
+<tables>
+    <table name="centrifuge_indices" comment_char="#">
+        <columns>value, name, path</columns>
+        <file path="${__HERE__}/test-data/centrifuge_indices.loc" />
+    </table>
+</tables>