# HG changeset patch
# User tiagoantao
# Date 1446586061 18000
# Node ID 66bcdd1ac9ca7a8d10552cc668945ac6c03ed646

planemo upload commit 2c71c5e5604b9c05648b883fddbb163a8e03c807

diff -r 000000000000 -r 66bcdd1ac9ca README.md
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/README.md	Tue Nov 03 16:27:41 2015 -0500
@@ -0,0 +1,10 @@
+RAxML for Galaxy
+================
+
+95% of this work was made by Oleksandr Moskalenko. Tiago Antao
+is trying to update it to a more current version.
+
+Acknowledgements
+----------------
+
+Björn Grüning for all the help
diff -r 000000000000 -r 66bcdd1ac9ca raxml.py
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/raxml.py	Tue Nov 03 16:27:41 2015 -0500
@@ -0,0 +1,360 @@
+#!/usr/bin/env python
+"""
+Runs RAxML on a sequence file.
+For use with RAxML version 8.2.4
+"""
+import os, shutil, subprocess, sys, optparse, fnmatch, glob
+
+def stop_err(msg):
+    sys.stderr.write("%s\n" % msg)
+    sys.exit()
+
+def getint(name):
+    basename = name.partition('RUN.')
+    if basename[2] != '':
+        num = basename[2]
+        return int(num)
+
+def __main__():
+    usage = "usage: %prog -T <threads> -s <input> -n <output> -m <model> [optional arguments]"
+
+    # Parse the primary wrapper's command line options
+    parser = optparse.OptionParser(usage = usage)
+    # raxml binary name, hardcoded in the xml file
+    parser.add_option("--binary", action="store", type="string", dest="binary", help="Command to run")
+    # (-a)
+    parser.add_option("--weightfile", action="store", type="string", dest="weightfile", help="Column weight file")
+    # (-A)
+    parser.add_option("--secondary_structure_model", action="store", type="string", dest="secondary_structure_model", help="Secondary structure model")
+    # (-b)
+    parser.add_option("--bootseed", action="store", type="int", dest="bootseed", help="Bootstrap random number seed")
+    # (-c)
+    parser.add_option("--numofcats", action="store", type="int", dest="numofcats", help="Number of distinct rate categories")
+    # (-d)
+    parser.add_option("--search_complete_random_tree", action="store_true", dest="search_complete_random_tree", help="Search with a complete random starting tree")
+    # (-D)
+    parser.add_option("--ml_search_convergence", action="store_true", dest="ml_search_convergence", help="ML search onvergence criterion")
+    # (-e)
+    parser.add_option("--model_opt_precision", action="store", type="float", dest="model_opt_precision", help="Model Optimization Precision (-e)")
+    # (-E)
+    parser.add_option("--excludefile", action="store", type="string", dest="excludefile", help="Exclude File Name")
+    # (-f)
+    parser.add_option("--search_algorithm", action="store", type="string", dest="search_algorithm", help="Search Algorithm")
+    # (-F)
+    parser.add_option("--save_memory_cat_model", action="store_true", dest="save_memory_cat_model", help="Save memory under CAT and GTRGAMMA models")
+    # (-g)
+    parser.add_option("--groupingfile", action="store", type="string", dest="groupingfile", help="Grouping File Name")
+    # (-G)
+    parser.add_option("--enable_evol_heuristics", action="store_true", dest="enable_evol_heuristics", help="Enable evol algo heuristics")
+    # (-i)
+    parser.add_option("--initial_rearrangement_setting", action="store", type="int", dest="initial_rearrangement_setting", help="Initial Rearrangement Setting")
+    # (-I)
+    parser.add_option("--posterior_bootstopping_analysis", action="store", type="string", dest="posterior_bootstopping_analysis", help="Posterior bootstopping analysis")
+    # (-J)
+    parser.add_option("--majority_rule_consensus", action="store", type="string", dest="majority_rule_consensus", help="Majority rule consensus")
+    # (-k)
+    parser.add_option("--print_branch_lengths", action="store_true", dest="print_branch_lengths", help="Print branch lengths")
+    # (-K)
+    parser.add_option("--multistate_sub_model", action="store", type="string", dest="multistate_sub_model", help="Multistate substitution model")
+    # (-m)
+    parser.add_option("--model_type", action="store", type="string", dest="model_type", help="Model Type")
+    parser.add_option("--base_model", action="store", type="string", dest="base_model", help="Base Model")
+    parser.add_option("--aa_empirical_freq", action="store_true", dest="aa_empirical_freq", help="Use AA Empirical base frequences")
+    parser.add_option("--aa_search_matrix", action="store", type="string", dest="aa_search_matrix", help="AA Search Matrix")
+    # (-n)
+    parser.add_option("--name", action="store", type="string", dest="name", help="Run Name")
+    # (-N/#)
+    parser.add_option("--number_of_runs", action="store", type="int", dest="number_of_runs", help="Number of alternative runs")
+    parser.add_option("--number_of_runs_bootstop", action="store", type="string", dest="number_of_runs_bootstop", help="Number of alternative runs based on the bootstop criteria")
+    # (-M)
+    parser.add_option("--estimate_individual_branch_lengths", action="store_true", dest="estimate_individual_branch_lengths", help="Estimate individual branch lengths")
+    # (-o)
+    parser.add_option("--outgroup_name", action="store", type="string", dest="outgroup_name", help="Outgroup Name")
+    # (-O)
+    parser.add_option("--disable_undetermined_seq_check", action="store_true", dest="disable_undetermined_seq_check", help="Disable undetermined sequence check")
+    # (-p)
+    parser.add_option("--random_seed", action="store", type="int", dest="random_seed", help="Random Number Seed")
+    # (-P)
+    parser.add_option("--external_protein_model", action="store", type="string", dest="external_protein_model", help="External Protein Model")
+    # (-q)
+    parser.add_option("--multiple_model", action="store", type="string", dest="multiple_model", help="Multiple Model File")
+    # (-r)
+    parser.add_option("--constraint_file", action="store", type="string", dest="constraint_file", help="Constraint File")
+    # (-R)
+    parser.add_option("--bin_model_parameter_file", action="store", type="string", dest="bin_model_parameter_file", help="Constraint File")
+    # (-s)
+    parser.add_option("--source", action="store", type="string", dest="source", help="Input file")
+    # (-S)
+    parser.add_option("--secondary_structure_file", action="store", type="string", dest="secondary_structure_file", help="Secondary structure file")
+    # (-t)
+    parser.add_option("--starting_tree", action="store", type="string", dest="starting_tree", help="Starting Tree")
+    # (-T)
+    parser.add_option("--threads", action="store", type="int", dest="threads", help="Number of threads to use")
+    # (-u)
+    parser.add_option("--use_median_approximation", action="store_true", dest="use_median_approximation", help="Use median approximation")
+    # (-U)
+    parser.add_option("--save_memory_gappy_alignments", action="store_true", dest="save_memory_gappy_alignments", help="Save memory in large gapped alignments")
+    # (-V)
+    parser.add_option("--disable_rate_heterogeneity", action="store_true", dest="disable_rate_heterogeneity", help="Disable rate heterogeneity")
+    # (-W)
+    parser.add_option("--sliding_window_size", action="store", type="string", dest="sliding_window_size", help="Sliding window size")
+    # (-x)
+    parser.add_option("--rapid_bootstrap_random_seed", action="store", type="int", dest="rapid_bootstrap_random_seed", help="Rapid Boostrap Random Seed")
+    # (-y)
+    parser.add_option("--parsimony_starting_tree_only", action="store_true", dest="parsimony_starting_tree_only", help="Generate a parsimony starting tree only")
+    # (-z)
+    parser.add_option("--file_multiple_trees", action="store", type="string", dest="file_multiple_trees", help="Multiple Trees File")
+
+    (options, args) = parser.parse_args()
+    cmd = []
+
+    # Required parameters
+    binary = options.binary
+    cmd.append(binary)
+    # Threads
+    threads = "-T %d" % options.threads
+    cmd.append(threads)
+    # Source
+    source = "-s %s" % options.source
+    cmd.append(source)
+    #Hardcode to "galaxy" first to simplify the output part of the wrapper
+    #name = "-n %s" % options.name
+    name = "-n galaxy"
+    cmd.append(name)
+    ## Model
+    model_type = options.model_type
+    base_model = options.base_model
+    aa_search_matrix = options.aa_search_matrix
+    aa_empirical_freq = options.aa_empirical_freq
+    if model_type == 'aminoacid':
+        model = "-m %s%s" % (base_model, aa_search_matrix)
+        if aa_empirical_freq:
+            model = "-m %s%s%s" % (base_model, aa_search_matrix, 'F')
+        # (-P)
+        if options.external_protein_model:
+            external_protein_model = "-P %s" % options.external_protein_model
+            cmd.append(external_protein_model)
+    else:
+        model = "-m %s" % base_model
+    cmd.append(model)
+    if model == "GTRCAT":
+        # (-c)
+        if options.numofcats:
+            numofcats = "-c %d" % options.numofcats
+            cmd.append(numofcats)
+    # Optional parameters
+    if options.number_of_runs_bootstop:
+        number_of_runs_bootstop = "-N %s" % options.number_of_runs_bootstop
+        cmd.append(number_of_runs_bootstop)
+    else:
+        number_of_runs_bootstop = ''
+    if options.number_of_runs:
+        number_of_runs_opt = "-N %d" % options.number_of_runs
+        cmd.append(number_of_runs_opt)
+    else:
+        number_of_runs_opt = 0
+    # (-a)
+    if options.weightfile:
+        weightfile = "-a %s" % options.weightfile
+        cmd.append(weightfile)
+    # (-A)
+    if options.secondary_structure_model:
+        secondary_structure_model  = "-A %s" % options.secondary_structure_model
+        cmd.append(secondary_structure_model )
+    # (-b)
+    if options.bootseed:
+        bootseed = "-b %d" % options.bootseed
+        cmd.append(bootseed)
+    else:
+        bootseed = 0
+    # -C - doesn't work in pthreads version, skipped
+    if options.search_complete_random_tree:
+        cmd.append("-d")
+    if options.ml_search_convergence:
+        cmd.append("-D" )
+    if options.model_opt_precision:
+        model_opt_precision = "-e %f" % options.model_opt_precision
+        cmd.append(model_opt_precision)
+    if options.excludefile:
+        excludefile = "-E %s" % options.excludefile
+        cmd.append(excludefile)
+    if options.search_algorithm:
+        search_algorithm = "-f %s" % options.search_algorithm
+        cmd.append(search_algorithm)
+    if options.save_memory_cat_model:
+        cmd.append("-F")
+    if options.groupingfile:
+        groupingfile = "-g %s" % options.groupingfile
+        cmd.append(groupingfile)
+    if options.enable_evol_heuristics:
+        enable_evol_heuristics = "-G %f" % options.enable_evol_heuristics
+        cmd.append(enable_evol_heuristics )
+    if options.initial_rearrangement_setting:
+        initial_rearrangement_setting  = "-i %s" % options.initial_rearrangement_setting
+        cmd.append(initial_rearrangement_setting)
+    if options.posterior_bootstopping_analysis:
+        posterior_bootstopping_analysis = "-I %s" % options.posterior_bootstopping_analysis
+        cmd.append(posterior_bootstopping_analysis)
+    if options.majority_rule_consensus:
+        majority_rule_consensus = "-J %s" % options.majority_rule_consensus
+        cmd.append(majority_rule_consensus)
+    if options.print_branch_lengths:
+        cmd.append("-k")
+    if options.multistate_sub_model:
+        multistate_sub_model = "-K %s" % options.multistate_sub_model
+        cmd.append(multistate_sub_model)
+    if options.estimate_individual_branch_lengths:
+        cmd.append("-M")
+    if options.outgroup_name:
+        outgroup_name = "-o %s" % options.outgroup_name
+        cmd.append(outgroup_name)
+    if options.disable_undetermined_seq_check:
+        cmd.append("-O")
+    if options.random_seed:
+        random_seed = "-p %d" % options.random_seed
+        cmd.append(random_seed)
+    multiple_model = None
+    if options.multiple_model:
+        multiple_model = "-q %s" % options.multiple_model
+        cmd.append(multiple_model)
+    if options.constraint_file:
+        constraint_file = "-r %s" % options.constraint_file
+        cmd.append(constraint_file)
+    if options.bin_model_parameter_file:
+        bin_model_parameter_file_name = "RAxML_binaryModelParameters.galaxy"
+        os.symlink(options.bin_model_parameter_file, bin_model_parameter_file_name )
+        bin_model_parameter_file = "-R %s" % options.bin_model_parameter_file
+        #Needs testing. Is the hardcoded name or the real path needed?
+        cmd.append(bin_model_parameter_file)
+    if options.secondary_structure_file:
+        secondary_structure_file = "-S %s" % options.secondary_structure_file
+        cmd.append(secondary_structure_file)
+    if options.starting_tree:
+        starting_tree = "-t %s" % options.starting_tree
+        cmd.append(starting_tree)
+    if options.use_median_approximation:
+        cmd.append("-u")
+    if options.save_memory_gappy_alignments:
+        cmd.append("-U")
+    if options.disable_rate_heterogeneity:
+        cmd.append("-V")
+    if options.sliding_window_size:
+        sliding_window_size = "-W %d" % options.sliding_window_size
+        cmd.append(sliding_window_size)
+    if options.rapid_bootstrap_random_seed:
+        rapid_bootstrap_random_seed = "-x %d" % options.rapid_bootstrap_random_seed
+        cmd.append(rapid_bootstrap_random_seed)
+    else:
+        rapid_bootstrap_random_seed = 0
+    if options.parsimony_starting_tree_only:
+        cmd.append("-y")
+    if options.file_multiple_trees:
+        file_multiple_trees = "-z %s" % options.file_multiple_trees
+        cmd.append(file_multiple_trees)
+
+    print "cmd list: ", cmd, "\n"
+
+    full_cmd = " ".join(cmd)
+    print "Command string: %s" % full_cmd
+
+    try:
+        proc = subprocess.Popen(args=full_cmd, shell=True, stdout=subprocess.PIPE, stderr=subprocess.PIPE)
+    except Exception, err:
+        sys.stderr.write("Error invoking command: \n%s\n\n%s\n" % (cmd, err))
+        sys.exit(1)
+    stdout, stderr = proc.communicate()
+    return_code = proc.returncode
+    if return_code:
+        sys.stdout.write(stdout)
+        sys.stderr.write(stderr)
+        sys.stderr.write("Return error code %i from command:\n" % return_code)
+        sys.stderr.write("%s\n" % cmd)
+    else:
+        sys.stdout.write(stdout)
+        sys.stdout.write(stderr)
+
+    #Multiple runs - concatenate
+    if number_of_runs_opt > 0:
+        if (bootseed == 0) and (rapid_bootstrap_random_seed == 0 ):
+            runfiles = glob.glob('RAxML*RUN*')
+            runfiles.sort(key=getint)
+        # Logs
+            outfile = open('RAxML_log.galaxy','w')
+            for filename in runfiles:
+                if fnmatch.fnmatch(filename, 'RAxML_log.galaxy.RUN.*'):
+                    infile = open(filename, 'r')
+                    filename_line = "%s\n" % filename
+                    outfile.write(filename_line)
+                    for line in infile:
+                        outfile.write(line)
+                    infile.close()
+            outfile.close()
+        # Parsimony Trees
+            outfile = open('RAxML_parsimonyTree.galaxy','w')
+            for filename in runfiles:
+                if fnmatch.fnmatch(filename, 'RAxML_parsimonyTree.galaxy.RUN.*'):
+                    infile = open(filename, 'r')
+                    filename_line = "%s\n" % filename
+                    outfile.write(filename_line)
+                    for line in infile:
+                        outfile.write(line)
+                    infile.close()
+            outfile.close()
+        # Results
+            outfile = open('RAxML_result.galaxy','w')
+            for filename in runfiles:
+                if fnmatch.fnmatch(filename, 'RAxML_result.galaxy.RUN.*'):
+                    infile = open(filename, 'r')
+                    filename_line = "%s\n" % filename
+                    outfile.write(filename_line)
+                    for line in infile:
+                        outfile.write(line)
+                    infile.close()
+            outfile.close()
+    # Multiple Model Partition Files
+    if multiple_model:
+        files = glob.glob('RAxML_bestTree.galaxy.PARTITION.*')
+        if len(files) > 0:
+            files.sort(key=getint)
+            outfile = open('RAxML_bestTreePartitions.galaxy','w')
+            # Best Tree Partitions
+            for filename in files:
+                if fnmatch.fnmatch(filename, 'RAxML_bestTree.galaxy.PARTITION.*'):
+                    infile = open(filename, 'r')
+                    filename_line = "%s\n" % filename
+                    outfile.write(filename_line)
+                    for line in infile:
+                        outfile.write(line)
+                    infile.close()
+            outfile.close()
+        else:
+            outfile = open('RAxML_bestTreePartitions.galaxy','w')
+            outfile.write("No partition files were produced.\n")
+            outfile.close()
+
+        # Result Partitions
+        files = glob.glob('RAxML_result.galaxy.PARTITION.*')
+        if len(files) > 0:
+            files.sort(key=getint)
+            outfile = open('RAxML_resultPartitions.galaxy','w')
+            for filename in files:
+                if fnmatch.fnmatch(filename, 'RAxML_result.galaxy.PARTITION.*'):
+                    infile = open(filename, 'r')
+                    filename_line = "%s\n" % filename
+                    outfile.write(filename_line)
+                    for line in infile:
+                        outfile.write(line)
+                    infile.close()
+            outfile.close()
+        else:
+            outfile = open('RAxML_resultPartitions.galaxy','w')
+            outfile.write("No partition files were produced.\n")
+            outfile.close()
+
+    # DEBUG options
+    infof = open('RAxML_info.galaxy','a')
+    infof.write('\nOM: CLI options DEBUG START:\n')
+    infof.write(options.__repr__())
+    infof.write('\nOM: CLI options DEBUG END\n')
+
+if __name__=="__main__": __main__()
diff -r 000000000000 -r 66bcdd1ac9ca raxml.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/raxml.xml	Tue Nov 03 16:27:41 2015 -0500
@@ -0,0 +1,564 @@
+<tool id="raxml" name="Phyogenetic reconstruction with RaXML" version="1.0.1">
+  <description>- Maximum Likelihood based inference of large phylogenetic trees</description>
+  <requirements>
+    <requirement type='package' version="8.2.4">raxml</requirement>
+  </requirements>
+  <command interpreter="python">raxml.py
+    ## Required parameters 
+    ## Program name and threads are hard-coded as they are dependent on the binary and threads are specified in the Galaxy's tool configuration
+    ## binary is hard-coded to the pthreads enabled raxml executable
+    --binary "raxmlHPC-PTHREADS"
+    ## (-T)
+    --threads \${GALAXY_SLOTS:-1}
+    ## (-s)
+    --source $infile
+    ## (-m)
+    --model_type $search_model_selector.model_type
+    --base_model $search_model_selector.base_model
+    #if str( $search_model_selector.model_type ) == 'aminoacid':
+        $search_model_selector.aa_model_empirical_base_frequencies
+        #if $search_model_selector.aa_search_matrix:
+            --aa_search_matrix $search_model_selector.aa_search_matrix
+        #end if
+    #end if
+    ## (-p)
+    #if $random_seed:
+        --random_seed $random_seed
+    #else
+        --random_seed 1234567890
+    #end if
+
+    ## Optional parameters
+
+#if str( $selExtraOpts.extraOptions ) == 'full':
+    ## (-N/#)
+    #if $selExtraOpts.number_of_runs:
+        --number_of_runs $selExtraOpts.number_of_runs
+    #end if
+    #if $selExtraOpts.number_of_runs_bootstop:
+        --number_of_runs_bootstop $selExtraOpts.number_of_runs_bootstop
+    #end if
+    ## (-a)
+    #if $selExtraOpts.weightfile:
+        --weightfile $selExtraOpts.weightfile
+    #end if
+    ## (-b)
+    #if str ($selExtraOpts.secondary_structure_model) != "":
+        --secondary_structure_model $selExtraOpts.secondary_structure_model
+    #end if
+    ## (-b)
+    #if $selExtraOpts.bootseed:
+        --bootseed $selExtraOpts.bootseed
+    #end if
+    ## (-c)
+    #if $selExtraOpts.numofcats:
+        --numofcats $selExtraOpts.numofcats
+    #end if
+    ## (-d)
+    $selExtraOpts.search_complete_random_tree
+    ## (-D)
+    $selExtraOpts.ml_search_convergence
+    ## (-e)
+    #if $selExtraOpts.model_opt_precision:
+        --model_opt_precision $selExtraOpts.model_opt_precision
+    #end if
+    ## (-E)
+    #if $selExtraOpts.excludefile:
+        --excludefile $selExtraOpts.excludefile
+    #end if
+    ## (-f)
+    #if $selExtraOpts.search_algorithm:
+        --search_algorithm $selExtraOpts.search_algorithm
+    #end if
+    ## (-F)
+    $selExtraOpts.save_memory_cat_model
+    ## (-g)
+    #if $selExtraOpts.groupingfile:
+        --groupingfile $selExtraOpts.groupingfile
+    #end if
+    ## (-G)
+    #if $selExtraOpts.enable_evol_heuristics:
+        --enable_evol_heuristics $selExtraOpts.enable_evol_heuristics
+    #end if
+    ## (-i)
+    #if $selExtraOpts.initial_rearrangement_setting:
+        --initial_rearrangement_setting $selExtraOpts.initial_rearrangement_setting
+    #end if
+    ## (-I)
+    #if $selExtraOpts.posterior_bootstopping_analysis:
+        --posterior_bootstopping_analysis $selExtraOpts.posterior_bootstopping_analysis
+    #end if
+    ## (-J)
+    #if $selExtraOpts.majority_rule_consensus:
+        --majority_rule_consensus $selExtraOpts.majority_rule_consensus
+    #end if
+    ## (-k)
+    $selExtraOpts.print_branch_lengths
+    ## (-K)
+    #if str ($selExtraOpts.multistate_sub_model) != "":
+        --multistate_sub_model $selExtraOpts.multistate_sub_model
+    #end if
+    ## (-m) - see elsewhere
+    ## (-M)
+    $selExtraOpts.estimate_individual_branch_lengths
+    ## (-n) - see elsewhere
+    ## (-o)
+    #if $selExtraOpts.outgroup_name:
+        --outgroup_name $selExtraOpts.outgroup_name
+    #end if
+    ## (-O)
+    $selExtraOpts.disable_undetermined_seq_check
+    ## (-P)
+    #if $selExtraOpts.external_protein_model:
+        --external_protein_model $selExtraOpts.external_protein_model
+    #end if
+    ## (-q)
+    #if $selExtraOpts.multiple_model:
+        --multiple_model $selExtraOpts.multiple_model
+    #end if
+    ## (-r)
+    #if $selExtraOpts.constraint_file:
+        --constraint_file $selExtraOpts.constraint_file
+    #end if
+    ## (-R)
+    #if $selExtraOpts.bin_model_parameter_file:
+        --bin_model_parameter_file $selExtraOpts.bin_model_parameter_file
+    #end if
+    ## (-S)
+    #if $selExtraOpts.secondary_structure_file:
+        --secondary_structure_file $selExtraOpts.secondary_structure_file
+    #end if
+    ## (-t)
+    #if $selExtraOpts.start_tree_file:
+        --starting_tree $selExtraOpts.start_tree_file
+    #end if
+    ## (-T) see elsewhere
+    ## (-u)
+    $selExtraOpts.use_median_approximation
+    ## (-U)
+    $selExtraOpts.save_memory_gappy_alignments
+    ## (-V)
+    $selExtraOpts.disable_rate_heterogeneity
+    ## (-W)
+    #if $selExtraOpts.sliding_window_size:
+        --sliding_window_size $selExtraOpts.sliding_window_size
+    #end if
+    ## (-x)
+    #if $selExtraOpts.rapid_bootstrap_random_seed:
+        --rapid_bootstrap_random_seed $selExtraOpts.rapid_bootstrap_random_seed
+    #end if
+    ## (-y)
+    $selExtraOpts.parsimony_starting_tree_only
+    ## (-z)
+    #if $selExtraOpts.file_multiple_trees:
+        --file_multiple_trees $selExtraOpts.file_multiple_trees
+    #end if
+#end if
+
+    </command>
+  <inputs>
+    ## (-s)
+    <param type="data" format="fasta,phylip" name="infile" label="Source file"/> 
+    ## (-m)
+    <conditional name="search_model_selector">
+        <param name="model_type" type="select" label="Model Type">
+            <option value="nucleotide" selected="true">Nucleotide</option>
+            <option value="aminoacid">Amino Acid</option>
+            <option value="binary">Binary</option>
+            <option value="multistate">Multistate</option>
+        </param>
+        <when value="nucleotide">
+    ## Nucleotide substitution models
+            <param name="base_model" type="select" label="Substitution Model">
+                <option value="GTRCAT">GTRCAT</option> 
+                <option value="GTRCATI">GTRCATI</option> 
+                <option value="GTRGAMMA" select="true">GTRGAMMA</option>
+                <option value="GTRGAMMAI">GTRGAMMAI</option>
+            </param>
+        </when>
+    ## Aminoacid substitution models
+        <when value="aminoacid">
+            <param name="aa_model_empirical_base_frequencies"
+                type="boolean" checked="no" truevalue="--aa_empirical_freq" falsevalue="" display="checkboxes" label="Use empirical base frequencies in AA models" />
+            <param name="base_model" type="select" label="Substitution Model (-m)">
+                <option value="PROTCAT" select="true">PROTCAT</option>
+                <option value="PROTCATI">PROTCATI</option>
+                <option value="PROTGAMMA">PROTGAMMA</option>
+                <option value="PROTGAMMAI">PROTGAMMAI</option>
+            </param>
+            <param name="aa_search_matrix" type="select" label="Matrix">
+                <option value="DAYHOFF" select="true">DAYHOFF</option>
+                <option value="DCMUT">DCMUT</option>
+                <option value="JTT">JTT</option>
+                <option value="MTREV">MTREV</option>
+                <option value="WAG">WAG</option>
+                <option value="RTREV">RTREV</option>
+                <option value="CPREV">CPREV</option>
+                <option value="VT">VT</option>
+                <option value="BLOSUM62">BLOSUM62</option>
+                <option value="MTMAM">MTMAM</option>
+                <option value="LG">LG</option>
+                <option value="MTART">MTART</option>
+                <option value="MTZOA">MTZOA</option>
+                <option value="PMB">PMB</option>
+                <option value="HIVB">HIVB</option>
+                <option value="HIVW">HIVW</option>
+                <option value="JTTDCMUT">JTTDCMUT</option>
+                <option value="FLU">FLU</option>
+                <option value="DUMMY">DUMMY</option>
+                <option value="DUMMY2">DUMMY2</option>
+                <option value="GTR_UNLINKED">GTR_UNLINKED</option>
+                <option value="GTR">GTR</option>
+            </param>
+        </when>
+## Binary substitution models
+        <when value="binary">
+            <param name="base_model" type="select" label="Substitution Model">
+                <option value="BINCAT">BINCAT</option> 
+                <option value="BINCATI">BINCATI</option> 
+                <option value="BINGAMMA">BINGAMMA</option> 
+                <option value="BINGAMMAI">BINGAMMAI</option> 
+            </param>
+        </when>
+## Multi-state substitution models
+        <when value="multistate">
+            <param name="base_model" type="select" label="Substitution Model">
+                <option value="MULTICAT">MULTICAT</option> 
+                <option value="MULTICATI">MULTICATI</option> 
+                <option value="MULTIGAMMA">MULTIGAMMA</option> 
+                <option value="MULTIGAMMAI">MULTIGAMMAI</option> 
+            </param>
+        </when>
+    </conditional>
+    <param name="random_seed" type="integer" value="1234567890" size="12" label="Random
+        seed used for the parsimony inferences" />
+    <conditional name="selExtraOpts">
+        <param name="extraOptions" type="select" label="RAxML options to use"
+            help="The required minimal settings are the input file and the
+            substitution model. To specify extra options select the 'Full option list'">
+            <option value="required">Required options only</option>
+            <option value="full">Full option list</option>
+        </param>
+        <when value="full">
+            ## (-N/#)
+            <param name="number_of_runs" type="integer" size="8" value=""
+                label="Number of runs" help="Specify the number of
+                alternative runs (-N|#) on distinct starting trees In combination
+                with the '-b' option will invoke a multiple boostrap analysis.
+                You can add the bootstopping criteria by choosing the autoMR,
+                autoMRE, autoMRE_IGN, or autoFC value in a menu below instead of
+                providing a number here. Bootstopping will only work in
+                combination with '-x' or '-b'."
+                optional="True" />
+            <param name="number_of_runs_bootstop" type="select" label="Use bootstopping criteria for number of runs" optional="True">
+                <option value="" selected="yes"></option>
+                <option value="autoMR">autoMR</option>
+                <option value="autoMRE">autoMRE</option>
+                <option value="autoMRE_IGN">autoMRE_IGN</option>
+                <option value="autoFC">autoFC</option>
+            </param>
+            ## Alphabetical Listing of Advanced Options
+            ## (-a)
+            <param format="txt" name="weightfile" type="data" label="Column weight file" optional="True" />
+            ## (-A)
+            <param name="secondary_structure_model" type="select" label="Secondary structure substitution model" optional="True">
+                <option value="" selected="yes"></option>
+                <option value="S6A">S6A</option>
+                <option value="S6B">S6B</option>
+                <option value="S6C">S6C</option>
+                <option value="S6D">S6D</option>
+                <option value="S6E">S6E</option>
+                <option value="S7A">S7A</option>
+                <option value="S7B">S7B</option>
+                <option value="S7C">S7C</option>
+                <option value="S7D">S7D</option>
+                <option value="S7E">S7E</option>
+                <option value="S7F">S7F</option>
+                <option value="S16">S16</option>
+                <option value="S16A">S16A</option>
+                <option value="S16B">S16B</option>
+            </param>
+            ## (-b)
+            <param name="bootseed" type="integer" size="8" value="" label="Random number for non-parametric bootstrapping" refresh_on_change='true'  optional="True" />
+            ## (-x)
+            <param name="rapid_bootstrap_random_seed" type="integer" value='' size="7" label="Rapid bootstrapping random seed" optional="True" help="Specify a random seed and turn on rapid bootstrapping. CAUTION: unlike in version 7.0.4 RAxML will conduct rapid BS replicates under the model of rate heterogeneity you specified via '-m' and not by default under CAT." />
+            ## (-B)
+            <param name="cutoff_threshold" type="float" size="8" label="MR Cutoff threshold" value="" help="Cutoff threshold for the MR-based bootstopping criteria, recommended value is 0.1" optional="True" />
+            ## (-c)
+            <param name="numofcats" type="integer" size="8" label="Number of Rate Categories for GTRCAT/GTRMIX" optional="True" />
+                ## (-C) Conduct model parameter optimization doesn't work in the pthreads version. Skip for now.
+            ## (-d)
+            <param name="search_complete_random_tree" type="boolean" checked="False" truevalue="--search_complete_random_tree" falsevalue="" display="checkboxes" label="Start ML optimization from a complete random starting tree" />
+            ## (-D)
+            <param name="ml_search_convergence" type="boolean" checked="False" truevalue="--ml_search_convergence" falsevalue="" label="ML search convergence criterion" />
+            ## (-e)
+            <param name="model_opt_precision" type="float" size="8" label="Model optimization precision" value="" help="Set model optimization precision in log likelihood units when MIX/MIXI or GAMMA/GAMMAI models are used" optional="True" />
+            ## (-E)
+            <param format="txt" name="excludefile" type="data" label="Exclude file" optional="True" />
+            ## (-f)
+            <param name="search_algorithm" type="select" label="Algorithm to execute" optional="True">
+                <option value="a">Rapid bootstrap and best ML tree search (a)</option>
+                <option value="A">Compute marginal ancestral states (A)</option>
+                <option value="b">Draw bipartition information (b)</option>
+                <option value="c">Check if the alignment can be read (c)</option>
+                <option value="d" selected="true">Hill-climbing ML Search (d) (default)</option>
+                <option value="e">Optimize GAMMA/GAMMAI model/branches (e)</option>
+                <option value="g">Compute per-site log likelihoods for -z trees (g)</option>
+                <option value="h">Compute log likelihood test for -t / -z trees (h)</option>
+                <option value="j">Generate bootstrapped alignment files (j)</option>
+                <option value="J">Compute SH-like support values for the -t tree (J)</option>
+                <option value="m">Compare bipartitions between -t and -z trees (m)</option>
+                <option value="n">Compute log likelihood score for -z trees (n)</option>
+                <option value="o">Use old slower search algorithm (o)</option>
+                <option value="p">Stepwise MP addition of new sequences (p)</option>
+                <option value="q">Fast quartet calculator (q)</option>
+                <option value="r">Compute pairwise RF distances in -z trees (r)</option>
+                <option value="s">Split a multi-gene alignment (s)</option>
+                <option value="S">Compute site-specific placement bias (S)</option>
+                <option value="t">Randomized tree searches on a fixed starting tree (t)</option>
+                <option value="T">Final optimization of a ML tree from a bootstrap (T)</option>
+                <option value="u">Morphological weight calibration using ML on a -t tree (u)</option>
+                <option value="v">Classify environmental sequences (v)</option>
+                <option value="w">Compute ELW-test on -z trees (w)</option>
+                <option value="x">Compute GAMMA model pair-wise ML distances on a tree (x)</option>
+                <option value="y">Classify environmental sequences into a reference tree (y)</option>
+            </param>
+            ## (-F)
+            <param name="save_memory_cat_model" type="boolean" checked="no" truevalue="--save_memory_cat_model" falsevalue="" display="checkboxes" label="ML tree searches under CAT model" optional="True" help="ML tree searches under CAT model for very large trees without switching to GAMMA in the end (saves memory) and no thorough optimization under GAMMA" />
+            ## (-g)
+            <param name="groupingfile" format="txt" type="data" label="Multifurcating constraint tree" optional="True" />
+            ## (-G)
+            <param name="enable_evol_heuristics" type="float" size="8" label="Enable the ML-based evolutionary placement algorithm heuristics" help="Enable the ML-based evolutionary placement algorithm heuristics by specifiyng a threshold value (fraction of insertion branches to be evaluated using slow insertions under ML)." optional="True" >
+                <validator type="in_range" message="0.0 &lt;= fraction &lt;= 1.0" min="0.0" max="1.0"/>
+            </param>
+            ## (-i)
+            <param name="initial_rearrangement_setting" type="integer" size="5" value="" label="Initial rearrangement setting" optional="True" />
+            ## (-I)
+            <param name="posterior_bootstopping_analysis" type="select" label="Posterior bootstopping analysis" optional="True">
+                <option value="" selected="True"></option>
+                <option value="autoFC">Frequency-based criterion (autoFC)</option>
+                <option value="autoMR">Majority-rule consensus tree criterion (autoMR)</option>
+                <option value="autoMRE">Extended majority-rule consensus tree criterion (autoMRE)</option>
+                <option value="autoMRE_IGN">Extended MR consensus tree criterion with bipartitions (autoMRE_IGN)</option>
+            </param>
+            ## (-j) - EMPTY - we cannot handle intermediate tree files in Galaxy
+            ## (-J)
+            <param name="majority_rule_consensus" type="select" label="Compute consensus tree" optional="True">
+                <option value="" selected="True"></option>
+                <option value="MR">Majority-rule consensus tree (MR)</option>
+                <option value="MRE">Extended majority-rule consensus tree (MRE)</option>
+                <option value="STRICT">Strict consensus tree (STRICT)</option>
+                <option value="STRICT_DROP">Identify strict dropsets (STRICT_DROP)</option>
+                <option value="MR_DROP">Identify majority-rule dropsets (MR_DROP)</option>
+            </param>
+            ## (-k)
+            <param name="print_branch_lengths" type="boolean" checked="no" truevalue="--print_branch_lengths" falsevalue="" display="checkboxes" label="Print bootstrapped trees with branch lengths" help="Specifies that bootstrapped trees should be printed with branch lengths. The bootstraps will run a bit longer, because model parameters will be optimized at the end of each run under GAMMA or GAMMA+P-Invar respectively." optional="True" />
+            ## (-K)
+            <param name="multistate_sub_model" type="select" label="Specify a
+                multi-state substitution model" optional="True">
+                <option value="" selected="true"></option>
+                <option value="GTR">GTR</option>
+                <option value="ORDERED">ORDERED</option>
+                <option value="MK">MK</option>
+            </param>
+            ## (-M)
+            <param name="estimate_individual_branch_lengths" type="boolean" checked="no" truevalue="--estimate_individual_branch_lengths" falsevalue="" display="checkboxes" label="Estimate individual per-partition branch lengths" help="Only has effect with a partition file (-q)." optional="True" />
+            ## (-n) name is hard-coded to 'galaxy' for more straightforward handling of output files
+            ## (-o)
+            <param name="outgroup_name" type="text" size="40" value="" label="Outgroup name" help="E.g. Mouse or Mouse,Rat. No spaces between taxon names are allowed." optional="True" />
+            ## (-O)
+            <param name="disable_undetermined_seq_check" type="boolean" checked="no" truevalue="--disable_undertermined_seq_check" falsevalue="" display="checkboxes" label="Disable check for completely undetermined sequence in alignment" optional="True" help="Disable the check for completely undetermined sequence in alignment. The program will not exit with an error message when '-O' is specified." />
+            <param name="external_protein_model" format="txt" type="data" label="External AA substitution model" help="Specify the file name of a user-defined AA (Protein) substitution model. This file must contain 420 entries, the first 400 being the AA substitution rates (this must be a symmetric matrix) and the last 20 are the empirical base frequencies." optional="True" />
+            ## (-q)
+            <param name="multiple_model" format="txt" type="data" label="Multiple model assignment to alignment partitions" optional="True" help="Specify the file name which contains the assignment of models to alignment partitions for multiple models of substitution. For the syntax of this file please consult the manual." />
+            ## (-r)
+            <param name="constraint_file" format="txt" type="data" label="Binary constraint tree" optional="True" help="Specify the file name of a binary constraint tree. This tree does not need to be comprehensive, i.e. must not contain all taxa." />
+            ## (-R)
+            <param name="bin_model_parameter_file" format="txt" type="data" label="Binary model parameter file" optional="True" help="Specify the file name of a binary model parameter file that has previously been generated with RAxML using the '-f e' tree evaluation option." />
+            ## (-s) source file option is in the required options section
+            ## (-S)
+            <param name="secondary_structure_file" format="txt" type="data" label="Secondary structure file" optional="True" help="Specify the name of a secondary structure file. The file can contain '.' for alignment columns that do not form part of a stem and characters '()&lt;&gt;[]{}' to define stem regions and pseudoknots."/>
+            ## (-t)
+            <param name="start_tree_file" format="txt" type="data" label="Starting tree file" optional="True" help="Specify a user starting tree file name in Newick format." />
+            ## (-T) is hard-coded in the required options section
+            <param name="use_median_approximation" type="boolean" checked="no" truevalue="--use_median_approximation" falsevalue="" display="checkboxes" label="Use the median for the discrete approximation" help="Use the median for the discrete approximation of the GAMMA model of rate heterogeneity." optional="True" />
+            ## (-U)
+            <param name="save_memory_gappy_alignments" type="boolean" checked="no" truevalue="--save_memory_gappy_alignments" falsevalue="" display="checkboxes" label="Save memory on large gappy alignments" help="Try to save memory by using SEV-based implementation for gap columns on large gappy alignments." optional="True" />
+            ## (-V)
+            <param name="disable_rate_heterogeneity" type="boolean" checked="no" truevalue="--disable_raite_heterogeneity" falsevalue="" display="checkboxes" label="Disable rate heterogeneity" help="Disable rate heterogeneity among sites model and use one without rate heterogeneity instead. Only works if you specify the CAT model of rate heterogeneity." optional="True" />
+            ## (-W)
+            <param name="sliding_window_size" type="integer" size="5" value="" label="Sliding window size" optional="True" help="Sliding window size for leave-one-out site-specific placement bias algorithm. Only effective when used in combination with '-f S'. Default is '100 sites'" />
+            ## (-x) - see it by the (-b)
+            ## (-y)
+            <param name="parsimony_starting_tree_only" type="boolean" checked="no" truevalue="--parsimony_starting_tree_only" falsevalue="" display="checkboxes" label="Compute a randomized parsimony starting tree only" optional="True" help="If you want to only compute a parsimony starting tree with RAxML specify '-y'. The program will exit after computation of the starting tree." />
+            ## (-z)
+            <param name="file_multiple_trees" format="txt" type="data" label="Multiple trees file" help="Specify the file name of a file containing multiple trees e.g. from a bootstrap that shall be used to draw bipartition values onto a tree provided with '-t', It can also be used to compute per site log likelihoods in combination with '-f g' and to read a bunch of trees for '-f h', '-f m' and '-f n'." optional="True" />
+        </when> ## full option list
+    </conditional> ## END $selExtraOpts
+  </inputs>
+  <outputs>
+        <data format="txt" name="info" from_work_dir="RAxML_info.galaxy" label="Info" />
+      ## REQUIRED
+        <data format="txt" name="logReq" from_work_dir="RAxML_log.galaxy" label="Log">
+            <filter>(selExtraOpts['extraOptions'] == 'required')</filter>
+            <filter>selExtraOpts['search_algorithm'] != 'a'</filter>
+        </data>
+        <data format="txt" name="bestTreeReq" from_work_dir="RAxML_bestTree.galaxy" label="Best-scoring ML Tree">
+            <filter>(selExtraOpts['extraOptions'] == 'required')</filter>
+        </data>
+        <data format="txt" name="parsimonyTreeReq" from_work_dir="RAxML_parsimonyTree.galaxy" label="Parsimony Tree">
+            <filter>(selExtraOpts['extraOptions'] == 'required')</filter>
+            <filter>selExtraOpts['search_algorithm'] != 'a'</filter>
+        </data>
+        <data format="txt" name="resultReq" from_work_dir="RAxML_result.galaxy" label="Result">
+            <filter>(selExtraOpts['extraOptions'] == 'required')</filter>
+            <filter>selExtraOpts['search_algorithm'] != 'a'</filter>
+        </data>
+      ## ADVANCED
+        <data format="txt" name="randomTree" from_work_dir="RAxML_randomTree.galaxy" label="Random Tree">
+            <filter>selExtraOpts['search_complete_random_tree'] is True</filter>
+            <filter>selExtraOpts['extraOptions'] == "full"</filter>
+        </data>
+        <data format="txt" name="bestTree" from_work_dir="RAxML_bestTree.galaxy" label="Best-scoring ML Tree">
+            <filter>(selExtraOpts['extraOptions'] == 'full')</filter>
+            <filter>(selExtraOpts['rapid_bootstrap_random_seed'] == '' or selExtraOpts['bootseed'] == '') and (selExtraOpts['search_algorithm'] == 'a')</filter>
+            <filter>(selExtraOpts['search_algorithm'] != 'b')</filter>
+            <filter>(selExtraOpts['majority_rule_consensus'] == '')</filter>
+        </data>
+        <data format="txt" name="bestTreeMultipleModel" from_work_dir="RAxML_bestTree.galaxy" label="Best-scoring ML Tree">
+            <filter>(selExtraOpts['extraOptions'] == "full")</filter>
+            <filter>(selExtraOpts['multiple_model'] != '')</filter>
+        </data>
+        <data format="txt" name="bestTreeMultipleModelPartitions" from_work_dir="RAxML_bestTreePartitions.galaxy" label="Best-scoring ML Tree Partitions">
+            <filter>(selExtraOpts['extraOptions'] == "full")</filter>
+            <filter>selExtraOpts['multiple_model'] is not None </filter>
+        </data>
+        <data format="txt" name="log" from_work_dir="RAxML_log.galaxy" label="Log">
+            <filter>(selExtraOpts['extraOptions'] == "full")</filter>
+            <filter>(selExtraOpts['rapid_bootstrap_random_seed'] == '')</filter>
+            <filter>(selExtraOpts['bootseed'] == '')</filter> 
+            <filter>(selExtraOpts['search_algorithm'] != 'a')</filter>
+            <filter>(selExtraOpts['search_algorithm'] != 'b')</filter>
+            <filter>(selExtraOpts['majority_rule_consensus'] == '') </filter>
+        </data>
+        <data format="txt" name="result" from_work_dir="RAxML_result.galaxy" label="Result">
+            <filter>(selExtraOpts['extraOptions'] == "full")</filter>
+            <filter>(selExtraOpts['rapid_bootstrap_random_seed'] == '')</filter>
+            <filter>selExtraOpts['bootseed'] == ''</filter> 
+            <filter>selExtraOpts['search_algorithm'] != 'a'</filter>
+            <filter>selExtraOpts['search_algorithm'] != 'b'</filter>
+            <filter>(selExtraOpts['majority_rule_consensus'] == '') </filter>
+        </data>
+        <data format="txt" name="resultMultipleModelPartitions" from_work_dir="RAxML_resultPartitions.galaxy" label="Result Partitions">
+            <filter>(selExtraOpts['extraOptions'] == "full")</filter>
+            <filter>(selExtraOpts['multiple_model'] is not None)</filter>
+        </data>
+        <data format="txt" name="parsimonyTree" from_work_dir="RAxML_parsimonyTree.galaxy" label="Parsimony Tree">
+            <filter>(selExtraOpts['extraOptions'] == "full")</filter>
+            <filter>(selExtraOpts['rapid_bootstrap_random_seed'] == '')</filter>
+            <filter>(selExtraOpts['bootseed'] == '')</filter> 
+            <filter>(selExtraOpts['search_algorithm'] != 'a')</filter>
+            <filter>(selExtraOpts['constraint_file'] is None)</filter>
+            <filter>(selExtraOpts['groupingfile'] is None)</filter>
+            <filter>(selExtraOpts['search_complete_random_tree'] is False)</filter>
+            <filter>(selExtraOpts['start_tree_file'] is None)</filter>
+            <filter>(selExtraOpts['majority_rule_consensus'] == '') </filter>
+        </data>
+        <data format="txt" name="bootstrap" from_work_dir="RAxML_bootstrap.galaxy" label="Final Bootstrap Trees">
+            <filter>selExtraOpts['extraOptions'] == "full"</filter>
+            <filter>selExtraOpts['number_of_runs'] != '' or selExtraOpts['number_of_runs_bootstop'] != ''</filter>
+            <filter>selExtraOpts['rapid_bootstrap_random_seed'] != '' or selExtraOpts['bootseed'] != ''</filter>
+        </data>
+        <data format="txt" name="bipartitions" from_work_dir="RAxML_bipartitions.galaxy" label="Bipartitions">
+            <filter>(selExtraOpts['search_algorithm'] == 'b') or ((selExtraOpts['search_algorithm'] == 'a') and (selExtraOpts['rapid_bootstrap_random_seed'] != '')) </filter>
+            <filter>selExtraOpts['extraOptions'] == "full"</filter>
+        </data>
+        <data format="txt" name="bipartitionsBranchLabels" from_work_dir="RAxML_bipartitionsBranchLabels.galaxy" label="Bipartitions Branch Labels">
+            <filter>selExtraOpts['extraOptions'] == "full"</filter>
+            <filter>(selExtraOpts['search_algorithm'] == 'b') or ((selExtraOpts['search_algorithm'] == 'a') and (selExtraOpts['rapid_bootstrap_random_seed'] != '')) </filter>
+        </data>
+        <data format="txt" name="strictConsensusTree" from_work_dir="RAxML_StrictConsensusTree.galaxy" label="Strict Consensus Tree">
+            <filter>selExtraOpts['extraOptions'] == "full"</filter>
+            <filter>(selExtraOpts['majority_rule_consensus'] == 'STRICT') </filter>
+        </data>
+        <data format="txt" name="majorityRuleConsensusTree" from_work_dir="RAxML_MajorityRuleConsensusTree.galaxy" label="Majority Rule Consensus Tree">
+            <filter>selExtraOpts['extraOptions'] == "full"</filter>
+            <filter>(selExtraOpts['majority_rule_consensus'] == 'MR')</filter>
+        </data>
+        <data format="txt" name="majorityRuleExtendedConsensusTree" from_work_dir="RAxML_MajorityRuleExtendedConsensusTree.galaxy" label="Majority Rule Extended Consensus Tree">
+            <filter>selExtraOpts['extraOptions'] == "full"</filter>
+            <filter>(selExtraOpts['majority_rule_consensus'] == 'MRE')</filter>
+        </data>
+        <data format="txt" name="bipartitionFreq" from_work_dir="RAxML_bipartitionFrequences.galaxy" label="Pair-wise bipartition frequences.">
+            <filter>selExtraOpts['search_algorithm'] == 'm' </filter>
+            <filter>selExtraOpts['extraOptions'] == "full"</filter>
+        </data>
+        <data format="txt" name="perSiteLLs" from_work_dir="RAxML_perSiteLLs.galaxy" label="Per-site likelihood schores">
+            <filter>selExtraOpts['search_algorithm'] == 'g' </filter>
+            <filter>selExtraOpts['extraOptions'] == "full"</filter>
+        </data>
+        <data format="txt" name="distances" from_work_dir="RAxML_distances.galaxy" label="Pair-wise distances">
+            <filter>selExtraOpts['search_algorithm'] == 'x' </filter>
+            <filter>selExtraOpts['extraOptions'] == "full"</filter>
+        </data>
+  </outputs>
+  <tests>
+      <test>
+          <param name="extraOptions" value="required"/>
+          <param name="infile" value="dna.phy"/>
+          <param name="model_type" value="nucleotide"/>
+          <param name="base_model" value="GTRCAT"/>
+          <output name="parsimonyTreeReq" file="RAxML_parsimonyTree.galaxy">
+          <output name="bestTreeReq"/>
+              <assert_contents>
+                <has_text_matching expression="Frog" />
+              </assert_contents>
+          </output>
+      </test>
+  </tests>
+  <help>
+Title:
+______
+Randomized Axelerated Maximum Likelihood
+
+Author:
+_______
+Alexandros Stamatakis 
+
+Description:
+____________
+
+RAxML is a program for Maximum Likelihood-based inference of large phylogenetic
+trees. The program is explicitly being developed to efficiently infer trees for
+extremely large datasets, either in terms of the number of taxa and/or the
+sequence length.
+
+This wrapper works with the RAxML version 8.2.4.
+
+URL:
+____
+Author's page: http://www.exelixis-lab.org/
+
+Help: http://groups.google.com/group/raxml
+
+
+Tool development:
+-----------------
+Oleksandr Moskalenko with adaptations from Tiago Antao.
+
+  </help>
+<citations>
+  <citation type="doi">10.1093/bioinformatics/btu033</citation>
+  <citation type="bibtex">
+@article{stamatakis2014raxml,
+  title={RAxML version 8: a tool for phylogenetic analysis and post-analysis of large phylogenies},
+  author={Stamatakis, Alexandros},
+  journal={Bioinformatics},
+  volume={30},
+  number={9},
+  pages={1312--1313},
+  year={2014},
+  publisher={Oxford Univ Press}}
+  </citation>
+</citations>
+</tool>
diff -r 000000000000 -r 66bcdd1ac9ca test-data/RAxML_parsimonyTree.galaxy
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/RAxML_parsimonyTree.galaxy	Tue Nov 03 16:27:41 2015 -0500
@@ -0,0 +1,1 @@
+(Whale,((((Mouse,Chicken),Human),Rat),((Frog,(Carp,Loach)),Seal)),Cow);
diff -r 000000000000 -r 66bcdd1ac9ca test-data/dna.phy
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/dna.phy	Tue Nov 03 16:27:41 2015 -0500
@@ -0,0 +1,11 @@
+10 60
+Cow       ATGGCATATCCCATACAACTAGGATTCCAAGATGCAACATCACCAATCATAGAAGAACTA
+Carp      ATGGCACACCCAACGCAACTAGGTTTCAAGGACGCGGCCATACCCGTTATAGAGGAACTT
+Chicken   ATGGCCAACCACTCCCAACTAGGCTTTCAAGACGCCTCATCCCCCATCATAGAAGAGCTC
+Human     ATGGCACATGCAGCGCAAGTAGGTCTACAAGACGCTACTTCCCCTATCATAGAAGAGCTT
+Loach     ATGGCACATCCCACACAATTAGGATTCCAAGACGCGGCCTCACCCGTAATAGAAGAACTT
+Mouse     ATGGCCTACCCATTCCAACTTGGTCTACAAGACGCCACATCCCCTATTATAGAAGAGCTA
+Rat       ATGGCTTACCCATTTCAACTTGGCTTACAAGACGCTACATCACCTATCATAGAAGAACTT
+Seal      ATGGCATACCCCCTACAAATAGGCCTACAAGATGCAACCTCTCCCATTATAGAGGAGTTA
+Whale     ATGGCATATCCATTCCAACTAGGTTTCCAAGATGCAGCATCACCCATCATAGAAGAGCTC
+Frog      ATGGCACACCCATCACAATTAGGTTTTCAAGACGCAGCCTCTCCAATTATAGAAGAATTA
\ No newline at end of file
diff -r 000000000000 -r 66bcdd1ac9ca tool_dependencies.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Tue Nov 03 16:27:41 2015 -0500
@@ -0,0 +1,6 @@
+<?xml version="1.0"?>
+<tool_dependency>
+  <package name="raxml" version="8.2.4">
+    <repository changeset_revision="25be7ee8d4b6" name="package_raxml_8_2_4" owner="tiagoantao" toolshed="https://testtoolshed.g2.bx.psu.edu" />
+  </package>
+</tool_dependency>