# HG changeset patch # User trinity_ctat # Date 1531842556 14400 # Node ID a940c4a36a43a73f627f130c3ed46166065d9a11 Upload ctat tools. diff -r 000000000000 -r a940c4a36a43 ctat_lncrna.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/ctat_lncrna.xml Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,181 @@ + + + Filters a high-quality set of lncRNA from reconstructed RNA-seq data + + ctat-lncrna + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + + +.. class:: infomark + +slncky is a tool for lncRNA discovery from RNA-Seq data. slncky filters a high-quality set of noncoding transcripts, discovers lncRNA orthologs, and characterizes conserved lncRNA evolution. + +To learn more about slncky visit their website_ . + +.. _website: https://github.com/slncky/slncky + + + + + 10.1186/s13059-016-0880-9 + + + diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.browse.html --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.browse.html Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,83 @@ + + + + + + + + + + + + + + + + + + + + + + +
+
+

Browse lncRNAs

+
+
+ + + + + + + + + + + + + + + + + + + + + + + + + + + +
LncNameOrthologOrtholog NameTypeTranscript-Transcript IdentityTrascript-Genome IdentityIndel RateConserved Splice SitesTotal Splice SitesLnc Exons AlignedOrtholog Exons Aligned
STRG.25.1MALAT1uc008gfj.2Malat1intergenic0.630.63-0.001,1,
STRG.5.1Unannotateduc009vfa.1Atpase6intergenic0.000.00-0.00NANA
STRG.52.1JA760615uc012hdm.1BC071253intergenic0.00-0.00-0.00NANA
STRG.48.2OK/SW-cl.16uc009vez.1Cox2intergenic0.00-0.00-0.00NANA
STRG.44.1TVAS5uc009vew.1AK018753intergenic0.00-0.00-0.00NANA
STRG.49.1OK/SW-cl.16uc009vfa.1Atpase6intergenic0.00-0.00-0.00NANA
STRG.45.1TVAS5uc009vew.1AK018753intergenic0.00-0.00-0.00NANA
STRG.51.1MTND5uc009vfc.1Cytbintergenic0.00-0.00-0.00NANA
+
+ + diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.canonical_to_lncs.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.canonical_to_lncs.txt Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,27 @@ +#canonical lncs +STRG.45.1 STRG.45.1, +STRG.28.1 STRG.28.2,STRG.28.1, +STRG.25.1 STRG.25.2,STRG.25.1, +STRG.44.1 STRG.44.1, +STRG.2.1 STRG.2.1, +STRG.15.2 STRG.15.2,STRG.15.1, +STRG.50.1 STRG.50.1, +STRG.3.1 STRG.3.1, +STRG.17.1 STRG.17.1, +STRG.48.1 STRG.48.1, +STRG.48.2 STRG.48.2, +STRG.1.1 STRG.1.1, +STRG.42.1 STRG.42.1, +STRG.51.1 STRG.51.1, +STRG.8.1 STRG.8.1, +STRG.7.1 STRG.7.1, +STRG.6.1 STRG.6.1, +STRG.52.1 STRG.52.1, +STRG.10.1 STRG.10.1, +STRG.47.1 STRG.47.1, +STRG.46.1 STRG.46.1, +STRG.5.1 STRG.5.1,STRG.5.2,STRG.4.1, +STRG.22.1 STRG.22.1, +STRG.43.1 STRG.43.1, +STRG.23.1 STRG.23.1, +STRG.49.1 STRG.49.1,STRG.49.2,STRG.49.3, diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.canonical_to_lncs.txt.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.canonical_to_lncs.txt.sorted Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,27 @@ +#canonical lncs +STRG.10.1 STRG.10.1, +STRG.1.1 STRG.1.1, +STRG.15.2 STRG.15.2,STRG.15.1, +STRG.17.1 STRG.17.1, +STRG.2.1 STRG.2.1, +STRG.22.1 STRG.22.1, +STRG.23.1 STRG.23.1, +STRG.25.1 STRG.25.2,STRG.25.1, +STRG.28.1 STRG.28.2,STRG.28.1, +STRG.3.1 STRG.3.1, +STRG.42.1 STRG.42.1, +STRG.43.1 STRG.43.1, +STRG.44.1 STRG.44.1, +STRG.45.1 STRG.45.1, +STRG.46.1 STRG.46.1, +STRG.47.1 STRG.47.1, +STRG.48.1 STRG.48.1, +STRG.48.2 STRG.48.2, +STRG.49.1 STRG.49.1,STRG.49.2,STRG.49.3, +STRG.50.1 STRG.50.1, +STRG.51.1 STRG.51.1, +STRG.5.1 STRG.5.1,STRG.5.2,STRG.4.1, +STRG.52.1 STRG.52.1, +STRG.6.1 STRG.6.1, +STRG.7.1 STRG.7.1, +STRG.8.1 STRG.8.1, diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.cluster_info.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.cluster_info.txt Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,6 @@ +3 N STRG.22.1,STRG.15.2,STRG.6.1, +3 N STRG.7.1,STRG.10.1,STRG.43.1, +2 N STRG.1.1,STRG.46.1, +2 N STRG.47.1,STRG.2.1, +2 N STRG.48.1,STRG.3.1, +#clusterSize alignToDup? transcripts diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.cluster_info.txt.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.cluster_info.txt.sorted Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,6 @@ +2 N STRG.1.1,STRG.46.1, +2 N STRG.47.1,STRG.2.1, +2 N STRG.48.1,STRG.3.1, +3 N STRG.22.1,STRG.15.2,STRG.6.1, +3 N STRG.7.1,STRG.10.1,STRG.43.1, +#clusterSize alignToDup? transcripts diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.filtered_info.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.filtered_info.txt Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,49 @@ +STRG.19.1 200.0% exonic overlap with coding transcript uc003ubx.4 +STRG.16.1 100.0% exonic overlap with coding transcript NM_001003806 +STRG.14.1 100.0% exonic overlap with coding transcript uc003nxk.2 +STRG.29.1 100.0% exonic overlap with coding transcript NM_001014449 +STRG.13.1 100.0% exonic overlap with coding transcript NM_005345 +STRG.27.1 100.0% exonic overlap with coding transcript uc001oja.3 +STRG.18.1 100.0% exonic overlap with coding transcript uc003tzi.4 +STRG.26.1 100.0% exonic overlap with coding transcript uc001oiw.2 +STRG.20.1 99.8% exonic overlap with coding transcript NM_198085 +STRG.37.1 99.8% exonic overlap with coding transcript uc002klr.3 +STRG.41.1 99.6% exonic overlap with coding transcript NM_014649 +STRG.33.1 97.7% exonic overlap with coding transcript NM_198993 +STRG.40.1 88.6% exonic overlap with coding transcript NM_002967 +STRG.31.3 71.4% exonic overlap with coding transcript uc002hqy.1 +STRG.32.1 40.2% exonic overlap with coding transcript uc002hrq.1 +STRG.30.1 37.4% exonic overlap with coding transcript uc002fnn.2 +STRG.34.1 35.7% exonic overlap with coding transcript uc002hsq.3 +STRG.24.1 32.7% exonic overlap with coding transcript uc001ocx.3 +STRG.39.1 32.6% exonic overlap with coding transcript NM_004152 +STRG.36.1 20.8% exonic overlap with coding transcript uc002iyw.4 +STRG.38.1 transcript entirely within coding transcript NM_001003652 +STRG.11.1 transcript entirely within coding transcript NM_173666 +STRG.21.2 transcript entirely within coding transcript uc011leg.2 +STRG.21.1 transcript entirely within coding transcript NM_001164750 +STRG.31.1 transcript entirely within coding transcript NM_000978 +STRG.31.2 transcript entirely within coding transcript uc002hqx.1 +STRG.9.1 transcript entirely within coding transcript NM_020357 +STRG.35.1 transcript entirely within coding transcript NM_001075099 +STRG.12.1 transcript entirely within coding transcript uc011dmq.2 +STRG.2.1 aligns to STRG.47.1 with 98.6% identity and 99.9% coverage. Appears to be duplication. +STRG.15.2 aligns to STRG.22.1 with 99.4% identity and 100.0% coverage. Appears to be duplication. +STRG.15.2 aligns to STRG.6.1 with 97.0% identity and 100.0% coverage. Appears to be duplication. +STRG.3.1 aligns to STRG.48.1 with 98.2% identity and 99.9% coverage. Appears to be duplication. +STRG.48.1 aligns to STRG.3.1 with 98.2% identity and 99.9% coverage. Appears to be duplication. +STRG.1.1 aligns to STRG.46.1 with 98.5% identity and 99.9% coverage. Appears to be duplication. +STRG.7.1 aligns to STRG.43.1 with 90.7% identity and 100.0% coverage. Appears to be duplication. +STRG.7.1 aligns to STRG.10.1 with 90.1% identity and 98.9% coverage. Appears to be duplication. +STRG.6.1 aligns to STRG.22.1 with 97.1% identity and 100.0% coverage. Appears to be duplication. +STRG.6.1 aligns to STRG.15.2 with 97.0% identity and 100.0% coverage. Appears to be duplication. +STRG.10.1 aligns to STRG.7.1 with 90.1% identity and 98.9% coverage. Appears to be duplication. +STRG.10.1 aligns to STRG.43.1 with 89.5% identity and 99.3% coverage. Appears to be duplication. +STRG.47.1 aligns to STRG.2.1 with 98.6% identity and 99.9% coverage. Appears to be duplication. +STRG.46.1 aligns to STRG.1.1 with 98.5% identity and 99.9% coverage. Appears to be duplication. +STRG.22.1 aligns to STRG.15.2 with 99.4% identity and 100.0% coverage. Appears to be duplication. +STRG.22.1 aligns to STRG.6.1 with 97.1% identity and 100.0% coverage. Appears to be duplication. +STRG.43.1 aligns to STRG.10.1 with 89.5% identity and 99.3% coverage. Appears to be duplication. +STRG.43.1 aligns to STRG.7.1 with 90.7% identity and 100.0% coverage. Appears to be duplication. +STRG.17.1 aligns to mm9 coding transcript uc008zth.2 with 65.4% exonic identity +STRG.17.1 aligns to mm9 coding transcript NM_133900 with 65.4% exonic identity diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.filtered_info.txt.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.filtered_info.txt.sorted Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,49 @@ +STRG.10.1 aligns to STRG.43.1 with 89.5% identity and 99.3% coverage. Appears to be duplication. +STRG.10.1 aligns to STRG.7.1 with 90.1% identity and 98.9% coverage. Appears to be duplication. +STRG.11.1 transcript entirely within coding transcript NM_173666 +STRG.1.1 aligns to STRG.46.1 with 98.5% identity and 99.9% coverage. Appears to be duplication. +STRG.12.1 transcript entirely within coding transcript uc011dmq.2 +STRG.13.1 100.0% exonic overlap with coding transcript NM_005345 +STRG.14.1 100.0% exonic overlap with coding transcript uc003nxk.2 +STRG.15.2 aligns to STRG.22.1 with 99.4% identity and 100.0% coverage. Appears to be duplication. +STRG.15.2 aligns to STRG.6.1 with 97.0% identity and 100.0% coverage. Appears to be duplication. +STRG.16.1 100.0% exonic overlap with coding transcript NM_001003806 +STRG.17.1 aligns to mm9 coding transcript NM_133900 with 65.4% exonic identity +STRG.17.1 aligns to mm9 coding transcript uc008zth.2 with 65.4% exonic identity +STRG.18.1 100.0% exonic overlap with coding transcript uc003tzi.4 +STRG.19.1 200.0% exonic overlap with coding transcript uc003ubx.4 +STRG.20.1 99.8% exonic overlap with coding transcript NM_198085 +STRG.21.1 transcript entirely within coding transcript NM_001164750 +STRG.21.2 transcript entirely within coding transcript uc011leg.2 +STRG.2.1 aligns to STRG.47.1 with 98.6% identity and 99.9% coverage. Appears to be duplication. +STRG.22.1 aligns to STRG.15.2 with 99.4% identity and 100.0% coverage. Appears to be duplication. +STRG.22.1 aligns to STRG.6.1 with 97.1% identity and 100.0% coverage. Appears to be duplication. +STRG.24.1 32.7% exonic overlap with coding transcript uc001ocx.3 +STRG.26.1 100.0% exonic overlap with coding transcript uc001oiw.2 +STRG.27.1 100.0% exonic overlap with coding transcript uc001oja.3 +STRG.29.1 100.0% exonic overlap with coding transcript NM_001014449 +STRG.30.1 37.4% exonic overlap with coding transcript uc002fnn.2 +STRG.31.1 transcript entirely within coding transcript NM_000978 +STRG.31.2 transcript entirely within coding transcript uc002hqx.1 +STRG.31.3 71.4% exonic overlap with coding transcript uc002hqy.1 +STRG.3.1 aligns to STRG.48.1 with 98.2% identity and 99.9% coverage. Appears to be duplication. +STRG.32.1 40.2% exonic overlap with coding transcript uc002hrq.1 +STRG.33.1 97.7% exonic overlap with coding transcript NM_198993 +STRG.34.1 35.7% exonic overlap with coding transcript uc002hsq.3 +STRG.35.1 transcript entirely within coding transcript NM_001075099 +STRG.36.1 20.8% exonic overlap with coding transcript uc002iyw.4 +STRG.37.1 99.8% exonic overlap with coding transcript uc002klr.3 +STRG.38.1 transcript entirely within coding transcript NM_001003652 +STRG.39.1 32.6% exonic overlap with coding transcript NM_004152 +STRG.40.1 88.6% exonic overlap with coding transcript NM_002967 +STRG.41.1 99.6% exonic overlap with coding transcript NM_014649 +STRG.43.1 aligns to STRG.10.1 with 89.5% identity and 99.3% coverage. Appears to be duplication. +STRG.43.1 aligns to STRG.7.1 with 90.7% identity and 100.0% coverage. Appears to be duplication. +STRG.46.1 aligns to STRG.1.1 with 98.5% identity and 99.9% coverage. Appears to be duplication. +STRG.47.1 aligns to STRG.2.1 with 98.6% identity and 99.9% coverage. Appears to be duplication. +STRG.48.1 aligns to STRG.3.1 with 98.2% identity and 99.9% coverage. Appears to be duplication. +STRG.6.1 aligns to STRG.15.2 with 97.0% identity and 100.0% coverage. Appears to be duplication. +STRG.6.1 aligns to STRG.22.1 with 97.1% identity and 100.0% coverage. Appears to be duplication. +STRG.7.1 aligns to STRG.10.1 with 90.1% identity and 98.9% coverage. Appears to be duplication. +STRG.7.1 aligns to STRG.43.1 with 90.7% identity and 100.0% coverage. Appears to be duplication. +STRG.9.1 transcript entirely within coding transcript NM_020357 diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.lncs.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.lncs.bed Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,13 @@ +chrM 3306 4262 STRG.45.1 100.0 + 3306 4262 255,0,0 1 956 0 +chr13 82264045 82265207 STRG.28.1 100.0 + 82264045 82265207 255,0,0 1 1162 0 +chr11 65265232 65273940 STRG.25.1 100.0 + 65265232 65273940 255,0,0 1 8708 0 +chrM 1670 3229 STRG.44.1 100.0 + 1670 3229 255,0,0 1 1559 0 +chrM 10058 10404 STRG.50.1 100.0 + 10058 10404 255,0,0 1 346 0 +chrM 8294 8364 STRG.48.2 100.0 + 8294 8364 255,0,0 1 70 0 +chrX 108297360 108297792 STRG.42.1 100.0 - 108297360 108297792 255,0,0 1 432 0 +chrM 12336 14148 STRG.51.1 100.0 + 12336 14148 255,0,0 1 1812 0 +chr2 26901086 26901378 STRG.8.1 100.0 - 26901086 26901378 255,0,0 1 292 0 +chrM 14148 14673 STRG.52.1 100.0 - 14148 14673 255,0,0 1 525 0 +chr1 569075 569756 STRG.5.1 100.0 + 569075 569756 255,0,0 1 681 0 +chr10 23425852 23426590 STRG.23.1 100.0 + 23425852 23426590 255,0,0 1 738 0 +chrM 9206 9990 STRG.49.1 100.0 + 9206 9990 255,0,0 1 784 0 diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.lncs.bed.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.lncs.bed.sorted Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,13 @@ +chr10 23425852 23426590 STRG.23.1 100.0 + 23425852 23426590 255,0,0 1 738 0 +chr11 65265232 65273940 STRG.25.1 100.0 + 65265232 65273940 255,0,0 1 8708 0 +chr13 82264045 82265207 STRG.28.1 100.0 + 82264045 82265207 255,0,0 1 1162 0 +chr1 569075 569756 STRG.5.1 100.0 + 569075 569756 255,0,0 1 681 0 +chr2 26901086 26901378 STRG.8.1 100.0 - 26901086 26901378 255,0,0 1 292 0 +chrM 10058 10404 STRG.50.1 100.0 + 10058 10404 255,0,0 1 346 0 +chrM 12336 14148 STRG.51.1 100.0 + 12336 14148 255,0,0 1 1812 0 +chrM 14148 14673 STRG.52.1 100.0 - 14148 14673 255,0,0 1 525 0 +chrM 1670 3229 STRG.44.1 100.0 + 1670 3229 255,0,0 1 1559 0 +chrM 3306 4262 STRG.45.1 100.0 + 3306 4262 255,0,0 1 956 0 +chrM 8294 8364 STRG.48.2 100.0 + 8294 8364 255,0,0 1 70 0 +chrM 9206 9990 STRG.49.1 100.0 + 9206 9990 255,0,0 1 784 0 +chrX 108297360 108297792 STRG.42.1 100.0 - 108297360 108297792 255,0,0 1 432 0 diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.lncs.info.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.lncs.info.txt Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,13 @@ +STRG.45.1 TVAS5 intergenic +STRG.28.1 Unannotated intergenic +STRG.25.1 MALAT1 intergenic +STRG.44.1 TVAS5 intergenic +STRG.50.1 AD intergenic +STRG.48.2 OK/SW-cl.16 intergenic +STRG.42.1 Unannotated intergenic +STRG.51.1 MTND5 intergenic +STRG.8.1 Unannotated intergenic +STRG.52.1 JA760615 intergenic +STRG.5.1 Unannotated intergenic +STRG.23.1 Unannotated intergenic +STRG.49.1 OK/SW-cl.16 intergenic diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.lncs.info.txt.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.lncs.info.txt.sorted Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,13 @@ +STRG.23.1 Unannotated intergenic +STRG.25.1 MALAT1 intergenic +STRG.28.1 Unannotated intergenic +STRG.42.1 Unannotated intergenic +STRG.44.1 TVAS5 intergenic +STRG.45.1 TVAS5 intergenic +STRG.48.2 OK/SW-cl.16 intergenic +STRG.49.1 OK/SW-cl.16 intergenic +STRG.50.1 AD intergenic +STRG.51.1 MTND5 intergenic +STRG.5.1 Unannotated intergenic +STRG.52.1 JA760615 intergenic +STRG.8.1 Unannotated intergenic diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.orfs.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.orfs.txt Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,3 @@ +lnc lncName ortholog orthologName alignScore lengthLncOrf lengthOrthOrf kN kS kN\kS lncOrf orthOrf +STRG.25.1 MALAT1 uc008gfj.2 Malat1 455430 90 90 0.04 0.02 2.286 ATGTTTCGTTTGCCTCAGACAGGTATCTCTTCGTTATCAGAAGAGTTGCTTCATTTCATCTGGGAGCAGAAAACAGCAGGCAGCTGTTAA ATGTTTCGTTTGCCTCAGACAGGTTTCTCTTCATAAGCAGAAGAGTTGCTTCATTCCATCTCGGAGCAGGAAACAGCAGACTGCTGTTGA +STRG.25.1 MALAT1 cast.naive_gene.v2.1_1455.0_chr19 Malat1 455430 90 90 0.04 0.02 2.286 ATGTTTCGTTTGCCTCAGACAGGTATCTCTTCGTTATCAGAAGAGTTGCTTCATTTCATCTGGGAGCAGAAAACAGCAGGCAGCTGTTAA ATGTTTCGTTTGCCTCAGACAGGTTTCTCTTCATAAGCAGAAGAGTTGCTTCATTCCATCTCGGAGCAGGAAACAGCAGACTGCTGTTGA diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.orthologs.top.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.orthologs.top.txt Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,9 @@ +#lnc lncGeneSymbol ortholog orthologGeneSymbol alignScore exonID locusID indelRate(exon) indelRate(intron) lncExonsAligned orthExonsAligned spliceConserved spliceTotal category(hg19) category(mm9) +STRG.25.1 MALAT1 uc008gfj.2 Malat1 455430 0.63 0.63 0.049 NA 1, 1, 0.0 0 intergenic intergenic +STRG.5.1 Unannotated uc009vfa.1 Atpase6 281595 0.00 0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.52.1 JA760615 uc012hdm.1 BC071253 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.48.2 OK/SW-cl.16 uc009vez.1 Cox2 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.44.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.49.1 OK/SW-cl.16 uc009vfa.1 Atpase6 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.45.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.51.1 MTND5 uc009vfc.1 Cytb 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.orthologs.top.txt.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.orthologs.top.txt.sorted Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,9 @@ +#lnc lncGeneSymbol ortholog orthologGeneSymbol alignScore exonID locusID indelRate(exon) indelRate(intron) lncExonsAligned orthExonsAligned spliceConserved spliceTotal category(hg19) category(mm9) +STRG.25.1 MALAT1 uc008gfj.2 Malat1 455430 0.63 0.63 0.049 NA 1, 1, 0.0 0 intergenic intergenic +STRG.44.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.45.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.48.2 OK/SW-cl.16 uc009vez.1 Cox2 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.49.1 OK/SW-cl.16 uc009vfa.1 Atpase6 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.51.1 MTND5 uc009vfc.1 Cytb 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.5.1 Unannotated uc009vfa.1 Atpase6 281595 0.00 0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.52.1 JA760615 uc012hdm.1 BC071253 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.orthologs.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.orthologs.txt Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,10 @@ +#lnc lncGeneSymbol ortholog orthologGeneSymbol alignScore exonID locusID indelRate(exon) indelRate(intron) lncExonsAligned orthExonsAligned spliceConserved spliceTotal category(hg19) category(mm9) +STRG.52.1 JA760615 uc012hdm.1 BC071253 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.51.1 MTND5 uc009vfc.1 Cytb 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.5.1 Unannotated uc009vfa.1 Atpase6 281595 0.00 0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.49.1 OK/SW-cl.16 uc009vfa.1 Atpase6 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.48.2 OK/SW-cl.16 uc009vez.1 Cox2 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.45.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.44.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.25.1 MALAT1 uc008gfj.2 Malat1 455430 0.63 0.63 0.049 NA 1, 1, 0.0 0 intergenic intergenic +STRG.25.1 MALAT1 cast.naive_gene.v2.1_1455.0_chr19 Malat1 455430 0.60 0.64 0.048 NA 1, 1,2, 0.0 0 intergenic intergenic diff -r 000000000000 -r a940c4a36a43 test-data/slncky/reads.simPE.orthologs.txt.sorted --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/slncky/reads.simPE.orthologs.txt.sorted Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,10 @@ +#lnc lncGeneSymbol ortholog orthologGeneSymbol alignScore exonID locusID indelRate(exon) indelRate(intron) lncExonsAligned orthExonsAligned spliceConserved spliceTotal category(hg19) category(mm9) +STRG.25.1 MALAT1 cast.naive_gene.v2.1_1455.0_chr19 Malat1 455430 0.60 0.64 0.048 NA 1, 1,2, 0.0 0 intergenic intergenic +STRG.25.1 MALAT1 uc008gfj.2 Malat1 455430 0.63 0.63 0.049 NA 1, 1, 0.0 0 intergenic intergenic +STRG.44.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.45.1 TVAS5 uc009vew.1 AK018753 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.48.2 OK/SW-cl.16 uc009vez.1 Cox2 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.49.1 OK/SW-cl.16 uc009vfa.1 Atpase6 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.51.1 MTND5 uc009vfc.1 Cytb 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.5.1 Unannotated uc009vfa.1 Atpase6 281595 0.00 0.00 NA NA NA NA 0.0 0 intergenic intergenic +STRG.52.1 JA760615 uc012hdm.1 BC071253 726896 0.00 -0.00 NA NA NA NA 0.0 0 intergenic intergenic diff -r 000000000000 -r a940c4a36a43 tool-data/ctat_lncrna_annotations.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/ctat_lncrna_annotations.loc.sample Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,15 @@ +# This file lists the locations of CTAT lncrna annotations +# Usually there will only be one index, but it is concievable +# that there could be multiple annotations. +# This file format is as follows +# (white space characters are TAB characters): +# +# +# value is a unique id +# name is the display name +# path is the directory where the index files are stored +# +#ctat_lncrna_annotations.loc could look like: +# +#slncky_annotations CTAT_lncrna_annotations /path/to/lncrna/annotations +# diff -r 000000000000 -r a940c4a36a43 tool_data_table_conf.xml.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Tue Jul 17 11:49:16 2018 -0400 @@ -0,0 +1,14 @@ + + + value, name, path + +
+ + value, name, path + +
+ + value, name, path + +
+