view alignment/phylocatenator.xml @ 0:5b9a38ec4a39 draft default tip

First commit of old repositories

<tool id="phylocatenator" name="Phylocatenator" version="1.0.1">
  <description>Produces concatenated sequence file from phytab file of aligned sequences</description>
    <command interpreter="perl">
	phylocatenator.pl $input1 $genes $species $mingene $species_file $models_file $out_file1 $partition_file $html_file > $phylocat_log
    </command>
  <inputs>
<!--    <display> $input1 with $genes and $species</display> -->
    <param name="input1" type="data" format="tabular" label="Table containing aligned genes"/>
    <param name="genes" type="integer" value="0" label="Genes" help="Minimum genes required per species. 0 retains all species. " />
    <param name="mingene" type="integer" value="35" label="Min" help="Minimum length of an aligned gene family to be included " />
    <param name="species" type="integer" value="4" label="Species" help="Minimum species per gene. 0 retains all genes." />
    <param name="species_file" type="data" format="txt" optional="true" label="Text list of species" help="Only species in the last can be retained in concatenated file" />
    <param name="models_file" type="data" format="tabular" optional="true" label="Table of: Models LUT" help="To partition data by model (protein, dna, binary, etc) according to a LUT (lookup table)" />
    <param name="outtype" type="select" label="Write as">
      <option value="R">RAxML_phylip</option>
    </param>
  </inputs>
  <outputs>
    <data format="txt" name="out_file1" metadata_source="input1" />
    <data format="txt" name="phylocat_log" label="${tool.name} on ${on_string}: Log File" />
    <data format="html" name="html_file" label="${tool.name} on ${on_string}: html Table" />
    <data format="txt" name="partition_file" label="${tool.name} on ${on_string}: Partition File" >
    </data>
  </outputs>
  <help>
**What it does**

This tool produces a concatenated data set for phylogenetics when not all genes are sampled for all species.

------

**Basic Example**

The input data must be in phytab column format.  Column 1 is species name, C2 is genefamily, C3 individual gene name, C4 is sequence. 
Sequences of each gene family must be aligned::

  species1	gene1	genenameA	acgttagcgcgctatagc
  species2	gene1	genenameB	acgttag--cgctataaa
  species3	gene1	genenameC	acgttagcgcgctatagc
  species4	gene1	genenameD	acgttagcgcgctatagc
  species1	gene2	genenameE	--gttagtttgcta
  species3	gene2	genenameF	gtgttagtttgcta

Two variables are $gene and $species.  These set thresholds for 
inclusion of data.  $species is the minimum number of species that 
contain a particular gene.  $gene sets a minimum number of gene families 
that a species must have to be included in the dataset.

Running phylocatenator on the above data with 0 for genes and 0 for species yields::

  4 32
  species1	acgttagcgcgctatagc--gttagtttgcta
  species2	acgttag--cgctataaa??????????????
  species3	acgttagcgcgctatagcgtgttagtttgcta
  species4	acgttagcgcgctatagc??????????????

**Optional Functionality**

I. You may enter a list of species.  
Species not in this list will not be written to the output file. 
For example, a species list of::

  species1
  species2


Would change the above output to::

  species1      acgttagcgcgctatagc--gttagtttgcta
  species2      acgttag--cgctataaa??????????????

II. Table of partition models

You may enter a table of models for each gene family/partition. Phylocatenator will then sort all the data to put all data 
for the same models together. It will then create the appropriate partition file, which will specify each model in raxml.
Currently, it is only possible to partiion data into valid raxml models.

The format is a tab-delimited file as follows::

  gene1	WAG
  gene2	JTT
  gene3	DNA
  gene4	WAG

Valid models include the following::

  BIN = binary morphological data
  MULTI = multistate morphological data
  DNA = DNA data
  WAG = one of several protein models listed in raxml help documents

III. Attribute

You may enter a table with an attribute/value for each gene family/partition. Phylocatenator will then select the data based 
on that value.

The format is a tab-delimited file as follows::

  gene1 3.1
  gene2 2.2
  gene3 0.9
  gene4 6.5

You can choose gene partitions based on the attribute value.  
For example, if the numbers above represent rate of evolution, you could 
choose to include 'slow' genes with a rate less than 2.5

------

**Additional Information**

http://osiris-phylogenetics.blogspot.com/2012/10/phylocatenator.html
Please direct questions or comments to [e-mail] or, if you can, enter them on the osiris_phylogenetics site at bitbucket.org

------

**Citation**

This tool is part of the Osiris Phylogenetics Tool Package for Galaxy. If you make extensive use of this tool in a publication, please consider citing the following.

Current Osiris Citation is here

http://osiris-phylogenetics.blogspot.com/2012/10/citation.html

First used in this paper

Oakley, Todd H, Joanna M Wolfe, Annie R Lindgren, and Alexander K Zaharoff. 2012. Phylotranscriptomics to Bring the Understudied into the Fold: Monophyletic Ostracoda, Fossil Placement, and Pancrustacean Phylogeny. lecular Biology and Evolution. doi:10.1093/molbev/mss216. 

</help>
</tool>