# HG changeset patch
# User urgi-team
# Date 1447162256 18000
# Node ID 3552a8d9f51ce73d9e04377de7bd45d6615f1ee8

Uploaded

diff -r 000000000000 -r 3552a8d9f51c VCFCarto_wrapper.py
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/VCFCarto_wrapper.py	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,107 @@
+#!/usr/bin/env python
+
+
+import subprocess, tempfile, sys, os, glob, shutil, time
+from optparse import OptionParser
+
+
+class VCFCartoWrapper(object):
+
+    def __init__(self):
+        self._options = None
+        
+        
+    def stop_err(self, msg ):
+        sys.stderr.write( "%s\n" % msg )
+        sys.exit()
+        
+        
+    def setAttributesFromCmdLine(self):
+        description = "VCFcarto can convert your tabulated file into a file with only the SNP from refA and refH.\n"
+        description += "2 formats are possible, either the input format is conserved, or the format is changed into a 3 letter format\n"
+        description += "(\"A\" for refA, \"H\" for refH and \"-\" when the base do not correspond to any parent)\n\n"
+        description += "example 1 : VCFcarto.py -f Storage.out -A G15 -H G23 -o FilteredStorage.out\n"
+        description += "example 2 : VCFcarto.py -f Storage.out -A ref1 -H ref2 -p -s -g -m -o cartoTable.out\n"
+        parser = OptionParser(description = description, version = "0.1") 
+        parser.add_option("-f", "--file",      dest = "tableName", action = "store", type = "string", help = "Input TSV File name [compulsory] [format: TSV]",                                                                                                    default = "")
+        parser.add_option("-o", "--output",    dest = "outFile",   action = "store", type = "string", help = "output TSV File name [compulsory] [format: TSV]",                                                                                                   default = "")
+        parser.add_option("-A", "--refA",      dest = "refA",      action = "store", type = "string", help = "name of the reference genome A [compulsory] ",                                                                                                      default = "")
+        parser.add_option("-H", "--refH",      dest = "refH",      action = "store", type = "string", help = "name of the reference genome H [compulsory] ",                                                                                                      default = "")
+        parser.add_option("-p", "--onlyParents",   dest = "onlyPar",   action = "store_true",         help = "Will change every letters by either A or H depending on which parents the strain correspond to for that base[optional] [default: False]",           default = False)
+        parser.add_option("-m", "--mergeMarkers",   dest = "mergeMarkers",   action = "store_true",   help = "Will merge sequential markers with the same information ; option -p is needed [optional] [default: False]",                                         default = False)
+        parser.add_option("-M", "--mergeFile", dest = "mergeFile", action = "store", type = "string", help = "name for the mergeFile ",                                                                                                                           default = "")
+        parser.add_option("-g", "--graphics",  dest = "graphs",    action = "store_true",             help = "create graphs. Only works with -p[optional] [default: False]",                                                                                      default = False)
+        parser.add_option("-G", "--graphHTML", dest = "graphHTML", action = "store", type = "string", help = "name of the HTML linking to graphs ",                                                                                                              default = "")
+        parser.add_option("-d", "--dirGraphs", dest = "dirGraphs", action = "store", type = "string", help = "name of the folder containing graphs ",                                                                                                              default = "")
+        options = parser.parse_args()[0]
+        self._setAttributesFromOptions(options)
+
+
+    def _setAttributesFromOptions(self, options):
+        self._options = options
+
+    def run(self):
+        prg = "VCFCarto.py"
+        args = ""
+        args += "-f %s" % self._options.tableName
+        args += " "
+        args += "-o %s" % self._options.outFile
+        args += " "
+        args += "-A %s" % self._options.refA
+        args += " "
+        args += "-H %s" % self._options.refH
+        args += " "
+        args += "-v 2 "
+        if self._options.onlyPar :
+            args += " "
+            args += "-p"
+            if self._options.mergeMarkers :
+                args += " "
+                args += "-m"
+            if self._options.graphs :
+                args += " "
+                args += "-g"
+        cmd = "%s %s" %(prg, args)
+        
+        print cmd
+        
+        try:
+            tmp_err = tempfile.NamedTemporaryFile().name
+            tmp_stderr = open( tmp_err, 'wb' )
+            proc = subprocess.Popen( args=cmd, shell=True, cwd=".", stderr=tmp_stderr )
+            returncode = proc.wait()
+            tmp_stderr.close()
+            # get stderr, allowing for case where it's very large
+            tmp_stderr = open( tmp_err, 'rb' )
+            stderr = ''
+            buffsize = 1048576
+            try:
+                while True:
+                    stderr += tmp_stderr.read( buffsize )
+                    if not stderr or len( stderr ) % buffsize != 0:
+                        break
+            except OverflowError:
+                pass
+            tmp_stderr.close()
+            if stderr:
+                raise Exception, stderr
+        except Exception, e:
+            self.stop_err( 'Error in VCFCarto:\n' + str( e ) ) 
+        
+        if self._options.mergeMarkers :
+            shutil.move("markerList.bed" ,self._options.mergeFile)
+        if self._options.graphs :
+            html = open(self._options.graphHTML, "w")
+            
+            os.mkdir(self._options.dirGraphs)
+            lGraphsFiles = glob.glob("VCFCarto_graphs/*")
+            for file in lGraphsFiles :
+                baseName = os.path.basename(file)
+                shutil.move( file ,"%s/%s" %(self._options.dirGraphs, baseName))
+                line = "<img src=\"%s\" > \n" %(baseName)
+                html.write(line)
+                
+if __name__ == "__main__":
+    iWrapper = VCFCartoWrapper()
+    iWrapper.setAttributesFromCmdLine()
+    iWrapper.run()    
diff -r 000000000000 -r 3552a8d9f51c VCFCarto_wrapper.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/VCFCarto_wrapper.xml	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,315 @@
+<tool id="VCFCarto" name="VCFCarto" version="0.01">
+    <description>VCFcarto can convert a tabulated marker file into a file with only the markers from 2 parents </description>
+    <requirements>
+        <requirement type="package" version="1.0">VCF_Gandalf_Tools</requirement>
+    </requirements>
+    <version_command>
+  VCFCarto.py --version
+    </version_command>
+    <command interpreter="python">
+    VCFCarto_wrapper.py -f $inputTabular -o $outputVCFCarto -A $parentA -H $parentH
+    #if str($outputType) == "carto"
+     -p -g --graphHTML $output_html --dirGraphs "$output_html.files_path"
+    #end if
+    #if str($outputType) == "MergedCarto"
+     -p -g --graphHTML $output_html --dirGraphs "$output_html.files_path" -m --mergeFile $output_bed
+    #end if
+    </command>
+    <inputs>
+        <param name="inputTabular" type="data" format="tabular" label="indicate your tabulated marker file"/>
+        <param name="parentA" size="20" type="text" value="V1" label="indicate parent 1 name (A)"/>
+        <param name="parentH" size="20" type="text" value="V2" label="indicate parent 2 name (H)"/>
+        <param name="outputType" type="select" display="radio" label="select type of output" multiple="False">
+            <option value="raw" >7 caracter code</option>
+            <option value="carto" >A - H code</option>
+            <option value="MergedCarto" >A - H code and merge</option>
+        </param>
+    </inputs>
+    <outputs>
+        <data format="tabular" name="outputVCFCarto" label="${tool.name} on ${on_string} (tabular)"/>
+        <data format="html" name="output_html" label="${tool.name} graphs on ${on_string} (html)">
+            <filter>not outputType == "raw"</filter>
+        </data>
+        <data format="bed" name="output_bed" label="${tool.name} markers on ${on_string} (bed)">
+            <filter>outputType == "MergedCarto"</filter>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="inputTabular" value="VCFCarto_input.tab"/>
+            <param name="parentA" value="REF1"/>
+            <param name="parentH" value="REF2"/>
+            <param name="outputType" value="raw"/>
+            <output name="outputVCFCarto" file="VCFCarto_output.tab" ftype="tabular"/>
+        </test>
+        <test>
+            <param name="inputTabular" value="VCFCarto_input.tab"/>
+            <param name="parentA" value="REF1"/>
+            <param name="parentH" value="REF2"/>
+            <param name="outputType" value="MergedCarto"/>
+            <output name="outputVCFCarto" file="VCFCarto_output_merged.tab" ftype="tabular"/>
+            <output name="output_bed" file="VCFCarto_output_merged.bed" ftype="bed"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+      
+**VCFcarto converts a tabulated marker file into a file with only the markers from 2 parents**
+
+.. class:: infomark
+
+expected input format is the output from VCFStorage.
+
+-----
+
+**what it does :**
+
+VCFcarto converts a tabulated marker file into a file with only the markers from 2 parents, refA and refH. 
+
+2 formats are possible, either the input format is conserved, or the format is changed into a 3 letter format
+
+-----
+
+**input format :**
+
+.. class:: infomark
+
+expected input format is the output from VCFStorage.
+
+the expected format is a tab delimited format file where all genomic positions are in rows, and all strains are in columns
+
+For each position and each genome, a code is attributed : 
+
+- for the reference : ::
+
+    A,T,G,C for the corresponding nucleotidic acid 
+
+- for the genomes : ::
+
+    U if the position was not refered in the VCF file 
+    R if the base is similar to the reference 
+    F if the base has been filtered out
+    A,T,G,C if the genome has a validated SNP at the position
+
+-----
+
+**output format :**
+
+for the main output, 2 formats are possible : 
+
+- The first format is similar to the input format (same columns and code) but will only be conserved lines where the 2 parents have different alleles. 
+
+- The second format (A - H format) will have a much simpler code ::
+
+    "A" when the strain allele is the same as parent A
+    "H" when the strain allele is the same as parent H
+    "-" in any other case (base filtered out, different base, base unmapped etc...)
+
+the second format may be used as an input for a cartographic tool. 
+
+If you decide to have the A - H format, you can also merge consecutive markers that carries the same information (every strains are similars between the two markers). If you decide to do so, new markers will be generated and a bed file will do the link between the input and the output markers.
+
+Finally, graphical output will be displayed to visualise the result. 
+
+-----
+
+**example :**
+
+input : ::
+
+	CHROM	POS	reference	REF1	G01	REF2	G02	G03	G04	G05	G06	G07	G08	G09	G10	G11	G12
+	Chr1	1	A	R	R	R	R	U	R	R	R	R	R	R	R	R	R
+	Chr1	2	T	R	R	R	R	R	U	R	R	R	R	R	R	R	R
+	Chr1	3	G	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+	Chr1	4	G	R	R	R	R	R	R	R	R	R	R	R	R	F	R
+	Chr1	5	G	R	R	R	R	R	R	U	F	R	R	R	R	R	R
+	Chr1	6	C	R	R	R	R	R	R	R	R	R	R	R	R	R	U
+	Chr1	7	A	G	C	C	C	F	C	C	C	C	C	G	C	G	G
+	Chr1	8	G	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+	Chr1	9	C	R	T	T	R	T	T	T	U	R	T	R	T	T	T
+	Chr1	10	T	R	R	R	R	R	R	R	R	R	R	R	R	R	U
+	Chr1	11	T	R	R	R	R	R	R	R	R	R	R	R	F	R	R
+	Chr1	12	A	R	R	R	R	U	R	R	R	R	F	R	R	R	R
+	Chr1	13	A	R	R	G	G	R	F	R	F	G	R	G	R	R	F
+	Chr1	14	A	R	R	R	R	R	R	R	R	F	R	R	R	R	R
+	Chr1	15	G	R	R	R	U	R	F	R	R	R	R	R	R	U	U
+	Chr1	16	G	A	R	R	A	R	R	U	F	R	R	A	A	R	A
+	Chr1	17	A	R	G	G	R	U	R	R	G	G	R	G	U	R	G
+	Chr1	18	C	R	R	R	R	R	U	R	R	R	R	R	R	R	R
+	Chr1	19	G	C	U	R	C	R	C	U	R	R	C	C	C	R	C
+	Chr1	20	G	A	U	R	A	R	A	U	R	R	A	A	A	R	A
+	Chr1	21	G	T	U	R	T	R	T	U	R	R	T	T	T	R	T
+	Chr1	22	A	T	U	R	T	R	T	U	R	R	T	T	T	R	T
+	Chr1	23	C	T	T	R	T	R	R	R	T	R	U	T	R	T	T
+	Chr1	24	T	R	R	R	R	R	U	R	R	R	R	R	R	R	F
+	Chr1	25	G	R	F	R	R	R	R	R	U	R	F	R	R	R	R
+	Chr1	26	T	R	R	C	C	C	C	C	R	R	C	R	C	R	U
+	Chr1	27	C	R	R	G	G	G	G	R	G	R	G	R	G	R	R
+	Chr1	28	C	G	T	T	T	G	G	T	T	F	T	G	T	T	G
+	Chr1	29	G	T	R	R	R	R	T	R	T	R	T	T	R	T	R
+	Chr1	30	T	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+	Chr1	31	A	R	R	R	R	F	R	R	R	R	F	R	R	R	R
+	Chr1	32	A	G	G	R	G	G	G	R	R	G	G	G	G	G	R
+	Chr1	33	G	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+	Chr1	34	C	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+	Chr1	35	C	R	R	R	R	R	F	R	R	R	R	R	R	R	U
+	Chr2	1	T	R	R	R	F	R	R	R	R	R	R	R	R	R	R
+	Chr2	2	A	C	R	R	C	C	U	R	R	R	R	C	C	C	U
+	Chr2	3	C	R	R	R	R	R	R	U	R	R	R	R	R	R	R
+	Chr2	4	C	R	R	R	R	R	R	R	U	R	R	R	R	F	R
+	Chr2	5	T	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+	Chr2	6	C	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+	Chr2	7	A	T	F	R	U	R	T	T	T	R	T	T	F	T	T
+	Chr2	8	T	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+	Chr2	9	C	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+	Chr2	10	G	R	T	T	T	T	R	T	R	R	R	R	R	U	R
+	Chr2	11	C	R	A	A	A	A	R	A	R	R	R	R	R	U	R
+	Chr2	12	A	R	T	T	T	T	R	T	R	R	R	R	R	U	R
+	Chr2	13	T	R	C	C	C	C	R	C	R	R	R	R	R	U	R
+	Chr2	14	C	T	A	A	T	A	T	A	T	A	T	T	A	A	A
+	Chr2	15	T	R	R	R	F	R	R	R	R	R	R	R	R	R	R
+	Chr2	16	A	R	R	R	R	R	R	R	U	R	R	R	R	R	R
+	Chr2	17	A	R	U	R	R	R	R	R	R	R	R	R	R	R	F
+	Chr2	18	G	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+	Chr2	19	A	R	R	R	R	R	R	F	R	R	R	R	R	R	R
+	Chr2	20	C	R	R	R	R	R	R	R	F	R	R	R	R	R	R
+	Chr2	21	G	A	R	R	A	A	A	R	R	R	A	A	R	R	R
+	Chr2	22	A	R	R	R	R	R	R	F	R	R	R	R	R	R	R
+	Chr2	23	A	R	R	T	T	R	R	T	T	T	T	T	R	R	R
+	Chr2	24	T	R	R	R	R	R	R	U	R	R	R	R	R	R	F
+	Chr2	25	T	R	A	A	R	R	A	R	A	R	R	A	R	R	A
+	Chr2	26	G	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+	Chr2	27	A	R	R	R	R	R	R	R	R	R	R	R	R	U	R
+	Chr2	28	C	R	U	R	R	F	F	R	R	F	R	F	U	R	R
+	Chr2	29	G	R	R	R	R	R	R	F	R	R	R	R	R	R	R
+	Chr2	30	T	A	A	G	A	G	G	A	A	G	F	G	G	G	U
+	Chr2	31	A	R	R	R	R	R	R	R	R	U	U	R	R	R	R
+	Chr2	32	G	R	R	R	R	R	R	U	U	R	R	R	R	R	R
+	Chr2	33	G	R	U	R	R	R	R	U	R	R	R	R	R	R	R
+	Chr2	34	A	R	R	R	U	R	R	R	R	R	R	R	R	R	R
+	Chr2	35	G	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+	Chr2	36	T	R	R	R	R	R	R	U	R	R	R	R	R	R	R
+	Chr3	1	T	U	R	R	R	R	R	U	R	R	R	R	R	R	R
+	Chr3	2	T	R	R	U	R	R	R	U	R	R	R	R	R	R	R
+	Chr3	3	T	F	R	R	R	R	R	U	R	R	R	R	R	R	R
+	Chr3	4	T	R	R	F	R	R	R	U	R	R	R	R	R	R	R
+
+
+output :
+
+- without A - H code : ::
+
+	CHROM	POS	reference	REF1	G01	REF2	G02	G03	G04	G05	G06	G07	G08	G09	G10	G11	G12
+	Chr1	7	A	G	C	C	C	F	C	C	C	C	C	G	C	G	G
+	Chr1	9	C	R	T	T	R	T	T	T	U	R	T	R	T	T	T
+	Chr1	13	A	R	R	G	G	R	F	R	F	G	R	G	R	R	F
+	Chr1	16	G	A	R	R	A	R	R	U	F	R	R	A	A	R	A
+	Chr1	17	A	R	G	G	R	U	R	R	G	G	R	G	U	R	G
+	Chr1	19	G	C	U	R	C	R	C	U	R	R	C	C	C	R	C
+	Chr1	20	G	A	U	R	A	R	A	U	R	R	A	A	A	R	A
+	Chr1	21	G	T	U	R	T	R	T	U	R	R	T	T	T	R	T
+	Chr1	22	A	T	U	R	T	R	T	U	R	R	T	T	T	R	T
+	Chr1	23	C	T	T	R	T	R	R	R	T	R	U	T	R	T	T
+	Chr1	26	T	R	R	C	C	C	C	C	R	R	C	R	C	R	U
+	Chr1	27	C	R	R	G	G	G	G	R	G	R	G	R	G	R	R
+	Chr1	28	C	G	T	T	T	G	G	T	T	F	T	G	T	T	G
+	Chr1	29	G	T	R	R	R	R	T	R	T	R	T	T	R	T	R
+	Chr1	32	A	G	G	R	G	G	G	R	R	G	G	G	G	G	R
+	Chr2	2	A	C	R	R	C	C	U	R	R	R	R	C	C	C	U
+	Chr2	7	A	T	F	R	U	R	T	T	T	R	T	T	F	T	T
+	Chr2	10	G	R	T	T	T	T	R	T	R	R	R	R	R	U	R
+	Chr2	11	C	R	A	A	A	A	R	A	R	R	R	R	R	U	R
+	Chr2	12	A	R	T	T	T	T	R	T	R	R	R	R	R	U	R
+	Chr2	13	T	R	C	C	C	C	R	C	R	R	R	R	R	U	R
+	Chr2	14	C	T	A	A	T	A	T	A	T	A	T	T	A	A	A
+	Chr2	21	G	A	R	R	A	A	A	R	R	R	A	A	R	R	R
+	Chr2	23	A	R	R	T	T	R	R	T	T	T	T	T	R	R	R
+	Chr2	25	T	R	A	A	R	R	A	R	A	R	R	A	R	R	A
+	Chr2	30	T	A	A	G	A	G	G	A	A	G	F	G	G	G	U
+
+- with A - H code but no markers : ::
+
+	CHROM	POS	reference	REF1	G01	REF2	G02	G03	G04	G05	G06	G07	G08	G09	G10	G11	G12
+	Chr1	7	-	A	H	H	H	-	H	H	H	H	H	A	H	A	A
+	Chr1	9	-	A	H	H	A	H	H	H	-	A	H	A	H	H	H
+	Chr1	13	-	A	A	H	H	A	-	A	-	H	A	H	A	A	-
+	Chr1	16	-	A	H	H	A	H	H	-	-	H	H	A	A	H	A
+	Chr1	17	-	A	H	H	A	-	A	A	H	H	A	H	-	A	H
+	Chr1	19	-	A	-	H	A	H	A	-	H	H	A	A	A	H	A
+	Chr1	20	-	A	-	H	A	H	A	-	H	H	A	A	A	H	A
+	Chr1	21	-	A	-	H	A	H	A	-	H	H	A	A	A	H	A
+	Chr1	22	-	A	-	H	A	H	A	-	H	H	A	A	A	H	A
+	Chr1	23	-	A	A	H	A	H	H	H	A	H	-	A	H	A	A
+	Chr1	26	-	A	A	H	H	H	H	H	A	A	H	A	H	A	-
+	Chr1	27	-	A	A	H	H	H	H	A	H	A	H	A	H	A	A
+	Chr1	28	-	A	H	H	H	A	A	H	H	-	H	A	H	H	A
+	Chr1	29	-	A	H	H	H	H	A	H	A	H	A	A	H	A	H
+	Chr1	32	-	A	A	H	A	A	A	H	H	A	A	A	A	A	H
+	Chr2	2	-	A	H	H	A	A	-	H	H	H	H	A	A	A	-
+	Chr2	7	-	A	-	H	-	H	A	A	A	H	A	A	-	A	A
+	Chr2	10	-	A	H	H	H	H	A	H	A	A	A	A	A	-	A
+	Chr2	11	-	A	H	H	H	H	A	H	A	A	A	A	A	-	A
+	Chr2	12	-	A	H	H	H	H	A	H	A	A	A	A	A	-	A
+	Chr2	13	-	A	H	H	H	H	A	H	A	A	A	A	A	-	A
+	Chr2	14	-	A	H	H	A	H	A	H	A	H	A	A	H	H	H
+	Chr2	21	-	A	H	H	A	A	A	H	H	H	A	A	H	H	H
+	Chr2	23	-	A	A	H	H	A	A	H	H	H	H	H	A	A	A
+	Chr2	25	-	A	H	H	A	A	H	A	H	A	A	H	A	A	H
+	Chr2	30	-	A	A	H	A	H	H	A	A	H	-	H	H	H	-
+
+- with A - H code and merge  : 
+ 
+ - tab file : ::
+ 
+	CHROM	POS	reference	REF1	G01	REF2	G02	G03	G04	G05	G06	G07	G08	G09	G10	G11	G12
+	Chr1	*M_00001	-	A	H	H	H	-	H	H	H	H	H	A	H	A	A
+	Chr1	*M_00002	-	A	H	H	A	H	H	H	-	A	H	A	H	H	H
+	Chr1	*M_00003	-	A	A	H	H	A	-	A	-	H	A	H	A	A	-
+	Chr1	*M_00004	-	A	H	H	A	H	H	-	-	H	H	A	A	H	A
+	Chr1	*M_00005	-	A	H	H	A	-	A	A	H	H	A	H	-	A	H
+	Chr1	*M_00006	-	A	-	H	A	H	A	-	H	H	A	A	A	H	A
+	Chr1	*M_00007	-	A	A	H	A	H	H	H	A	H	-	A	H	A	A
+	Chr1	*M_00008	-	A	A	H	H	H	H	H	A	A	H	A	H	A	-
+	Chr1	*M_00009	-	A	A	H	H	H	H	A	H	A	H	A	H	A	A
+	Chr1	*M_00010	-	A	H	H	H	A	A	H	H	-	H	A	H	H	A
+	Chr1	*M_00011	-	A	H	H	H	H	A	H	A	H	A	A	H	A	H
+	Chr1	*M_00012	-	A	A	H	A	A	A	H	H	A	A	A	A	A	H
+	Chr2	*M_00013	-	A	H	H	A	A	-	H	H	H	H	A	A	A	-
+	Chr2	*M_00014	-	A	-	H	-	H	A	A	A	H	A	A	-	A	A
+	Chr2	*M_00015	-	A	H	H	H	H	A	H	A	A	A	A	A	-	A
+	Chr2	*M_00016	-	A	H	H	A	H	A	H	A	H	A	A	H	H	H
+	Chr2	*M_00017	-	A	H	H	A	A	A	H	H	H	A	A	H	H	H
+	Chr2	*M_00018	-	A	A	H	H	A	A	H	H	H	H	H	A	A	A
+	Chr2	*M_00019	-	A	H	H	A	A	H	A	H	A	A	H	A	A	H
+	Chr2	*M_00020	-	A	A	H	A	H	H	A	A	H	-	H	H	H	-
+
+ - bed file : :: 
+    
+	Chr1	7	7	*M_00001
+	Chr1	9	9	*M_00002
+	Chr1	13	13	*M_00003
+	Chr1	16	16	*M_00004
+	Chr1	17	17	*M_00005
+	Chr1	19	22	*M_00006
+	Chr1	23	23	*M_00007
+	Chr1	26	26	*M_00008
+	Chr1	27	27	*M_00009
+	Chr1	28	28	*M_00010
+	Chr1	29	29	*M_00011
+	Chr1	32	32	*M_00012
+	Chr2	2	2	*M_00013
+	Chr2	7	7	*M_00014
+	Chr2	10	13	*M_00015
+	Chr2	14	14	*M_00016
+	Chr2	21	21	*M_00017
+	Chr2	23	23	*M_00018
+	Chr2	25	25	*M_00019
+	Chr2	30	30	*M_00020
+
+
+-----
+
+**reference :**
+
+]]>
+    </help>
+</tool>
diff -r 000000000000 -r 3552a8d9f51c VCFFiltering_wrapper.py
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/VCFFiltering_wrapper.py	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,110 @@
+#!/usr/bin/env python
+
+
+import subprocess, tempfile, sys, os, glob, shutil, time
+from optparse import OptionParser
+from optparse import Option, OptionValueError
+			
+class VCFFilteringWrapper(object):
+
+	def __init__(self):
+		self._options = None
+		
+		
+	def stop_err(self, msg ):
+		sys.stderr.write( "%s\n" % msg )
+		sys.exit()
+		
+		
+	def setAttributesFromCmdLine(self):
+		description = "VCFFiltering_wrapper"
+		description += "\nWrapper for VCFFiltering ;\n VCFFiltering filters SNP on a VCF depending on depth (DP) allele number (AN), allele frequency (AF) and SNP quality.\n"
+		description += "example 1 : VCFFiltering.py -f myVCF.vcf -o FilteredVCF.vcf\n"
+		description += "example 2 : VCFFiltering.py -f myVCF.vcf -N 2 -F 0.87 -b bed1.bed bed2.bed -o FilteredVCF.vcf\n"
+		parser = OptionParser(description = description, version = "0.1")
+		parser.add_option("-f", "--vcf",	   dest = "VCFFile",   action = "store", type = "string", help = "Input VCF File name [compulsory] [format: VCF]",                                           default = "")
+		parser.add_option("-o", "--output",	dest = "outFile",   action = "store", type = "string", help = "output VCF File name [compulsory] [format: VCF]",                                             default = "")
+		parser.add_option("-m", "--minDP",	 dest = "minDP",	 action = "store", type = "int",	help = "minimum of depth ; if both minDP and maxDP are set, optimal DP will not be calculated ",     default = 0)
+		parser.add_option("-M", "--maxDP",	 dest = "maxDP",	 action = "store", type = "int",	help = "maximum of depth ; if both minDP and maxDP are set, optimal DP will not be calculated ",     default = 0)
+		parser.add_option("-N", "--AN",		dest = "AN",		action = "store", type = "int",	help = "maximum number of allele for a SNP; default = 2",                                                default = 2)
+		parser.add_option("-F", "--AF",		dest = "AF",		action = "store", type = "float",  help = "minimum frequency for the alternative allele of a SNP; default = 0.9",                        default = 0.9)
+		parser.add_option("-b", "--bed",	   dest = "bedFiles",  action = "append", type = "string", help = "bed files: list of coordinates to filter, multiple arguments allowed '-b file1 file2' ",  default = [])
+		parser.add_option("-G", "--graphHTML", dest = "graphHTML", action = "store", type = "string", help = "name of the HTML linking to graphs ",                                                      default = "")
+		parser.add_option("-d", "--dirGraphs", dest = "dirGraphs", action = "store", type = "string", help = "name of the folder containing graphs ",                                                    default = "")
+		options = parser.parse_args()[0]
+		self._setAttributesFromOptions(options)
+
+
+	def _setAttributesFromOptions(self, options):
+		self._options = options
+
+	def run(self):
+		if self._options.minDP and self._options.maxDP :
+			if self._options.minDP > self._options.maxDP :
+				self.stop_err( 'error in options : minDP > max DP (%s > %s)' %(self._options.minDP,self._options.maxDP)) 
+					
+		prg = "VCFFiltering.py -g -G 'png' "
+		args = ""
+		args += "-f %s" % self._options.VCFFile
+		args += " "
+		args += "-o %s" % self._options.outFile
+		if self._options.AF :
+			args += " "
+			args += "-F %s" % self._options.AF
+		if self._options.AN :
+			args += " "
+			args += "-N %s" % self._options.AN
+		if self._options.minDP :
+			args += " "
+			args += "-m %s" % self._options.minDP
+		if self._options.maxDP :
+			args += " "
+			args += "-M %s" % self._options.maxDP
+		if self._options.bedFiles :
+			if self._options.bedFiles == "":
+				pass
+			else :
+				self._lBedFiles = self._options.bedFiles
+		cmd = "%s %s" %(prg, args)
+		
+		print cmd
+		
+		try:
+			tmp_err = tempfile.NamedTemporaryFile().name
+			tmp_stderr = open( tmp_err, 'wb' )
+			proc = subprocess.Popen( args=cmd, shell=True, cwd=".", stderr=tmp_stderr )
+			returncode = proc.wait()
+			tmp_stderr.close()
+			# get stderr, allowing for case where it's very large
+			tmp_stderr = open( tmp_err, 'rb' )
+			stderr = ''
+			buffsize = 1048576
+			try:
+				while True:
+					stderr += tmp_stderr.read( buffsize )
+					if not stderr or len( stderr ) % buffsize != 0:
+						break
+			except OverflowError:
+				pass
+			tmp_stderr.close()
+			if stderr:
+				raise Exception, stderr
+		except Exception, e:
+			self.stop_err( 'Error in VCFFiltering:\n' + str( e ) ) 
+			
+		if True :
+			html = open(self._options.graphHTML, "w")
+			
+			os.mkdir(self._options.dirGraphs)
+			lGraphsFiles = glob.glob("VCFFiltering_graphs/*")
+			for file in lGraphsFiles :
+				baseName = os.path.basename(file)
+				shutil.move( file ,"%s/%s" %(self._options.dirGraphs, baseName))
+				line = "<img src=\"%s\" > \n" %(baseName)
+				html.write(line)
+
+
+if __name__ == "__main__":
+	iWrapper = VCFFilteringWrapper()
+	iWrapper.setAttributesFromCmdLine()
+	iWrapper.run()	
diff -r 000000000000 -r 3552a8d9f51c VCFFiltering_wrapper.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/VCFFiltering_wrapper.xml	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,157 @@
+<tool id="VCFFiltering" name="VCFFiltering" version="0.01">
+    <description>Filters SNP on a VCF depending on depth, allele number and allele frequency</description>
+    <requirements>
+        <requirement type="package" version="1.0">VCF_Gandalf_Tools</requirement>
+    </requirements>
+    <version_command>
+  VCFFiltering.py --version
+    </version_command>
+    <command interpreter="python">
+	#if $DP_auto.is_DP_auto
+    VCFFiltering_wrapper.py -f $inputVCF -o $outputVCF -F $AF -N $AN
+    #else
+    VCFFiltering_wrapper.py -f $inputVCF -o $outputVCF -F $AF -N $AN -m $DP_auto.DPmin -M $DP_auto.DPmax
+	#end if
+	## Bed files
+	#if $BedFile_List.is_BedFile
+	#for $bed in $BedFile_List.BedFiles
+	 -b $bed.inputBed
+	#end for
+	#end if
+	--graphHTML $output_html --dirGraphs "$output_html.files_path"
+	
+    </command>
+    <inputs>
+        <param name="inputVCF" type="data" format="vcf" label="Input VCF File name (from FreeBayes)"/>
+        <conditional name="DP_auto">
+            <param name="is_DP_auto" type="boolean" label="Calculate optimal depth range automatically" truevalue="yes" falsevalue="no" checked="on" />
+            <when value="yes"/>
+            <when value="no">
+                <param name="DPmin" type="integer" label="minumum Depth" value="1" help="default = 1">
+                    <validator type="in_range" min="0" message="DP can't be negative" />
+                </param>
+                <param name="DPmax" type="integer" label="maximum Depth" value="200" help="default = 200">
+                    <validator type="in_range" min="0" message="DP can't be negative"  />
+                </param>
+            </when>
+        </conditional>
+        <param name="AF" type="float" value="0.9" label="minimum allele frequency" help="default = 0.9">
+            <validator type="in_range" min="0.0" max="1.0"/>
+        </param>
+        <param name="AN" type="integer" value="2" label="maximum allele number" help="default = 2">
+            <validator type="in_range" min="1" message="Allele number can't be negative" />
+        </param>
+        <conditional name="BedFile_List">
+            <param name="is_BedFile" type="boolean" label="bed files : list of coordinates to filter, multiple beds allowed" truevalue="yes" falsevalue="no" checked="off" />
+            <when value="no"/>
+            <when value="yes">
+                <repeat name="BedFiles" title="bed files : list of coordinates to filter, multiple beds allowed" min="1">
+                    <param name="inputBed" type="data" format="bed" label="Select Bed file "/>
+                </repeat>
+            </when>
+        </conditional>
+    </inputs>
+    <outputs>
+        <data format="vcf" name="outputVCF" label="${tool.name} on ${on_string} (vcf)"/>
+        <data format="html" name="output_html" label="${tool.name} graphs on ${on_string} (html)">
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="is_DP_auto" value="yes" />
+            <param name="AF" value="0.9"/>
+            <param name="AN" value="2"/>
+            <param name="inputVCF" ftype="vcf" value="VCFFiltering_input.vcf" />
+            <output name="outputVCF" file="VCFFiltering_DPauto_output.vcf"/>
+        </test>
+        <test>
+            <param name="is_DP_auto" value="no" />
+            <param name="DPmin" value="4"/>
+            <param name="DPmax" value="200"/>
+            <param name="AF" value="0.9"/>
+            <param name="AN" value="2"/>
+            <param name="inputVCF" ftype="vcf" value="VCFFiltering_input.vcf" />
+            <output name="outputVCF" file="VCFFiltering_DP_4_200_output.vcf"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+**Filters SNP on a VCF depending on depth, allele number and allele frequency**
+
+-----
+
+**what it does :**
+
+VCFFiltering is a python script that allows to filter SNP results from freebayes on multiple criterias as once. The filters are : 
+
+ - Allele number : number of possible allele at the genomic position
+ - Allele frequency : frenquency of the most represented allele ; note that if the most represented allele is the reference (a "." in the 4th column of the VCF, the allele frequency will still work but allele frequency should be under 1-x)
+ - Depth : Higher and lower bound of the depth ; the depth is the number of reads mapped on the genomic positions.
+
+Depth can be automatically detected. If you do so, The 90 % of the positions with a depth closest to the most frequent depth will pass the filter. 
+	
+This script has been developped to be used with freebayes output, on haploïd data. 
+
+
+.. class:: infomark
+
+the VCF source is detected from the header. Please keep the header of your VCF file if you want to use this tool
+
+-----
+
+**input and output formats :**
+
+input format is a VCF file obtaines with freebayes ; headers are necessary
+you can also add some bed files to filter some specific regions.
+
+output format is a filtered VCF file.
+
+-----
+
+**example :**
+
+
+VCF input file: ::
+
+    ##fileformat=VCFv4.1
+    ##fileDate=20150126
+    ##source=freeBayes v0.9.13-2-ga830efd
+    ##reference=ref.fsa
+    ##phasing=none
+    ##commandline="freebayes --report-monomorphic --ploidy 2 -X -u -f ref.fsa strain_1.bam"
+    #CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	strain_1
+    chrom1	1	.	T	.	.	.	DP=4;DPB=1;EPPR=5.18177;GTI=0;MQMR=36;NS=1;NUMALT=0;ODDS=0;PAIREDR=1;PQR=0;PRO=0;QR=38;RO=4;RPPR=5.18177	GT:DP:RO:QR:AO:QA:GL	0/0:4:4:38:.:.:0
+    chrom1	2	.	A	.	.	.	DP=12;DPB=1;EPPR=5.18177;GTI=0;MQMR=36;NS=1;NUMALT=0;ODDS=0;PAIREDR=1;PQR=0;PRO=0;QR=38;RO=11;RPPR=5.18177	GT:DP:RO:QR:AO:QA:GL	0/0:12:11:38:.:.:0
+    chrom1	3	.	T	A	.	.	DP=5;DPB=1;EPPR=5.18177;GTI=0;MQMR=36;NS=1;NUMALT=0;ODDS=0;PAIREDR=1;PQR=0;PRO=0;QR=38;AO=5;RPPR=5.18177	GT:DP:RO:QR:AO:QA:GL	0/0:5:0:38:5:.:0
+    chrom1	4	.	G	T	.	.	DP=6;DPB=1;EPPR=5.18177;GTI=0;MQMR=36;NS=1;NUMALT=0;ODDS=0;PAIREDR=1;PQR=0;PRO=0;QR=38;AO=5;RPPR=5.18177	GT:DP:RO:QR:AO:QA:GL	0/0:6:1:38:5:.:0
+    chrom1	5	.	C	C	.	.	DP=12;DPB=1;EPPR=5.18177;GTI=0;MQMR=36;NS=1;NUMALT=0;ODDS=0;PAIREDR=1;PQR=0;PRO=0;QR=38;AO=11;RPPR=5.18177	GT:DP:RO:QR:AO:QA:GL	0/0:12:1:38:11:.:0
+
+purposed options: ::
+
+ - Calculate optimal depth range automatically = no
+ - minumum Depth = 5
+ - maximum Depth = 14
+ - minimum allele frequency = 0.9
+ - maximum allele number = 2
+
+exemple result : ::
+
+    ##fileformat=VCFv4.1
+    ##fileDate=20150126
+    ##source=freeBayes v0.9.13-2-ga830efd
+    ##reference=ref.fsa
+    ##phasing=none
+    ##commandline="freebayes --report-monomorphic --ploidy 2 -X -u -f ref.fsa strain_1.bam"
+    #CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	strain_1
+    chrom1	1	.	T	.	.	G_DP	DP=4;DPB=1;EPPR=5.18177;GTI=0;MQMR=36;NS=1;NUMALT=0;ODDS=0;PAIREDR=1;PQR=0;PRO=0;QR=38;RO=4;RPPR=5.18177;G_AN=0;G_AF=0.00;G_DP=4;G_Base=T	GT:DP:RO:QR:AO:QA:GL	0/0:4:4:38:.:.:0
+    chrom1	2	.	A	.	.	.	DP=12;DPB=1;EPPR=5.18177;GTI=0;MQMR=36;NS=1;NUMALT=0;ODDS=0;PAIREDR=1;PQR=0;PRO=0;QR=38;RO=11;RPPR=5.18177;G_AN=0;G_AF=0.08;G_DP=12;G_Base=A	GT:DP:RO:QR:AO:QA:GL	0/0:12:11:38:.:.:0
+    chrom1	3	.	T	A	.	.	DP=5;DPB=1;EPPR=5.18177;GTI=0;MQMR=36;NS=1;NUMALT=0;ODDS=0;PAIREDR=1;PQR=0;PRO=0;QR=38;AO=5;RPPR=5.18177;G_AN=0;G_AF=1.00;G_DP=5;G_Base=A	GT:DP:RO:QR:AO:QA:GL	0/0:5:0:38:5:.:0
+    chrom1	4	.	G	T	.	G_AF	DP=6;DPB=1;EPPR=5.18177;GTI=0;MQMR=36;NS=1;NUMALT=0;ODDS=0;PAIREDR=1;PQR=0;PRO=0;QR=38;AO=5;RPPR=5.18177;G_AN=0;G_AF=0.83;G_DP=6;G_Base=T	GT:DP:RO:QR:AO:QA:GL	0/0:6:1:38:5:.:0
+    chrom1	5	.	C	C	.	.	DP=12;DPB=1;EPPR=5.18177;GTI=0;MQMR=36;NS=1;NUMALT=0;ODDS=0;PAIREDR=1;PQR=0;PRO=0;QR=38;AO=11;RPPR=5.18177;G_AN=0;G_AF=0.92;G_DP=12;G_Base=C	GT:DP:RO:QR:AO:QA:GL	0/0:12:1:38:11:.:0
+
+-----
+
+**reference :**
+
+]]>
+    </help>
+</tool>
diff -r 000000000000 -r 3552a8d9f51c VCFStorage_wrapper.py
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/VCFStorage_wrapper.py	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,96 @@
+#!/usr/bin/env python
+
+
+import subprocess, tempfile, sys, os, glob, shutil, time, random
+from optparse import OptionParser
+from optparse import Option, OptionValueError
+
+class VCFStorageWrapper(object):
+
+	def __init__(self):
+		self._options = None
+		
+		
+	def stop_err(self, msg ):
+		sys.stderr.write( "%s\n" % msg )
+		sys.exit()
+		
+		
+	def setAttributesFromCmdLine(self):
+		description = "VCFStorage_wrapper"
+		description += "\nWrapper for VCFStorage\n VCFStorage "
+		description += "VCFStorage stores info from variant calling into a table. It will create a tabulate file with the different infos\n"
+		description += "example : VCFStorage -f fasta.fa -l genomelist.list -w workdir -o output.tab \n"
+		parser = OptionParser(description = description, version = "0.1")
+		parser.add_option("-f", "--fasta",            dest = "fastaFile",      action = "store",     type = "string", help = "Input fasta file name [compulsory] [format: Fasta]",                default = "")
+		parser.add_option("-l", "--genomeNameList",   dest = "genomeNameList", action = "append",    type = "string", help = "Input list of genome name ")
+		parser.add_option("-L", "--genomeFileList",   dest = "genomeFileList", action = "append",    type = "string", help = "Input list of genome VCF file ")
+		parser.add_option("-w", "--workDir",          dest = "workDir",        action = "store",     type = "string", help = "name of the workingDirectory",                                      default = "")
+		parser.add_option("-o", "--out",              dest = "outFile",        action = "store",     type = "string", help = "Output file name [compulsory] [format: tab]",                       default = "")
+		options = parser.parse_args()[0]
+		self._setAttributesFromOptions(options)
+
+
+	def _setAttributesFromOptions(self, options):
+		self._options = options
+
+	def run(self):
+		self.createGenomeList()
+		cmd = self.createCmdLine()
+		self.launchCmdLine(cmd)
+		
+	def createGenomeList(self):
+		self.genomelistFile = "%s.genomeListFile" % self._options.outFile
+		lGenomeName = self._options.genomeNameList
+		lGenomeVCF = self._options.genomeFileList
+		output = open(self.genomelistFile, "w")
+		for i,genomeName in enumerate(lGenomeName) :
+			output.write("%s\t%s\n" % (lGenomeName[i],lGenomeVCF[i]))
+		output.close()
+		
+	def createCmdLine(self):
+		workdir = "VCFStorage_%s_%d" % (time.strftime("%d%H%M%S"), random.randint(0, 10000))
+		prg = "VCFStorage.py"
+		args = ""
+		args += "-f %s" % self._options.fastaFile
+		args += " "
+		args += "-o %s" % self._options.outFile
+		args += " "
+		args += "-l %s" % self.genomelistFile
+		args += " "
+		args += "-w %s" % workdir
+		cmd = "%s %s" %(prg, args)
+		
+		print cmd
+		return cmd
+		
+	def launchCmdLine(self, cmd):
+		try:
+			tmp_err = tempfile.NamedTemporaryFile().name
+			tmp_stderr = open( tmp_err, 'wb' )
+			proc = subprocess.Popen( args=cmd, shell=True, cwd=".", stderr=tmp_stderr )
+			returncode = proc.wait()
+			tmp_stderr.close()
+			# get stderr, allowing for case where it's very large
+			tmp_stderr = open( tmp_err, 'rb' )
+			stderr = ''
+			buffsize = 1048576
+			try:
+				while True:
+					stderr += tmp_stderr.read( buffsize )
+					if not stderr or len( stderr ) % buffsize != 0:
+						break
+			except OverflowError:
+				pass
+			tmp_stderr.close()
+			if stderr:
+				raise Exception, stderr
+		except Exception, e:
+			os.remove(self.genomelistFile)
+			self.stop_err( 'Error in VCFStorage:\n' + str( e ) ) 
+		os.remove(self.genomelistFile)
+
+if __name__ == "__main__":
+	iWrapper = VCFStorageWrapper()
+	iWrapper.setAttributesFromCmdLine()
+	iWrapper.run()	
diff -r 000000000000 -r 3552a8d9f51c VCFStorage_wrapper.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/VCFStorage_wrapper.xml	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,236 @@
+<tool id="VCFStorage" name="VCFStorage" version="0.01">
+  <description> stores info from variant calling into a table. It will create a tabulate filed with SNP infos</description>
+  <requirements>
+    <requirement type="package" version="1.0">VCF_Gandalf_Tools</requirement>
+  </requirements>
+  <version_command>
+  VCFStorage.py --version
+  </version_command>
+  <command interpreter="python">
+    VCFStorage_wrapper.py -f $inputFasta -o $outputVCFStorage 
+    ## genome list
+    #for $VCF in $VCFFile
+     -l $VCF.strainName
+     -L $VCF.inputStrainVCF
+    #end for
+  </command>
+  <inputs>
+    <param name="inputFasta" type="data" format="fasta" label="Input genome sequence file name (fasta)"/>
+    <repeat name="VCFFile" title="VCF list" min="1">
+        <param name="strainName" size="20" type="text" value="V1" label="strain name (no space allowed)"/>
+        <param name="inputStrainVCF" type="data" format="vcf" label="Select VCF file "/>
+    </repeat>
+  </inputs>
+  <outputs>
+    <data format="tabular" name="outputVCFStorage" label="${tool.name} on ${on_string} (tabular)"/>
+  </outputs>
+  <tests>
+    <test>
+        <param name="inputFasta" ftype="fasta" value="chr17.fa" />
+        <param name="strainName" value="V1"/>
+        <param name="inputStrainVCF" ftype="vcf" value="chr17.VCF"/>
+        <output name="outputVCFStorage" ftype="tabular" file="Expchr17.tab"/>
+    </test>
+  </tests>
+  <help><![CDATA[
+    **stores info from variant calling into a table. It will create a tabulate filed with SNP infos**
+    
+-----
+
+**what it does :**
+
+VCFStorage.py is a python script that allows to store data from multiple VCF into a single tabular marker file. each VCF will be a new column on the final output.
+
+-----
+
+**input format :**
+
+Multiple files are necessary as input : 
+
+ - the fasta file of your genomic sequence
+ - multiple VCF files (1 per strain). It is strongly advised to use the column filter (col 7) for filtered positions instead of removing the lines from the VCF. 
+
+-----
+
+**ouput format :**
+
+the result is a tab delimited format file  where all genomic positions are in rows, and all strains are in columns (in the order you gave the VCF)
+
+For each position and each genome, a code is attributed : 
+
+- for the reference : ::
+
+    A,T,G,C for the corresponding nucleotidic acid 
+
+- for the genomes : ::
+
+    U if the position was not refered in the VCF file 
+    R if the base is similar to the reference 
+    F if the base has been filtered in the column FILTER (column 7) of the VCF 
+    A,T,G,C if the genome has a validated SNP at the position
+
+
+-----
+
+**example :**
+
+fasta input file (genomic sequence): ::
+    
+    >chr_17
+    ccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaa
+    TACGCGCGCGCCTAACCCTACGACTTTAACCTACTCTAAACTCTCCTACTAGTACGTCTT
+    
+VCF input file : ::
+
+    ##fileformat=VCFv4.1
+    ##fileDate=20140725
+    ##source=freeBayes v0.9.13-2-ga830efd
+    ##reference=exmple.fsa
+    ##phasing=none
+    ##DetectedFormat=freebayes
+    ##FILTER=<ID=G_AN,Description="The SNP has been filtered ; out of AN range(over 2)">
+    ##FILTER=<ID=G_AF,Description="The SNP has been filtered ; out of AF range(under 0.9)">
+    ##FILTER=<ID=G_DP,Description="The SNP has been filtered ; out of DP range(15 - 35)">
+    ##FILTER=<ID=InDel,Description="The SNP has been filtered ; InDel detected">
+    ##FILTER=<ID=Nmatch,Description="The SNP has been filtered ; reference base detected : N">
+    #CHROM    POS    ID    REF    ALT    QUAL    FILTER    INFO    FORMAT    V1
+    chr_17    17    .    A    G    529.213    G_AF;G_DP    AB=0.583333;ABP=5.18177;AC=1;AF=0.5;AN=2;AO=21;CIGAR=1X;DP=36;DPB=36;DPRA=0;EPP=3.1137;EPPR=3.15506;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=60;NS=1;NUMALT=1;ODDS=77.012;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=751;QR=535;RO=15;RPP=5.59539;RPPR=4.31318;RUN=1;SAF=11;SAP=3.1137;SAR=10;SRF=5;SRP=6.62942;SRR=10;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.58;G_DP=36;G_Base=G    GT:DP:RO:QR:AO:QA:GL    0/1:36:15:535:21:751:-10,0,-10
+    chr_17    37    .    C    G    1082.38    .    AB=0;ABP=0;AC=2;AF=1;AN=2;AO=34;CIGAR=1X;DP=34;DPB=34;DPRA=0;EPP=3.26577;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=48.0391;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=1243;QR=0;RO=0;RPP=15.5282;RPPR=0;RUN=1;SAF=18;SAP=3.26577;SAR=16;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=34;G_Base=G    GT:DP:RO:QR:AO:QA:GL    1/1:34:0:0:34:1243:-10,-9.23017,0
+    chr_17    40    .    T    T    825.518    G_AF    AB=0;ABP=0;AC=2;AF=1;AN=2;AO=29;CIGAR=1X;DP=34;DPB=34;DPRA=0;EPP=6.67934;EPPR=13.8677;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=60;NS=1;NUMALT=1;ODDS=8.92992;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=1082;QR=178;RO=5;RPP=9.07545;RPPR=13.8677;RUN=1;SAF=13;SAP=3.68421;SAR=16;SRF=5;SRP=13.8677;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.85;G_DP=34;G_Base=T    GT:DP:RO:QR:AO:QA:GL    1/1:34:5:178:29:1082:-10,0,-6.82575
+    chr_17    60    .    A    .    699.741    .    AB=0;ABP=0;AC=2;AF=1;AN=2;AO=22;CIGAR=1X;DP=22;DPB=22;DPRA=0;EPP=17.2236;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=32.2544;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=823;QR=0;RO=0;RPP=9.32731;RPPR=0;RUN=1;SAF=12;SAP=3.40511;SAR=10;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=22;G_Base=G    GT:DP:RO:QR:AO:QA:GL    1/1:22:0:0:22:823:-10,-5.98732,0
+    chr_17    73    .    T    .    846.299    .    AB=0;ABP=0;AC=2;AF=1;AN=2;AO=27;CIGAR=1X;DP=27;DPB=27;DPRA=0;EPP=16.6021;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=38.84;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=1002;QR=0;RO=0;RPP=5.02092;RPPR=0;RUN=1;SAF=21;SAP=21.1059;SAR=6;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=27;G_Base=T    GT:DP:RO:QR:AO:QA:GL    1/1:27:0:0:27:1002:-10,-7.34226,0
+    chr_17    81    .    C    T    764.464    .    AB=0;ABP=0;AC=2;AF=1;AN=2;AO=25;CIGAR=1X;DP=25;DPB=25;DPRA=0;EPP=13.5202;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=36.1324;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=902;QR=0;RO=0;RPP=3.79203;RPPR=0;RUN=1;SAF=19;SAP=17.6895;SAR=6;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=25;G_Base=T    GT:DP:RO:QR:AO:QA:GL    1/1:25:0:0:25:902:-10,-6.76842,0
+    chr_17    105    .    C    T    1154    G_DP    AB=0;ABP=0;AC=2;AF=1;AN=2;AO=37;CIGAR=1X;DP=37;DPB=37;DPRA=0;EPP=5.88603;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=52.0047;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=1336;QR=0;RO=0;RPP=19.9713;RPPR=0;RUN=1;SAF=23;SAP=7.76406;SAR=14;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=37;G_Base=T    GT:DP:RO:QR:AO:QA:GL    1/1:37:0:0:37:1336:-10,-10,0
+    chr_17    112    .    G    A    1276.25    G_DP    AB=0;ABP=0;AC=2;AF=1;AN=2;AO=40;CIGAR=1X;DP=40;DPB=40;DPRA=0;EPP=10.8276;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=55.9501;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=1471;QR=0;RO=0;RPP=10.8276;RPPR=0;RUN=1;SAF=26;SAP=10.8276;SAR=14;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=40;G_Base=A    GT:DP:RO:QR:AO:QA:GL    1/1:40:0:0:40:1471:-10,-10,0
+
+expected result : ::
+
+    CHROM    POS    reference    V1
+    chr_17    1    C    U
+    chr_17    2    C    U
+    chr_17    3    C    U
+    chr_17    4    T    U
+    chr_17    5    A    U
+    chr_17    6    A    U
+    chr_17    7    C    U
+    chr_17    8    C    U
+    chr_17    9    C    U
+    chr_17    10    T    U
+    chr_17    11    A    U
+    chr_17    12    A    U
+    chr_17    13    C    U
+    chr_17    14    C    U
+    chr_17    15    C    U
+    chr_17    16    T    U
+    chr_17    17    A    F
+    chr_17    18    A    U
+    chr_17    19    C    U
+    chr_17    20    C    U
+    chr_17    21    C    U
+    chr_17    22    T    U
+    chr_17    23    A    U
+    chr_17    24    A    U
+    chr_17    25    C    U
+    chr_17    26    C    U
+    chr_17    27    C    U
+    chr_17    28    T    U
+    chr_17    29    A    U
+    chr_17    30    A    U
+    chr_17    31    C    U
+    chr_17    32    C    U
+    chr_17    33    C    U
+    chr_17    34    T    U
+    chr_17    35    A    U
+    chr_17    36    A    U
+    chr_17    37    C    G
+    chr_17    38    C    U
+    chr_17    39    C    U
+    chr_17    40    T    F
+    chr_17    41    A    U
+    chr_17    42    A    U
+    chr_17    43    C    U
+    chr_17    44    C    U
+    chr_17    45    C    U
+    chr_17    46    T    U
+    chr_17    47    A    U
+    chr_17    48    A    U
+    chr_17    49    C    U
+    chr_17    50    C    U
+    chr_17    51    C    U
+    chr_17    52    T    U
+    chr_17    53    A    U
+    chr_17    54    A    U
+    chr_17    55    C    U
+    chr_17    56    C    U
+    chr_17    57    C    U
+    chr_17    58    T    U
+    chr_17    59    A    U
+    chr_17    60    A    R
+    chr_17    61    T    U
+    chr_17    62    A    U
+    chr_17    63    C    U
+    chr_17    64    G    U
+    chr_17    65    C    U
+    chr_17    66    G    U
+    chr_17    67    C    U
+    chr_17    68    G    U
+    chr_17    69    C    U
+    chr_17    70    G    U
+    chr_17    71    C    U
+    chr_17    72    C    U
+    chr_17    73    T    R
+    chr_17    74    A    U
+    chr_17    75    A    U
+    chr_17    76    C    U
+    chr_17    77    C    U
+    chr_17    78    C    U
+    chr_17    79    T    U
+    chr_17    80    A    U
+    chr_17    81    C    T
+    chr_17    82    G    U
+    chr_17    83    A    U
+    chr_17    84    C    U
+    chr_17    85    T    U
+    chr_17    86    T    U
+    chr_17    87    T    U
+    chr_17    88    A    U
+    chr_17    89    A    U
+    chr_17    90    C    U
+    chr_17    91    C    U
+    chr_17    92    T    U
+    chr_17    93    A    U
+    chr_17    94    C    U
+    chr_17    95    T    U
+    chr_17    96    C    U
+    chr_17    97    T    U
+    chr_17    98    A    U
+    chr_17    99    A    U
+    chr_17    100    A    U
+    chr_17    101    C    U
+    chr_17    102    T    U
+    chr_17    103    C    U
+    chr_17    104    T    U
+    chr_17    105    C    F
+    chr_17    106    C    U
+    chr_17    107    T    U
+    chr_17    108    A    U
+    chr_17    109    C    U
+    chr_17    110    T    U
+    chr_17    111    A    U
+    chr_17    112    G    F
+    chr_17    113    T    U
+    chr_17    114    A    U
+    chr_17    115    C    U
+    chr_17    116    G    U
+    chr_17    117    T    U
+    chr_17    118    C    U
+    chr_17    119    T    U
+    chr_17    120    T    U
+
+-----
+
+**reference :**
+
+]]>
+  </help>
+</tool>
diff -r 000000000000 -r 3552a8d9f51c test-data/Expchr17.tab
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Expchr17.tab	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,121 @@
+CHROM	POS	reference	V1
+chr_17	1	C	U
+chr_17	2	C	U
+chr_17	3	C	U
+chr_17	4	T	U
+chr_17	5	A	U
+chr_17	6	A	U
+chr_17	7	C	U
+chr_17	8	C	U
+chr_17	9	C	U
+chr_17	10	T	U
+chr_17	11	A	U
+chr_17	12	A	U
+chr_17	13	C	U
+chr_17	14	C	U
+chr_17	15	C	U
+chr_17	16	T	U
+chr_17	17	A	F
+chr_17	18	A	U
+chr_17	19	C	U
+chr_17	20	C	U
+chr_17	21	C	U
+chr_17	22	T	U
+chr_17	23	A	U
+chr_17	24	A	U
+chr_17	25	C	U
+chr_17	26	C	U
+chr_17	27	C	U
+chr_17	28	T	U
+chr_17	29	A	U
+chr_17	30	A	U
+chr_17	31	C	U
+chr_17	32	C	U
+chr_17	33	C	U
+chr_17	34	T	U
+chr_17	35	A	U
+chr_17	36	A	U
+chr_17	37	C	G
+chr_17	38	C	U
+chr_17	39	C	U
+chr_17	40	T	F
+chr_17	41	A	U
+chr_17	42	A	U
+chr_17	43	C	U
+chr_17	44	C	U
+chr_17	45	C	U
+chr_17	46	T	U
+chr_17	47	A	U
+chr_17	48	A	U
+chr_17	49	C	U
+chr_17	50	C	U
+chr_17	51	C	U
+chr_17	52	T	U
+chr_17	53	A	U
+chr_17	54	A	U
+chr_17	55	C	U
+chr_17	56	C	U
+chr_17	57	C	U
+chr_17	58	T	U
+chr_17	59	A	U
+chr_17	60	A	R
+chr_17	61	T	U
+chr_17	62	A	U
+chr_17	63	C	U
+chr_17	64	G	U
+chr_17	65	C	U
+chr_17	66	G	U
+chr_17	67	C	U
+chr_17	68	G	U
+chr_17	69	C	U
+chr_17	70	G	U
+chr_17	71	C	U
+chr_17	72	C	U
+chr_17	73	T	R
+chr_17	74	A	U
+chr_17	75	A	U
+chr_17	76	C	U
+chr_17	77	C	U
+chr_17	78	C	U
+chr_17	79	T	U
+chr_17	80	A	U
+chr_17	81	C	T
+chr_17	82	G	U
+chr_17	83	A	U
+chr_17	84	C	U
+chr_17	85	T	U
+chr_17	86	T	U
+chr_17	87	T	U
+chr_17	88	A	U
+chr_17	89	A	U
+chr_17	90	C	U
+chr_17	91	C	U
+chr_17	92	T	U
+chr_17	93	A	U
+chr_17	94	C	U
+chr_17	95	T	U
+chr_17	96	C	U
+chr_17	97	T	U
+chr_17	98	A	U
+chr_17	99	A	U
+chr_17	100	A	U
+chr_17	101	C	U
+chr_17	102	T	U
+chr_17	103	C	U
+chr_17	104	T	U
+chr_17	105	C	F
+chr_17	106	C	U
+chr_17	107	T	U
+chr_17	108	A	U
+chr_17	109	C	U
+chr_17	110	T	U
+chr_17	111	A	U
+chr_17	112	G	F
+chr_17	113	T	U
+chr_17	114	A	U
+chr_17	115	C	U
+chr_17	116	G	U
+chr_17	117	T	U
+chr_17	118	C	U
+chr_17	119	T	U
+chr_17	120	T	U
diff -r 000000000000 -r 3552a8d9f51c test-data/VCFCarto_input.tab
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/VCFCarto_input.tab	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,76 @@
+CHROM	POS	reference	REF1	G01	REF2	G02	G03	G04	G05	G06	G07	G08	G09	G10	G11	G12
+Chr1	1	A	R	R	R	R	U	R	R	R	R	R	R	R	R	R
+Chr1	2	T	R	R	R	R	R	U	R	R	R	R	R	R	R	R
+Chr1	3	G	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+Chr1	4	G	R	R	R	R	R	R	R	R	R	R	R	R	F	R
+Chr1	5	G	R	R	R	R	R	R	U	F	R	R	R	R	R	R
+Chr1	6	C	R	R	R	R	R	R	R	R	R	R	R	R	R	U
+Chr1	7	A	G	C	C	C	F	C	C	C	C	C	G	C	G	G
+Chr1	8	G	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+Chr1	9	C	R	T	T	R	T	T	T	U	R	T	R	T	T	T
+Chr1	10	T	R	R	R	R	R	R	R	R	R	R	R	R	R	U
+Chr1	11	T	R	R	R	R	R	R	R	R	R	R	R	F	R	R
+Chr1	12	A	R	R	R	R	U	R	R	R	R	F	R	R	R	R
+Chr1	13	A	R	R	G	G	R	F	R	F	G	R	G	R	R	F
+Chr1	14	A	R	R	R	R	R	R	R	R	F	R	R	R	R	R
+Chr1	15	G	R	R	R	U	R	F	R	R	R	R	R	R	U	U
+Chr1	16	G	A	R	R	A	R	R	U	F	R	R	A	A	R	A
+Chr1	17	A	R	G	G	R	U	R	R	G	G	R	G	U	R	G
+Chr1	18	C	R	R	R	R	R	U	R	R	R	R	R	R	R	R
+Chr1	19	G	C	U	R	C	R	C	U	R	R	C	C	C	R	C
+Chr1	20	G	A	U	R	A	R	A	U	R	R	A	A	A	R	A
+Chr1	21	G	T	U	R	T	R	T	U	R	R	T	T	T	R	T
+Chr1	22	A	T	U	R	T	R	T	U	R	R	T	T	T	R	T
+Chr1	23	C	T	T	R	T	R	R	R	T	R	U	T	R	T	T
+Chr1	24	T	R	R	R	R	R	U	R	R	R	R	R	R	R	F
+Chr1	25	G	R	F	R	R	R	R	R	U	R	F	R	R	R	R
+Chr1	26	T	R	R	C	C	C	C	C	R	R	C	R	C	R	U
+Chr1	27	C	R	R	G	G	G	G	R	G	R	G	R	G	R	R
+Chr1	28	C	G	T	T	T	G	G	T	T	F	T	G	T	T	G
+Chr1	29	G	T	R	R	R	R	T	R	T	R	T	T	R	T	R
+Chr1	30	T	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+Chr1	31	A	R	R	R	R	F	R	R	R	R	F	R	R	R	R
+Chr1	32	A	G	G	R	G	G	G	R	R	G	G	G	G	G	R
+Chr1	33	G	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+Chr1	34	C	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+Chr1	35	C	R	R	R	R	R	F	R	R	R	R	R	R	R	U
+Chr2	1	T	R	R	R	F	R	R	R	R	R	R	R	R	R	R
+Chr2	2	A	C	R	R	C	C	U	R	R	R	R	C	C	C	U
+Chr2	3	C	R	R	R	R	R	R	U	R	R	R	R	R	R	R
+Chr2	4	C	R	R	R	R	R	R	R	U	R	R	R	R	F	R
+Chr2	5	T	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+Chr2	6	C	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+Chr2	7	A	T	F	R	U	R	T	T	T	R	T	T	F	T	T
+Chr2	8	T	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+Chr2	9	C	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+Chr2	10	G	R	T	T	T	T	R	T	R	R	R	R	R	U	R
+Chr2	11	C	R	A	A	A	A	R	A	R	R	R	R	R	U	R
+Chr2	12	A	R	T	T	T	T	R	T	R	R	R	R	R	U	R
+Chr2	13	T	R	C	C	C	C	R	C	R	R	R	R	R	U	R
+Chr2	14	C	T	A	A	T	A	T	A	T	A	T	T	A	A	A
+Chr2	15	T	R	R	R	F	R	R	R	R	R	R	R	R	R	R
+Chr2	16	A	R	R	R	R	R	R	R	U	R	R	R	R	R	R
+Chr2	17	A	R	U	R	R	R	R	R	R	R	R	R	R	R	F
+Chr2	18	G	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+Chr2	19	A	R	R	R	R	R	R	F	R	R	R	R	R	R	R
+Chr2	20	C	R	R	R	R	R	R	R	F	R	R	R	R	R	R
+Chr2	21	G	A	R	R	A	A	A	R	R	R	A	A	R	R	R
+Chr2	22	A	R	R	R	R	R	R	F	R	R	R	R	R	R	R
+Chr2	23	A	R	R	T	T	R	R	T	T	T	T	T	R	R	R
+Chr2	24	T	R	R	R	R	R	R	U	R	R	R	R	R	R	F
+Chr2	25	T	R	A	A	R	R	A	R	A	R	R	A	R	R	A
+Chr2	26	G	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+Chr2	27	A	R	R	R	R	R	R	R	R	R	R	R	R	U	R
+Chr2	28	C	R	U	R	R	F	F	R	R	F	R	F	U	R	R
+Chr2	29	G	R	R	R	R	R	R	F	R	R	R	R	R	R	R
+Chr2	30	T	A	A	G	A	G	G	A	A	G	F	G	G	G	U
+Chr2	31	A	R	R	R	R	R	R	R	R	U	U	R	R	R	R
+Chr2	32	G	R	R	R	R	R	R	U	U	R	R	R	R	R	R
+Chr2	33	G	R	U	R	R	R	R	U	R	R	R	R	R	R	R
+Chr2	34	A	R	R	R	U	R	R	R	R	R	R	R	R	R	R
+Chr2	35	G	R	R	R	R	R	R	R	R	R	R	R	R	R	R
+Chr2	36	T	R	R	R	R	R	R	U	R	R	R	R	R	R	R
+Chr3	1	T	U	R	R	R	R	R	U	R	R	R	R	R	R	R
+Chr3	2	T	R	R	U	R	R	R	U	R	R	R	R	R	R	R
+Chr3	3	T	F	R	R	R	R	R	U	R	R	R	R	R	R	R
+Chr3	4	T	R	R	F	R	R	R	U	R	R	R	R	R	R	R
diff -r 000000000000 -r 3552a8d9f51c test-data/VCFCarto_output.tab
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/VCFCarto_output.tab	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,27 @@
+CHROM	POS	reference	REF1	G01	REF2	G02	G03	G04	G05	G06	G07	G08	G09	G10	G11	G12
+Chr1	7	A	G	C	C	C	F	C	C	C	C	C	G	C	G	G
+Chr1	9	C	R	T	T	R	T	T	T	U	R	T	R	T	T	T
+Chr1	13	A	R	R	G	G	R	F	R	F	G	R	G	R	R	F
+Chr1	16	G	A	R	R	A	R	R	U	F	R	R	A	A	R	A
+Chr1	17	A	R	G	G	R	U	R	R	G	G	R	G	U	R	G
+Chr1	19	G	C	U	R	C	R	C	U	R	R	C	C	C	R	C
+Chr1	20	G	A	U	R	A	R	A	U	R	R	A	A	A	R	A
+Chr1	21	G	T	U	R	T	R	T	U	R	R	T	T	T	R	T
+Chr1	22	A	T	U	R	T	R	T	U	R	R	T	T	T	R	T
+Chr1	23	C	T	T	R	T	R	R	R	T	R	U	T	R	T	T
+Chr1	26	T	R	R	C	C	C	C	C	R	R	C	R	C	R	U
+Chr1	27	C	R	R	G	G	G	G	R	G	R	G	R	G	R	R
+Chr1	28	C	G	T	T	T	G	G	T	T	F	T	G	T	T	G
+Chr1	29	G	T	R	R	R	R	T	R	T	R	T	T	R	T	R
+Chr1	32	A	G	G	R	G	G	G	R	R	G	G	G	G	G	R
+Chr2	2	A	C	R	R	C	C	U	R	R	R	R	C	C	C	U
+Chr2	7	A	T	F	R	U	R	T	T	T	R	T	T	F	T	T
+Chr2	10	G	R	T	T	T	T	R	T	R	R	R	R	R	U	R
+Chr2	11	C	R	A	A	A	A	R	A	R	R	R	R	R	U	R
+Chr2	12	A	R	T	T	T	T	R	T	R	R	R	R	R	U	R
+Chr2	13	T	R	C	C	C	C	R	C	R	R	R	R	R	U	R
+Chr2	14	C	T	A	A	T	A	T	A	T	A	T	T	A	A	A
+Chr2	21	G	A	R	R	A	A	A	R	R	R	A	A	R	R	R
+Chr2	23	A	R	R	T	T	R	R	T	T	T	T	T	R	R	R
+Chr2	25	T	R	A	A	R	R	A	R	A	R	R	A	R	R	A
+Chr2	30	T	A	A	G	A	G	G	A	A	G	F	G	G	G	U
diff -r 000000000000 -r 3552a8d9f51c test-data/VCFCarto_output_merged.bed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/VCFCarto_output_merged.bed	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,20 @@
+Chr1	7	7	*M_00001
+Chr1	9	9	*M_00002
+Chr1	13	13	*M_00003
+Chr1	16	16	*M_00004
+Chr1	17	17	*M_00005
+Chr1	19	22	*M_00006
+Chr1	23	23	*M_00007
+Chr1	26	26	*M_00008
+Chr1	27	27	*M_00009
+Chr1	28	28	*M_00010
+Chr1	29	29	*M_00011
+Chr1	32	32	*M_00012
+Chr2	2	2	*M_00013
+Chr2	7	7	*M_00014
+Chr2	10	13	*M_00015
+Chr2	14	14	*M_00016
+Chr2	21	21	*M_00017
+Chr2	23	23	*M_00018
+Chr2	25	25	*M_00019
+Chr2	30	30	*M_00020
diff -r 000000000000 -r 3552a8d9f51c test-data/VCFCarto_output_merged.tab
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/VCFCarto_output_merged.tab	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,21 @@
+CHROM	POS	reference	REF1	G01	REF2	G02	G03	G04	G05	G06	G07	G08	G09	G10	G11	G12
+Chr1	*M_00001	-	A	H	H	H	-	H	H	H	H	H	A	H	A	A
+Chr1	*M_00002	-	A	H	H	A	H	H	H	-	A	H	A	H	H	H
+Chr1	*M_00003	-	A	A	H	H	A	-	A	-	H	A	H	A	A	-
+Chr1	*M_00004	-	A	H	H	A	H	H	-	-	H	H	A	A	H	A
+Chr1	*M_00005	-	A	H	H	A	-	A	A	H	H	A	H	-	A	H
+Chr1	*M_00006	-	A	-	H	A	H	A	-	H	H	A	A	A	H	A
+Chr1	*M_00007	-	A	A	H	A	H	H	H	A	H	-	A	H	A	A
+Chr1	*M_00008	-	A	A	H	H	H	H	H	A	A	H	A	H	A	-
+Chr1	*M_00009	-	A	A	H	H	H	H	A	H	A	H	A	H	A	A
+Chr1	*M_00010	-	A	H	H	H	A	A	H	H	-	H	A	H	H	A
+Chr1	*M_00011	-	A	H	H	H	H	A	H	A	H	A	A	H	A	H
+Chr1	*M_00012	-	A	A	H	A	A	A	H	H	A	A	A	A	A	H
+Chr2	*M_00013	-	A	H	H	A	A	-	H	H	H	H	A	A	A	-
+Chr2	*M_00014	-	A	-	H	-	H	A	A	A	H	A	A	-	A	A
+Chr2	*M_00015	-	A	H	H	H	H	A	H	A	A	A	A	A	-	A
+Chr2	*M_00016	-	A	H	H	A	H	A	H	A	H	A	A	H	H	H
+Chr2	*M_00017	-	A	H	H	A	A	A	H	H	H	A	A	H	H	H
+Chr2	*M_00018	-	A	A	H	H	A	A	H	H	H	H	H	A	A	A
+Chr2	*M_00019	-	A	H	H	A	A	H	A	H	A	A	H	A	A	H
+Chr2	*M_00020	-	A	A	H	A	H	H	A	A	H	-	H	H	H	-
diff -r 000000000000 -r 3552a8d9f51c test-data/VCFFiltering_DP_4_200_output.vcf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/VCFFiltering_DP_4_200_output.vcf	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,110 @@
+##fileformat=VCFv4.1
+##fileDate=20140725
+##source=freeBayes v0.9.13-2-ga830efd
+##phasing=none
+##DetectedFormat=freebayes
+##FILTER=<ID=G_AN,Description="The SNP has been filtered ; out of AN range(over 2)">
+##FILTER=<ID=G_AF,Description="The SNP has been filtered ; out of AF range(under 0.9)">
+##FILTER=<ID=G_DP,Description="The SNP has been filtered ; out of DP range(4 - 200)">
+##FILTER=<ID=InDel,Description="The SNP has been filtered ; InDel detected">
+##FILTER=<ID=Nmatch,Description="The SNP has been filtered ; reference base detected : N">
+##INFO=<ID=G_AN,Number=1,Type=Integer,Description="Total number of alleles calculated by VCFFiltering">
+##INFO=<ID=G_AF,Number=1,Type=Float,Description="frequency of the most supported alternative allele calculated by VCFFiltering">
+##INFO=<ID=G_base,Number=1,Type=String,Description="base of the most supported alternative allele found by VCFFiltering">
+##INFO=<ID=G_DP,Number=1,Type=Integer,Description="total depth calculated by VCFFiltering">
+##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of samples with data">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
+##INFO=<ID=DPB,Number=1,Type=Float,Description="Total read depth per bp at the locus; bases in reads overlapping / bases in haplotype">
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Total number of alternate alleles in called genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Estimated allele frequency in the range (0,1]">
+##INFO=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count, with partial observations recorded fractionally">
+##INFO=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observations, with partial observations recorded fractionally">
+##INFO=<ID=PRO,Number=1,Type=Float,Description="Reference allele observation count, with partial observations recorded fractionally">
+##INFO=<ID=PAO,Number=A,Type=Float,Description="Alternate allele observations, with partial observations recorded fractionally">
+##INFO=<ID=QR,Number=1,Type=Integer,Description="Reference allele quality sum in phred">
+##INFO=<ID=QA,Number=A,Type=Integer,Description="Alternate allele quality sum in phred">
+##INFO=<ID=PQR,Number=1,Type=Float,Description="Reference allele quality sum in phred for partial observations">
+##INFO=<ID=PQA,Number=A,Type=Float,Description="Alternate allele quality sum in phred for partial observations">
+##INFO=<ID=SRF,Number=1,Type=Integer,Description="Number of reference observations on the forward strand">
+##INFO=<ID=SRR,Number=1,Type=Integer,Description="Number of reference observations on the reverse strand">
+##INFO=<ID=SAF,Number=A,Type=Integer,Description="Number of alternate observations on the forward strand">
+##INFO=<ID=SAR,Number=A,Type=Integer,Description="Number of alternate observations on the reverse strand">
+##INFO=<ID=SRP,Number=1,Type=Float,Description="Strand balance probability for the reference allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SRF and SRR given E(SRF/SRR) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=SAP,Number=A,Type=Float,Description="Strand balance probability for the alternate allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SAF and SAR given E(SAF/SAR) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=AB,Number=A,Type=Float,Description="Allele balance at heterozygous sites: a number between 0 and 1 representing the ratio of reads showing the reference allele to all reads, considering only reads from individuals called as heterozygous">
+##INFO=<ID=ABP,Number=A,Type=Float,Description="Allele balance probability at heterozygous sites: Phred-scaled upper-bounds estimate of the probability of observing the deviation between ABR and ABA given E(ABR/ABA) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=RUN,Number=A,Type=Integer,Description="Run length: the number of consecutive repeats of the alternate allele in the reference genome">
+##INFO=<ID=RPP,Number=A,Type=Float,Description="Read Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=RPPR,Number=1,Type=Float,Description="Read Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=EPP,Number=A,Type=Float,Description="End Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=EPPR,Number=1,Type=Float,Description="End Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=DPRA,Number=A,Type=Float,Description="Alternate allele depth ratio.  Ratio between depth in samples with each called alternate allele and those without.">
+##INFO=<ID=ODDS,Number=1,Type=Float,Description="The log odds ratio of the best genotype combination to the second-best.">
+##INFO=<ID=GTI,Number=1,Type=Integer,Description="Number of genotyping iterations required to reach convergence or bailout.">
+##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex.">
+##INFO=<ID=CIGAR,Number=A,Type=String,Description="The extended CIGAR representation of each alternate allele, with the exception that '=' is replaced by 'M' to ease VCF parsing.  Note that INDEL alleles do not have the first matched base (which is provided by default, per the spec) referred to by the CIGAR.">
+##INFO=<ID=NUMALT,Number=1,Type=Integer,Description="Number of unique non-reference alleles in called genotypes at this position.">
+##INFO=<ID=MEANALT,Number=A,Type=Float,Description="Mean number of unique non-reference allele observations per sample with the corresponding alternate alleles.">
+##INFO=<ID=LEN,Number=A,Type=Integer,Description="allele length">
+##INFO=<ID=MQM,Number=A,Type=Float,Description="Mean mapping quality of observed alternate alleles">
+##INFO=<ID=MQMR,Number=1,Type=Float,Description="Mean mapping quality of observed reference alleles">
+##INFO=<ID=PAIRED,Number=A,Type=Float,Description="Proportion of observed alternate alleles which are supported by properly paired read fragments">
+##INFO=<ID=PAIREDR,Number=1,Type=Float,Description="Proportion of observed reference alleles which are supported by properly paired read fragments">
+##INFO=<ID=technology.illumina,Number=A,Type=Float,Description="Fraction of observations supporting the alternate observed in reads from illumina">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality, the Phred-scaled marginal (or unconditional) probability of the called genotype">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count">
+##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations">
+##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count">
+##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	G15_myco
+chr_1	235	.	C	T	21.392	G_AF;G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=30;MQMR=42;NS=1;NUMALT=1;ODDS=0.865778;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=77;QR=35;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:35:2:77:-4.63556,0,-2.351
+chr_1	244	.	C	T	21.1881	G_AF;G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=30;MQMR=42;NS=1;NUMALT=1;ODDS=0.865718;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=76;QR=35;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:35:2:76:-4.61503,0,-2.35102
+chr_1	253	.	T	C	73.475	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=34;MQMR=0;NS=1;NUMALT=1;ODDS=7.23646;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=110;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=2;SAP=3.73412;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=C	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:110:-8.62509,-0.841726,0
+chr_1	333	.	G	A	24.2337	G_AF;G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=30;MQMR=42;NS=1;NUMALT=1;ODDS=3.07477;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=82;QR=24;RO=1;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=5.18177;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:24:2:82:-4.69685,0,-1.39164
+chr_1	354	.	G	A	20.5104	G_AF;G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=30;MQMR=42;NS=1;NUMALT=1;ODDS=2.23682;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=78;QR=28;RO=1;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=5.18177;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:28:2:78:-4.66174,0,-1.75556
+chr_1	363	.	G	A	40.3032	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=3.0103;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=36;MQMR=0;NS=1;NUMALT=1;ODDS=5.91856;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=63;QR=0;RO=0;RPP=7.35324;RPPR=0;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=2;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:63:-5.23324,-0.570398,0
+chr_1	1531	.	G	A	73.2764	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=35;MQMR=0;NS=1;NUMALT=1;ODDS=7.23732;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=115;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=3;SAP=9.52472;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:115:-9.08235,-0.842098,0
+chr_1	1565	.	A	G	14.5726	G_AF	AB=0.5;ABP=3.0103;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=7.35324;EPPR=7.35324;GTI=0;LEN=1;MEANALT=1;MQM=38;MQMR=35;NS=1;NUMALT=1;ODDS=3.30493;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=71;QR=71;RO=2;RPP=7.35324;RPPR=3.0103;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=3.0103;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.50;G_DP=4;G_Base=G	GT:DP:RO:QR:AO:QA:GL	0/1:4:2:71:2:71:-5.0654,0,-4.84835
+chr_1	1589	.	A	G	102.964	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=5.18177;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=36.5;MQMR=0;NS=1;NUMALT=1;ODDS=8.55461;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=155;QR=0;RO=0;RPP=11.6962;RPPR=0;RUN=1;SAF=1;SAP=5.18177;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=4;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:155:-10,-1.11316,0
+chr_1	1635	.	G	A	95.7333	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=5.18177;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=38.5;MQMR=0;NS=1;NUMALT=1;ODDS=8.55365;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=141;QR=0;RO=0;RPP=5.18177;RPPR=0;RUN=1;SAF=0;SAP=11.6962;SAR=4;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=4;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:141:-10,-1.11274,0
+chr_1	2624	.	C	T	122.967	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=5.18177;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=44.75;MQMR=0;NS=1;NUMALT=1;ODDS=8.5553;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=156;QR=0;RO=0;RPP=3.0103;RPPR=0;RUN=1;SAF=3;SAP=5.18177;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=4;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:156:-10,-1.11346,0
+chr_1	2670	.	C	T	30.7231	G_AF;G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=42.5;MQMR=36;NS=1;NUMALT=1;ODDS=0.739044;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=71;QR=41;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:41:2:71:-5.60946,0,-2.40604
+chr_1	2671	.	G	A	30.0349	G_AF;G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=42.5;MQMR=36;NS=1;NUMALT=1;ODDS=0.738983;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=70;QR=41;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:41:2:70:-5.5406,0,-2.40606
+chr_1	2686	.	A	G	28.1218	G_AF;G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=42.5;MQMR=36;NS=1;NUMALT=1;ODDS=0.861385;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=67;QR=39;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:39:2:67:-5.31237,0,-2.3529
+chr_1	2697	.	G	A	66.8365	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=9.52472;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=7.23789;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=104;QR=0;RO=0;RPP=9.52472;RPPR=0;RUN=1;SAF=0;SAP=9.52472;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:104:-9.39261,-0.842345,0
+chr_1	2699	.	G	A	75.6507	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=7.23781;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=103;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=0;SAP=9.52472;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:103:-9.31979,-0.842311,0
+chr_1	2747	.	C	T	52.6764	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=7.35324;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=5.92179;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=81;QR=0;RO=0;RPP=7.35324;RPPR=0;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=2;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:81:-7.07265,-0.5718,0
+chr_1	3616	.	C	T	96.527	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=11.6962;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=8.55506;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=153;QR=0;RO=0;RPP=11.6962;RPPR=0;RUN=1;SAF=4;SAP=11.6962;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=4;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:153:-10,-1.11336,0
+chr_1	3624	.	A	G	99.7577	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=11.6962;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=8.55532;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=158;QR=0;RO=0;RPP=11.6962;RPPR=0;RUN=1;SAF=4;SAP=11.6962;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=4;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:158:-10,-1.11347,0
+chr_1	3630	.	G	A	119.888	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=13.8677;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=9.87182;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=191;QR=0;RO=0;RPP=13.8677;RPPR=0;RUN=1;SAF=5;SAP=13.8677;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=5;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:191:-10,-1.38419,0
+chr_1	3657	.	T	C	146.729	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.44459;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=9.87224;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=204;QR=0;RO=0;RPP=3.44459;RPPR=0;RUN=1;SAF=5;SAP=13.8677;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=5;G_Base=C	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:204:-10,-1.38437,0
+chr_1	3681	.	C	T	141.607	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=6;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=8.80089;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=41.5;MQMR=0;NS=1;NUMALT=1;ODDS=11.1867;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=201;QR=0;RO=0;RPP=8.80089;RPPR=0;RUN=1;SAF=6;SAP=16.0391;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=6;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:6:0:0:6:201:-10,-1.65422,0
+chr_1	3746	.	G	A	143.027	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.44459;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=42.8;MQMR=0;NS=1;NUMALT=1;ODDS=9.87133;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=177;QR=0;RO=0;RPP=3.44459;RPPR=0;RUN=1;SAF=2;SAP=3.44459;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=5;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:177:-10,-1.38398,0
+chr_1	3766	.	TGG	TG	207.378	InDel	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=7;CIGAR=1M1D1M;DP=7;DPB=4.66667;DPRA=0;EPP=3.32051;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=41.8571;MQMR=0;NS=1;NUMALT=1;ODDS=12.5052;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=267;QR=0;RO=0;RPP=3.32051;RPPR=0;RUN=1;SAF=1;SAP=10.7656;SAR=6;SRF=0;SRP=0;SRR=0;TYPE=del;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=7;G_Base=TG	GT:DP:RO:QR:AO:QA:GL	1/1:7:0:0:7:267:-10,-1.9258,0
+chr_1	3804	.	C	T	168.638	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=6;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=4.45795;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=42.1667;MQMR=0;NS=1;NUMALT=1;ODDS=11.188;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=213;QR=0;RO=0;RPP=3.0103;RPPR=0;RUN=1;SAF=1;SAP=8.80089;SAR=5;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=6;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:6:0:0:6:213:-10,-1.65476,0
+chr_1	3845	.	G	A	130.7	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=6.91895;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=41.8;MQMR=0;NS=1;NUMALT=1;ODDS=9.87163;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=184;QR=0;RO=0;RPP=13.8677;RPPR=0;RUN=1;SAF=1;SAP=6.91895;SAR=4;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=5;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:184:-10,-1.38411,0
+chr_1	3857	.	G	A	72.7109	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=9.52472;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=7.23836;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=113;QR=0;RO=0;RPP=9.52472;RPPR=0;RUN=1;SAF=0;SAP=9.52472;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:113:-9.98004,-0.84255,0
+chr_1	4299	.	C	T	48.7928	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=3.73412;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=37.6667;MQMR=48;NS=1;NUMALT=1;ODDS=2.04069;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=100;QR=34;RO=1;RPP=9.52472;RPPR=5.18177;RUN=1;SAF=2;SAP=3.73412;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.75;G_DP=4;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:4:1:34:3:100:-7.69498,0,-2.01683
+chr_1	4311	.	A	G	138.174	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=6.91895;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40.2;MQMR=0;NS=1;NUMALT=1;ODDS=9.8711;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=179;QR=0;RO=0;RPP=3.44459;RPPR=0;RUN=1;SAF=3;SAP=3.44459;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=5;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:179:-10,-1.38387,0
+chr_1	4357	.	C	T	141.385	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.44459;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40.2;MQMR=0;NS=1;NUMALT=1;ODDS=9.87061;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=181;QR=0;RO=0;RPP=3.44459;RPPR=0;RUN=1;SAF=2;SAP=3.44459;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=5;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:181:-10,-1.38366,0
+chr_1	4372	.	C	T	57.8383	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=3.73412;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=48;NS=1;NUMALT=1;ODDS=0.86483;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=110;QR=40;RO=1;RPP=3.73412;RPPR=5.18177;RUN=1;SAF=2;SAP=3.73412;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.75;G_DP=4;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:4:1:40:3:110:-8.53351,0,-2.5275
+chr_1	4389	.	C	T	176.339	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=7;CIGAR=1X;DP=8;DPB=8;DPRA=0;EPP=5.80219;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=45.4286;MQMR=48;NS=1;NUMALT=1;ODDS=6.11702;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=247;QR=37;RO=1;RPP=3.32051;RPPR=5.18177;RUN=1;SAF=3;SAP=3.32051;SAR=4;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.88;G_DP=8;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:8:1:37:7:247:-10,0,-1.14959
+chr_1	4398	.	T	C	197.868	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=7;CIGAR=1X;DP=7;DPB=7;DPRA=0;EPP=5.80219;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=45.4286;MQMR=0;NS=1;NUMALT=1;ODDS=12.5039;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=243;QR=0;RO=0;RPP=3.32051;RPPR=0;RUN=1;SAF=3;SAP=3.32051;SAR=4;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=7;G_Base=C	GT:DP:RO:QR:AO:QA:GL	1/1:7:0:0:7:243:-10,-1.92523,0
+chr_1	4404	.	T	C	168.543	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=6;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=4.45795;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=46.3333;MQMR=0;NS=1;NUMALT=1;ODDS=11.1873;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=209;QR=0;RO=0;RPP=4.45795;RPPR=0;RUN=1;SAF=2;SAP=4.45795;SAR=4;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=6;G_Base=C	GT:DP:RO:QR:AO:QA:GL	1/1:6:0:0:6:209:-10,-1.65448,0
+chr_1	4475	.	C	T	81.0612	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=47;MQMR=0;NS=1;NUMALT=1;ODDS=7.2379;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=110;QR=0;RO=0;RPP=9.52472;RPPR=0;RUN=1;SAF=1;SAP=3.73412;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:110:-9.86084,-0.842352,0
+chr_1	4540	.	C	T	72.5101	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=37.6667;MQMR=0;NS=1;NUMALT=1;ODDS=7.23698;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=101;QR=0;RO=0;RPP=9.52472;RPPR=0;RUN=1;SAF=1;SAP=3.73412;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:101:-9.00573,-0.841952,0
+chr_1	4580	.	C	T	81.3345	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=9.52472;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=37.6667;MQMR=0;NS=1;NUMALT=1;ODDS=7.23817;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=119;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=1;SAP=3.73412;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:119:-9.88816,-0.842465,0
+chr_1	4611	.	C	G	51.9857	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=7.35324;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=41.5;MQMR=0;NS=1;NUMALT=1;ODDS=5.92133;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=69;QR=0;RO=0;RPP=3.0103;RPPR=0;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=2;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:69:-6.40152,-0.5716,0
+chr_1	4661	.	A	G	19.7502	G_AF;G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=35;MQMR=43;NS=1;NUMALT=1;ODDS=0.834078;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=76;QR=35;RO=1;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:35:2:76:-5.08162,0,-2.36476
+chr_1	4678	.	G	A	21.951	G_AF;G_DP	AB=0.666667;ABP=3.73412;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=35;MQMR=43;NS=1;NUMALT=1;ODDS=0.136458;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=68;QR=41;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	0/1:3:1:41:2:68:-4.94794,0,-2.78626
+chr_1	4686	.	C	T	81.6957	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=37.6667;MQMR=0;NS=1;NUMALT=1;ODDS=7.23731;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=110;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=2;SAP=3.73412;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:110:-9.44717,-0.842096,0
+chr_1	4699	.	G	A	103.379	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=3.0103;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=36.75;MQMR=0;NS=1;NUMALT=1;ODDS=8.55324;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=140;QR=0;RO=0;RPP=5.18177;RPPR=0;RUN=1;SAF=3;SAP=5.18177;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=4;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:140:-10,-1.11256,0
+chr_1	4717	.	C	T	18.6085	G_AF;G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=35;MQMR=34;NS=1;NUMALT=1;ODDS=1.12012;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=66;QR=40;RO=1;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=1;SRP=5.18177;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:40:2:66:-4.87583,0,-2.24054
+chr_1	4727	.	G	A	43.4619	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=3.0103;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=32;MQMR=0;NS=1;NUMALT=1;ODDS=5.91984;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=66;QR=0;RO=0;RPP=3.0103;RPPR=0;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=2;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:66:-5.54913,-0.570955,0
+chr_1	4747	.	C	T	40.3421	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=7.35324;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=34;MQMR=0;NS=1;NUMALT=1;ODDS=5.92045;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=68;QR=0;RO=0;RPP=7.35324;RPPR=0;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=2;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:68:-5.83919,-0.571218,0
+chr_1	3305168	.	T	A,G	280.615	G_AF	AB=0.75,0.25;ABP=9.52472,9.52472;AC=1,1;AF=0.5,0.5;AN=2;AO=9,3;CIGAR=1X,1X;DP=12;DPB=12;DPRA=0,0;EPP=9.04217,3.73412;EPPR=0;GTI=0;LEN=1,1;MEANALT=2,2;MQM=60,60;MQMR=0;NS=1;NUMALT=2;ODDS=4.632;PAIRED=1,1;PAIREDR=0;PAO=0,0;PQA=0,0;PQR=0;PRO=0;QA=319,107;QR=0;RO=0;RPP=9.04217,9.52472;RPPR=0;RUN=1,1;SAF=4,2;SAP=3.25157,3.73412;SAR=5,1;SRF=0;SRP=0;SRR=0;TYPE=snp,snp;technology.illumina=1,1;G_AN=2;G_AF=0.75;G_DP=12;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/2:12:0:0:9,3:319,107:-10,-8.89435,-6.43456,-10,0,-10
+chr_1	3305169	.	T	A,G	280.615	G_AF	AB=0.25,0.75;ABP=9.52472,9.52472;AC=1,1;AF=0.5,0.5;AN=2;AO=9,3;CIGAR=1X,1X;DP=12;DPB=12;DPRA=0,0;EPP=9.04217,3.73412;EPPR=0;GTI=0;LEN=1,1;MEANALT=2,2;MQM=60,60;MQMR=0;NS=1;NUMALT=2;ODDS=4.632;PAIRED=1,1;PAIREDR=0;PAO=0,0;PQA=0,0;PQR=0;PRO=0;QA=319,107;QR=0;RO=0;RPP=9.04217,9.52472;RPPR=0;RUN=1,1;SAF=4,2;SAP=3.25157,3.73412;SAR=5,1;SRF=0;SRP=0;SRR=0;TYPE=snp,snp;technology.illumina=1,1;G_AN=2;G_AF=0.75;G_DP=12;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/2:12:0:0:9,3:319,107:-10,-8.89435,-6.43456,-10,0,-10
diff -r 000000000000 -r 3552a8d9f51c test-data/VCFFiltering_DPauto_output.vcf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/VCFFiltering_DPauto_output.vcf	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,110 @@
+##fileformat=VCFv4.1
+##fileDate=20140725
+##source=freeBayes v0.9.13-2-ga830efd
+##phasing=none
+##DetectedFormat=freebayes
+##FILTER=<ID=G_AN,Description="The SNP has been filtered ; out of AN range(over 2)">
+##FILTER=<ID=G_AF,Description="The SNP has been filtered ; out of AF range(under 0.9)">
+##FILTER=<ID=G_DP,Description="The SNP has been filtered ; out of DP range(3 - 5)">
+##FILTER=<ID=InDel,Description="The SNP has been filtered ; InDel detected">
+##FILTER=<ID=Nmatch,Description="The SNP has been filtered ; reference base detected : N">
+##INFO=<ID=G_AN,Number=1,Type=Integer,Description="Total number of alleles calculated by VCFFiltering">
+##INFO=<ID=G_AF,Number=1,Type=Float,Description="frequency of the most supported alternative allele calculated by VCFFiltering">
+##INFO=<ID=G_base,Number=1,Type=String,Description="base of the most supported alternative allele found by VCFFiltering">
+##INFO=<ID=G_DP,Number=1,Type=Integer,Description="total depth calculated by VCFFiltering">
+##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of samples with data">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
+##INFO=<ID=DPB,Number=1,Type=Float,Description="Total read depth per bp at the locus; bases in reads overlapping / bases in haplotype">
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Total number of alternate alleles in called genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Estimated allele frequency in the range (0,1]">
+##INFO=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count, with partial observations recorded fractionally">
+##INFO=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observations, with partial observations recorded fractionally">
+##INFO=<ID=PRO,Number=1,Type=Float,Description="Reference allele observation count, with partial observations recorded fractionally">
+##INFO=<ID=PAO,Number=A,Type=Float,Description="Alternate allele observations, with partial observations recorded fractionally">
+##INFO=<ID=QR,Number=1,Type=Integer,Description="Reference allele quality sum in phred">
+##INFO=<ID=QA,Number=A,Type=Integer,Description="Alternate allele quality sum in phred">
+##INFO=<ID=PQR,Number=1,Type=Float,Description="Reference allele quality sum in phred for partial observations">
+##INFO=<ID=PQA,Number=A,Type=Float,Description="Alternate allele quality sum in phred for partial observations">
+##INFO=<ID=SRF,Number=1,Type=Integer,Description="Number of reference observations on the forward strand">
+##INFO=<ID=SRR,Number=1,Type=Integer,Description="Number of reference observations on the reverse strand">
+##INFO=<ID=SAF,Number=A,Type=Integer,Description="Number of alternate observations on the forward strand">
+##INFO=<ID=SAR,Number=A,Type=Integer,Description="Number of alternate observations on the reverse strand">
+##INFO=<ID=SRP,Number=1,Type=Float,Description="Strand balance probability for the reference allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SRF and SRR given E(SRF/SRR) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=SAP,Number=A,Type=Float,Description="Strand balance probability for the alternate allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SAF and SAR given E(SAF/SAR) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=AB,Number=A,Type=Float,Description="Allele balance at heterozygous sites: a number between 0 and 1 representing the ratio of reads showing the reference allele to all reads, considering only reads from individuals called as heterozygous">
+##INFO=<ID=ABP,Number=A,Type=Float,Description="Allele balance probability at heterozygous sites: Phred-scaled upper-bounds estimate of the probability of observing the deviation between ABR and ABA given E(ABR/ABA) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=RUN,Number=A,Type=Integer,Description="Run length: the number of consecutive repeats of the alternate allele in the reference genome">
+##INFO=<ID=RPP,Number=A,Type=Float,Description="Read Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=RPPR,Number=1,Type=Float,Description="Read Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=EPP,Number=A,Type=Float,Description="End Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=EPPR,Number=1,Type=Float,Description="End Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=DPRA,Number=A,Type=Float,Description="Alternate allele depth ratio.  Ratio between depth in samples with each called alternate allele and those without.">
+##INFO=<ID=ODDS,Number=1,Type=Float,Description="The log odds ratio of the best genotype combination to the second-best.">
+##INFO=<ID=GTI,Number=1,Type=Integer,Description="Number of genotyping iterations required to reach convergence or bailout.">
+##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex.">
+##INFO=<ID=CIGAR,Number=A,Type=String,Description="The extended CIGAR representation of each alternate allele, with the exception that '=' is replaced by 'M' to ease VCF parsing.  Note that INDEL alleles do not have the first matched base (which is provided by default, per the spec) referred to by the CIGAR.">
+##INFO=<ID=NUMALT,Number=1,Type=Integer,Description="Number of unique non-reference alleles in called genotypes at this position.">
+##INFO=<ID=MEANALT,Number=A,Type=Float,Description="Mean number of unique non-reference allele observations per sample with the corresponding alternate alleles.">
+##INFO=<ID=LEN,Number=A,Type=Integer,Description="allele length">
+##INFO=<ID=MQM,Number=A,Type=Float,Description="Mean mapping quality of observed alternate alleles">
+##INFO=<ID=MQMR,Number=1,Type=Float,Description="Mean mapping quality of observed reference alleles">
+##INFO=<ID=PAIRED,Number=A,Type=Float,Description="Proportion of observed alternate alleles which are supported by properly paired read fragments">
+##INFO=<ID=PAIREDR,Number=1,Type=Float,Description="Proportion of observed reference alleles which are supported by properly paired read fragments">
+##INFO=<ID=technology.illumina,Number=A,Type=Float,Description="Fraction of observations supporting the alternate observed in reads from illumina">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality, the Phred-scaled marginal (or unconditional) probability of the called genotype">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count">
+##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations">
+##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count">
+##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	G15_myco
+chr_1	235	.	C	T	21.392	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=30;MQMR=42;NS=1;NUMALT=1;ODDS=0.865778;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=77;QR=35;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:35:2:77:-4.63556,0,-2.351
+chr_1	244	.	C	T	21.1881	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=30;MQMR=42;NS=1;NUMALT=1;ODDS=0.865718;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=76;QR=35;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:35:2:76:-4.61503,0,-2.35102
+chr_1	253	.	T	C	73.475	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=34;MQMR=0;NS=1;NUMALT=1;ODDS=7.23646;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=110;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=2;SAP=3.73412;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=C	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:110:-8.62509,-0.841726,0
+chr_1	333	.	G	A	24.2337	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=30;MQMR=42;NS=1;NUMALT=1;ODDS=3.07477;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=82;QR=24;RO=1;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=5.18177;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:24:2:82:-4.69685,0,-1.39164
+chr_1	354	.	G	A	20.5104	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=30;MQMR=42;NS=1;NUMALT=1;ODDS=2.23682;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=78;QR=28;RO=1;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=5.18177;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:28:2:78:-4.66174,0,-1.75556
+chr_1	363	.	G	A	40.3032	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=3.0103;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=36;MQMR=0;NS=1;NUMALT=1;ODDS=5.91856;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=63;QR=0;RO=0;RPP=7.35324;RPPR=0;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=2;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:63:-5.23324,-0.570398,0
+chr_1	1531	.	G	A	73.2764	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=35;MQMR=0;NS=1;NUMALT=1;ODDS=7.23732;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=115;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=3;SAP=9.52472;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:115:-9.08235,-0.842098,0
+chr_1	1565	.	A	G	14.5726	G_AF	AB=0.5;ABP=3.0103;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=7.35324;EPPR=7.35324;GTI=0;LEN=1;MEANALT=1;MQM=38;MQMR=35;NS=1;NUMALT=1;ODDS=3.30493;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=71;QR=71;RO=2;RPP=7.35324;RPPR=3.0103;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=3.0103;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.50;G_DP=4;G_Base=G	GT:DP:RO:QR:AO:QA:GL	0/1:4:2:71:2:71:-5.0654,0,-4.84835
+chr_1	1589	.	A	G	102.964	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=5.18177;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=36.5;MQMR=0;NS=1;NUMALT=1;ODDS=8.55461;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=155;QR=0;RO=0;RPP=11.6962;RPPR=0;RUN=1;SAF=1;SAP=5.18177;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=4;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:155:-10,-1.11316,0
+chr_1	1635	.	G	A	95.7333	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=5.18177;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=38.5;MQMR=0;NS=1;NUMALT=1;ODDS=8.55365;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=141;QR=0;RO=0;RPP=5.18177;RPPR=0;RUN=1;SAF=0;SAP=11.6962;SAR=4;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=4;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:141:-10,-1.11274,0
+chr_1	2624	.	C	T	122.967	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=5.18177;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=44.75;MQMR=0;NS=1;NUMALT=1;ODDS=8.5553;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=156;QR=0;RO=0;RPP=3.0103;RPPR=0;RUN=1;SAF=3;SAP=5.18177;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=4;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:156:-10,-1.11346,0
+chr_1	2670	.	C	T	30.7231	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=42.5;MQMR=36;NS=1;NUMALT=1;ODDS=0.739044;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=71;QR=41;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:41:2:71:-5.60946,0,-2.40604
+chr_1	2671	.	G	A	30.0349	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=42.5;MQMR=36;NS=1;NUMALT=1;ODDS=0.738983;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=70;QR=41;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:41:2:70:-5.5406,0,-2.40606
+chr_1	2686	.	A	G	28.1218	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=42.5;MQMR=36;NS=1;NUMALT=1;ODDS=0.861385;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=67;QR=39;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:39:2:67:-5.31237,0,-2.3529
+chr_1	2697	.	G	A	66.8365	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=9.52472;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=7.23789;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=104;QR=0;RO=0;RPP=9.52472;RPPR=0;RUN=1;SAF=0;SAP=9.52472;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:104:-9.39261,-0.842345,0
+chr_1	2699	.	G	A	75.6507	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=7.23781;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=103;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=0;SAP=9.52472;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:103:-9.31979,-0.842311,0
+chr_1	2747	.	C	T	52.6764	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=7.35324;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=5.92179;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=81;QR=0;RO=0;RPP=7.35324;RPPR=0;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=2;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:81:-7.07265,-0.5718,0
+chr_1	3616	.	C	T	96.527	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=11.6962;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=8.55506;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=153;QR=0;RO=0;RPP=11.6962;RPPR=0;RUN=1;SAF=4;SAP=11.6962;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=4;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:153:-10,-1.11336,0
+chr_1	3624	.	A	G	99.7577	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=11.6962;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=8.55532;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=158;QR=0;RO=0;RPP=11.6962;RPPR=0;RUN=1;SAF=4;SAP=11.6962;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=4;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:158:-10,-1.11347,0
+chr_1	3630	.	G	A	119.888	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=13.8677;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=9.87182;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=191;QR=0;RO=0;RPP=13.8677;RPPR=0;RUN=1;SAF=5;SAP=13.8677;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=5;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:191:-10,-1.38419,0
+chr_1	3657	.	T	C	146.729	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.44459;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=9.87224;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=204;QR=0;RO=0;RPP=3.44459;RPPR=0;RUN=1;SAF=5;SAP=13.8677;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=5;G_Base=C	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:204:-10,-1.38437,0
+chr_1	3681	.	C	T	141.607	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=6;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=8.80089;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=41.5;MQMR=0;NS=1;NUMALT=1;ODDS=11.1867;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=201;QR=0;RO=0;RPP=8.80089;RPPR=0;RUN=1;SAF=6;SAP=16.0391;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=6;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:6:0:0:6:201:-10,-1.65422,0
+chr_1	3746	.	G	A	143.027	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.44459;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=42.8;MQMR=0;NS=1;NUMALT=1;ODDS=9.87133;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=177;QR=0;RO=0;RPP=3.44459;RPPR=0;RUN=1;SAF=2;SAP=3.44459;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=5;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:177:-10,-1.38398,0
+chr_1	3766	.	TGG	TG	207.378	InDel;G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=7;CIGAR=1M1D1M;DP=7;DPB=4.66667;DPRA=0;EPP=3.32051;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=41.8571;MQMR=0;NS=1;NUMALT=1;ODDS=12.5052;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=267;QR=0;RO=0;RPP=3.32051;RPPR=0;RUN=1;SAF=1;SAP=10.7656;SAR=6;SRF=0;SRP=0;SRR=0;TYPE=del;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=7;G_Base=TG	GT:DP:RO:QR:AO:QA:GL	1/1:7:0:0:7:267:-10,-1.9258,0
+chr_1	3804	.	C	T	168.638	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=6;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=4.45795;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=42.1667;MQMR=0;NS=1;NUMALT=1;ODDS=11.188;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=213;QR=0;RO=0;RPP=3.0103;RPPR=0;RUN=1;SAF=1;SAP=8.80089;SAR=5;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=6;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:6:0:0:6:213:-10,-1.65476,0
+chr_1	3845	.	G	A	130.7	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=6.91895;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=41.8;MQMR=0;NS=1;NUMALT=1;ODDS=9.87163;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=184;QR=0;RO=0;RPP=13.8677;RPPR=0;RUN=1;SAF=1;SAP=6.91895;SAR=4;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=5;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:184:-10,-1.38411,0
+chr_1	3857	.	G	A	72.7109	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=9.52472;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=7.23836;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=113;QR=0;RO=0;RPP=9.52472;RPPR=0;RUN=1;SAF=0;SAP=9.52472;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:113:-9.98004,-0.84255,0
+chr_1	4299	.	C	T	48.7928	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=3.73412;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=37.6667;MQMR=48;NS=1;NUMALT=1;ODDS=2.04069;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=100;QR=34;RO=1;RPP=9.52472;RPPR=5.18177;RUN=1;SAF=2;SAP=3.73412;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.75;G_DP=4;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:4:1:34:3:100:-7.69498,0,-2.01683
+chr_1	4311	.	A	G	138.174	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=6.91895;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40.2;MQMR=0;NS=1;NUMALT=1;ODDS=9.8711;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=179;QR=0;RO=0;RPP=3.44459;RPPR=0;RUN=1;SAF=3;SAP=3.44459;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=5;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:179:-10,-1.38387,0
+chr_1	4357	.	C	T	141.385	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.44459;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40.2;MQMR=0;NS=1;NUMALT=1;ODDS=9.87061;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=181;QR=0;RO=0;RPP=3.44459;RPPR=0;RUN=1;SAF=2;SAP=3.44459;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=5;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:181:-10,-1.38366,0
+chr_1	4372	.	C	T	57.8383	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=3.73412;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=48;NS=1;NUMALT=1;ODDS=0.86483;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=110;QR=40;RO=1;RPP=3.73412;RPPR=5.18177;RUN=1;SAF=2;SAP=3.73412;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.75;G_DP=4;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:4:1:40:3:110:-8.53351,0,-2.5275
+chr_1	4389	.	C	T	176.339	G_AF;G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=7;CIGAR=1X;DP=8;DPB=8;DPRA=0;EPP=5.80219;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=45.4286;MQMR=48;NS=1;NUMALT=1;ODDS=6.11702;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=247;QR=37;RO=1;RPP=3.32051;RPPR=5.18177;RUN=1;SAF=3;SAP=3.32051;SAR=4;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.88;G_DP=8;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:8:1:37:7:247:-10,0,-1.14959
+chr_1	4398	.	T	C	197.868	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=7;CIGAR=1X;DP=7;DPB=7;DPRA=0;EPP=5.80219;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=45.4286;MQMR=0;NS=1;NUMALT=1;ODDS=12.5039;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=243;QR=0;RO=0;RPP=3.32051;RPPR=0;RUN=1;SAF=3;SAP=3.32051;SAR=4;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=7;G_Base=C	GT:DP:RO:QR:AO:QA:GL	1/1:7:0:0:7:243:-10,-1.92523,0
+chr_1	4404	.	T	C	168.543	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=6;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=4.45795;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=46.3333;MQMR=0;NS=1;NUMALT=1;ODDS=11.1873;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=209;QR=0;RO=0;RPP=4.45795;RPPR=0;RUN=1;SAF=2;SAP=4.45795;SAR=4;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=6;G_Base=C	GT:DP:RO:QR:AO:QA:GL	1/1:6:0:0:6:209:-10,-1.65448,0
+chr_1	4475	.	C	T	81.0612	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=47;MQMR=0;NS=1;NUMALT=1;ODDS=7.2379;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=110;QR=0;RO=0;RPP=9.52472;RPPR=0;RUN=1;SAF=1;SAP=3.73412;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:110:-9.86084,-0.842352,0
+chr_1	4540	.	C	T	72.5101	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=37.6667;MQMR=0;NS=1;NUMALT=1;ODDS=7.23698;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=101;QR=0;RO=0;RPP=9.52472;RPPR=0;RUN=1;SAF=1;SAP=3.73412;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:101:-9.00573,-0.841952,0
+chr_1	4580	.	C	T	81.3345	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=9.52472;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=37.6667;MQMR=0;NS=1;NUMALT=1;ODDS=7.23817;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=119;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=1;SAP=3.73412;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:119:-9.88816,-0.842465,0
+chr_1	4611	.	C	G	51.9857	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=7.35324;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=41.5;MQMR=0;NS=1;NUMALT=1;ODDS=5.92133;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=69;QR=0;RO=0;RPP=3.0103;RPPR=0;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=2;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:69:-6.40152,-0.5716,0
+chr_1	4661	.	A	G	19.7502	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=35;MQMR=43;NS=1;NUMALT=1;ODDS=0.834078;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=76;QR=35;RO=1;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:35:2:76:-5.08162,0,-2.36476
+chr_1	4678	.	G	A	21.951	G_AF	AB=0.666667;ABP=3.73412;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=35;MQMR=43;NS=1;NUMALT=1;ODDS=0.136458;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=68;QR=41;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=A	GT:DP:RO:QR:AO:QA:GL	0/1:3:1:41:2:68:-4.94794,0,-2.78626
+chr_1	4686	.	C	T	81.6957	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=37.6667;MQMR=0;NS=1;NUMALT=1;ODDS=7.23731;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=110;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=2;SAP=3.73412;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:110:-9.44717,-0.842096,0
+chr_1	4699	.	G	A	103.379	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=3.0103;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=36.75;MQMR=0;NS=1;NUMALT=1;ODDS=8.55324;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=140;QR=0;RO=0;RPP=5.18177;RPPR=0;RUN=1;SAF=3;SAP=5.18177;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=4;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:140:-10,-1.11256,0
+chr_1	4717	.	C	T	18.6085	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=35;MQMR=34;NS=1;NUMALT=1;ODDS=1.12012;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=66;QR=40;RO=1;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=1;SRP=5.18177;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.67;G_DP=3;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:40:2:66:-4.87583,0,-2.24054
+chr_1	4727	.	G	A	43.4619	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=3.0103;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=32;MQMR=0;NS=1;NUMALT=1;ODDS=5.91984;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=66;QR=0;RO=0;RPP=3.0103;RPPR=0;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=2;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:66:-5.54913,-0.570955,0
+chr_1	4747	.	C	T	40.3421	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=7.35324;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=34;MQMR=0;NS=1;NUMALT=1;ODDS=5.92045;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=68;QR=0;RO=0;RPP=7.35324;RPPR=0;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=2;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:68:-5.83919,-0.571218,0
+chr_1	3305168	.	T	A,G	280.615	G_AF;G_DP	AB=0.75,0.25;ABP=9.52472,9.52472;AC=1,1;AF=0.5,0.5;AN=2;AO=9,3;CIGAR=1X,1X;DP=12;DPB=12;DPRA=0,0;EPP=9.04217,3.73412;EPPR=0;GTI=0;LEN=1,1;MEANALT=2,2;MQM=60,60;MQMR=0;NS=1;NUMALT=2;ODDS=4.632;PAIRED=1,1;PAIREDR=0;PAO=0,0;PQA=0,0;PQR=0;PRO=0;QA=319,107;QR=0;RO=0;RPP=9.04217,9.52472;RPPR=0;RUN=1,1;SAF=4,2;SAP=3.25157,3.73412;SAR=5,1;SRF=0;SRP=0;SRR=0;TYPE=snp,snp;technology.illumina=1,1;G_AN=2;G_AF=0.75;G_DP=12;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/2:12:0:0:9,3:319,107:-10,-8.89435,-6.43456,-10,0,-10
+chr_1	3305169	.	T	A,G	280.615	G_AF;G_DP	AB=0.25,0.75;ABP=9.52472,9.52472;AC=1,1;AF=0.5,0.5;AN=2;AO=9,3;CIGAR=1X,1X;DP=12;DPB=12;DPRA=0,0;EPP=9.04217,3.73412;EPPR=0;GTI=0;LEN=1,1;MEANALT=2,2;MQM=60,60;MQMR=0;NS=1;NUMALT=2;ODDS=4.632;PAIRED=1,1;PAIREDR=0;PAO=0,0;PQA=0,0;PQR=0;PRO=0;QA=319,107;QR=0;RO=0;RPP=9.04217,9.52472;RPPR=0;RUN=1,1;SAF=4,2;SAP=3.25157,3.73412;SAR=5,1;SRF=0;SRP=0;SRR=0;TYPE=snp,snp;technology.illumina=1,1;G_AN=2;G_AF=0.75;G_DP=12;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/2:12:0:0:9,3:319,107:-10,-8.89435,-6.43456,-10,0,-10
diff -r 000000000000 -r 3552a8d9f51c test-data/VCFFiltering_input.vcf
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/VCFFiltering_input.vcf	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,100 @@
+##fileformat=VCFv4.1
+##fileDate=20140725
+##source=freeBayes v0.9.13-2-ga830efd
+##phasing=none
+##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of samples with data">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total read depth at the locus">
+##INFO=<ID=DPB,Number=1,Type=Float,Description="Total read depth per bp at the locus; bases in reads overlapping / bases in haplotype">
+##INFO=<ID=AC,Number=A,Type=Integer,Description="Total number of alternate alleles in called genotypes">
+##INFO=<ID=AN,Number=1,Type=Integer,Description="Total number of alleles in called genotypes">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Estimated allele frequency in the range (0,1]">
+##INFO=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count, with partial observations recorded fractionally">
+##INFO=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observations, with partial observations recorded fractionally">
+##INFO=<ID=PRO,Number=1,Type=Float,Description="Reference allele observation count, with partial observations recorded fractionally">
+##INFO=<ID=PAO,Number=A,Type=Float,Description="Alternate allele observations, with partial observations recorded fractionally">
+##INFO=<ID=QR,Number=1,Type=Integer,Description="Reference allele quality sum in phred">
+##INFO=<ID=QA,Number=A,Type=Integer,Description="Alternate allele quality sum in phred">
+##INFO=<ID=PQR,Number=1,Type=Float,Description="Reference allele quality sum in phred for partial observations">
+##INFO=<ID=PQA,Number=A,Type=Float,Description="Alternate allele quality sum in phred for partial observations">
+##INFO=<ID=SRF,Number=1,Type=Integer,Description="Number of reference observations on the forward strand">
+##INFO=<ID=SRR,Number=1,Type=Integer,Description="Number of reference observations on the reverse strand">
+##INFO=<ID=SAF,Number=A,Type=Integer,Description="Number of alternate observations on the forward strand">
+##INFO=<ID=SAR,Number=A,Type=Integer,Description="Number of alternate observations on the reverse strand">
+##INFO=<ID=SRP,Number=1,Type=Float,Description="Strand balance probability for the reference allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SRF and SRR given E(SRF/SRR) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=SAP,Number=A,Type=Float,Description="Strand balance probability for the alternate allele: Phred-scaled upper-bounds estimate of the probability of observing the deviation between SAF and SAR given E(SAF/SAR) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=AB,Number=A,Type=Float,Description="Allele balance at heterozygous sites: a number between 0 and 1 representing the ratio of reads showing the reference allele to all reads, considering only reads from individuals called as heterozygous">
+##INFO=<ID=ABP,Number=A,Type=Float,Description="Allele balance probability at heterozygous sites: Phred-scaled upper-bounds estimate of the probability of observing the deviation between ABR and ABA given E(ABR/ABA) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=RUN,Number=A,Type=Integer,Description="Run length: the number of consecutive repeats of the alternate allele in the reference genome">
+##INFO=<ID=RPP,Number=A,Type=Float,Description="Read Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=RPPR,Number=1,Type=Float,Description="Read Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between RPL and RPR given E(RPL/RPR) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=EPP,Number=A,Type=Float,Description="End Placement Probability: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=EPPR,Number=1,Type=Float,Description="End Placement Probability for reference observations: Phred-scaled upper-bounds estimate of the probability of observing the deviation between EL and ER given E(EL/ER) ~ 0.5, derived using Hoeffding's inequality">
+##INFO=<ID=DPRA,Number=A,Type=Float,Description="Alternate allele depth ratio.  Ratio between depth in samples with each called alternate allele and those without.">
+##INFO=<ID=ODDS,Number=1,Type=Float,Description="The log odds ratio of the best genotype combination to the second-best.">
+##INFO=<ID=GTI,Number=1,Type=Integer,Description="Number of genotyping iterations required to reach convergence or bailout.">
+##INFO=<ID=TYPE,Number=A,Type=String,Description="The type of allele, either snp, mnp, ins, del, or complex.">
+##INFO=<ID=CIGAR,Number=A,Type=String,Description="The extended CIGAR representation of each alternate allele, with the exception that '=' is replaced by 'M' to ease VCF parsing.  Note that INDEL alleles do not have the first matched base (which is provided by default, per the spec) referred to by the CIGAR.">
+##INFO=<ID=NUMALT,Number=1,Type=Integer,Description="Number of unique non-reference alleles in called genotypes at this position.">
+##INFO=<ID=MEANALT,Number=A,Type=Float,Description="Mean number of unique non-reference allele observations per sample with the corresponding alternate alleles.">
+##INFO=<ID=LEN,Number=A,Type=Integer,Description="allele length">
+##INFO=<ID=MQM,Number=A,Type=Float,Description="Mean mapping quality of observed alternate alleles">
+##INFO=<ID=MQMR,Number=1,Type=Float,Description="Mean mapping quality of observed reference alleles">
+##INFO=<ID=PAIRED,Number=A,Type=Float,Description="Proportion of observed alternate alleles which are supported by properly paired read fragments">
+##INFO=<ID=PAIREDR,Number=1,Type=Float,Description="Proportion of observed reference alleles which are supported by properly paired read fragments">
+##INFO=<ID=technology.illumina,Number=A,Type=Float,Description="Fraction of observations supporting the alternate observed in reads from illumina">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##FORMAT=<ID=GQ,Number=1,Type=Float,Description="Genotype Quality, the Phred-scaled marginal (or unconditional) probability of the called genotype">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood, log10-scaled likelihoods of the data given the called genotype for each possible genotype generated from the reference and alternate alleles given the sample ploidy">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=RO,Number=1,Type=Integer,Description="Reference allele observation count">
+##FORMAT=<ID=QR,Number=1,Type=Integer,Description="Sum of quality of the reference observations">
+##FORMAT=<ID=AO,Number=A,Type=Integer,Description="Alternate allele observation count">
+##FORMAT=<ID=QA,Number=A,Type=Integer,Description="Sum of quality of the alternate observations">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	G15_myco
+chr_1	235	.	C	T	21.392	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=30;MQMR=42;NS=1;NUMALT=1;ODDS=0.865778;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=77;QR=35;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:35:2:77:-4.63556,0,-2.351
+chr_1	244	.	C	T	21.1881	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=30;MQMR=42;NS=1;NUMALT=1;ODDS=0.865718;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=76;QR=35;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:35:2:76:-4.61503,0,-2.35102
+chr_1	253	.	T	C	73.475	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=34;MQMR=0;NS=1;NUMALT=1;ODDS=7.23646;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=110;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=2;SAP=3.73412;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:110:-8.62509,-0.841726,0
+chr_1	333	.	G	A	24.2337	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=30;MQMR=42;NS=1;NUMALT=1;ODDS=3.07477;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=82;QR=24;RO=1;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=5.18177;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:24:2:82:-4.69685,0,-1.39164
+chr_1	354	.	G	A	20.5104	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=30;MQMR=42;NS=1;NUMALT=1;ODDS=2.23682;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=78;QR=28;RO=1;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=5.18177;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:28:2:78:-4.66174,0,-1.75556
+chr_1	363	.	G	A	40.3032	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=3.0103;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=36;MQMR=0;NS=1;NUMALT=1;ODDS=5.91856;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=63;QR=0;RO=0;RPP=7.35324;RPPR=0;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:63:-5.23324,-0.570398,0
+chr_1	1531	.	G	A	73.2764	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=35;MQMR=0;NS=1;NUMALT=1;ODDS=7.23732;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=115;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=3;SAP=9.52472;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:115:-9.08235,-0.842098,0
+chr_1	1565	.	A	G	14.5726	.	AB=0.5;ABP=3.0103;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=7.35324;EPPR=7.35324;GTI=0;LEN=1;MEANALT=1;MQM=38;MQMR=35;NS=1;NUMALT=1;ODDS=3.30493;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=71;QR=71;RO=2;RPP=7.35324;RPPR=3.0103;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=1;SRP=3.0103;SRR=1;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	0/1:4:2:71:2:71:-5.0654,0,-4.84835
+chr_1	1589	.	A	G	102.964	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=5.18177;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=36.5;MQMR=0;NS=1;NUMALT=1;ODDS=8.55461;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=155;QR=0;RO=0;RPP=11.6962;RPPR=0;RUN=1;SAF=1;SAP=5.18177;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:155:-10,-1.11316,0
+chr_1	1635	.	G	A	95.7333	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=5.18177;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=38.5;MQMR=0;NS=1;NUMALT=1;ODDS=8.55365;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=141;QR=0;RO=0;RPP=5.18177;RPPR=0;RUN=1;SAF=0;SAP=11.6962;SAR=4;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:141:-10,-1.11274,0
+chr_1	2624	.	C	T	122.967	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=5.18177;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=44.75;MQMR=0;NS=1;NUMALT=1;ODDS=8.5553;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=156;QR=0;RO=0;RPP=3.0103;RPPR=0;RUN=1;SAF=3;SAP=5.18177;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:156:-10,-1.11346,0
+chr_1	2670	.	C	T	30.7231	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=42.5;MQMR=36;NS=1;NUMALT=1;ODDS=0.739044;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=71;QR=41;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:41:2:71:-5.60946,0,-2.40604
+chr_1	2671	.	G	A	30.0349	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=42.5;MQMR=36;NS=1;NUMALT=1;ODDS=0.738983;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=70;QR=41;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:41:2:70:-5.5406,0,-2.40606
+chr_1	2686	.	A	G	28.1218	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=42.5;MQMR=36;NS=1;NUMALT=1;ODDS=0.861385;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=67;QR=39;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:39:2:67:-5.31237,0,-2.3529
+chr_1	2697	.	G	A	66.8365	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=9.52472;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=7.23789;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=104;QR=0;RO=0;RPP=9.52472;RPPR=0;RUN=1;SAF=0;SAP=9.52472;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:104:-9.39261,-0.842345,0
+chr_1	2699	.	G	A	75.6507	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=7.23781;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=103;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=0;SAP=9.52472;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:103:-9.31979,-0.842311,0
+chr_1	2747	.	C	T	52.6764	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=7.35324;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=5.92179;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=81;QR=0;RO=0;RPP=7.35324;RPPR=0;RUN=1;SAF=0;SAP=7.35324;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:81:-7.07265,-0.5718,0
+chr_1	3616	.	C	T	96.527	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=11.6962;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=8.55506;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=153;QR=0;RO=0;RPP=11.6962;RPPR=0;RUN=1;SAF=4;SAP=11.6962;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:153:-10,-1.11336,0
+chr_1	3624	.	A	G	99.7577	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=11.6962;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=8.55532;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=158;QR=0;RO=0;RPP=11.6962;RPPR=0;RUN=1;SAF=4;SAP=11.6962;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:158:-10,-1.11347,0
+chr_1	3630	.	G	A	119.888	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=13.8677;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=9.87182;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=191;QR=0;RO=0;RPP=13.8677;RPPR=0;RUN=1;SAF=5;SAP=13.8677;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:191:-10,-1.38419,0
+chr_1	3657	.	T	C	146.729	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.44459;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=9.87224;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=204;QR=0;RO=0;RPP=3.44459;RPPR=0;RUN=1;SAF=5;SAP=13.8677;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:204:-10,-1.38437,0
+chr_1	3681	.	C	T	141.607	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=6;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=8.80089;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=41.5;MQMR=0;NS=1;NUMALT=1;ODDS=11.1867;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=201;QR=0;RO=0;RPP=8.80089;RPPR=0;RUN=1;SAF=6;SAP=16.0391;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:6:0:0:6:201:-10,-1.65422,0
+chr_1	3746	.	G	A	143.027	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.44459;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=42.8;MQMR=0;NS=1;NUMALT=1;ODDS=9.87133;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=177;QR=0;RO=0;RPP=3.44459;RPPR=0;RUN=1;SAF=2;SAP=3.44459;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:177:-10,-1.38398,0
+chr_1	3766	.	TGG	TG	207.378	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=7;CIGAR=1M1D1M;DP=7;DPB=4.66667;DPRA=0;EPP=3.32051;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=41.8571;MQMR=0;NS=1;NUMALT=1;ODDS=12.5052;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=267;QR=0;RO=0;RPP=3.32051;RPPR=0;RUN=1;SAF=1;SAP=10.7656;SAR=6;SRF=0;SRP=0;SRR=0;TYPE=del;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:7:0:0:7:267:-10,-1.9258,0
+chr_1	3804	.	C	T	168.638	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=6;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=4.45795;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=42.1667;MQMR=0;NS=1;NUMALT=1;ODDS=11.188;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=213;QR=0;RO=0;RPP=3.0103;RPPR=0;RUN=1;SAF=1;SAP=8.80089;SAR=5;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:6:0:0:6:213:-10,-1.65476,0
+chr_1	3845	.	G	A	130.7	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=6.91895;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=41.8;MQMR=0;NS=1;NUMALT=1;ODDS=9.87163;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=184;QR=0;RO=0;RPP=13.8677;RPPR=0;RUN=1;SAF=1;SAP=6.91895;SAR=4;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:184:-10,-1.38411,0
+chr_1	3857	.	G	A	72.7109	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=9.52472;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=0;NS=1;NUMALT=1;ODDS=7.23836;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=113;QR=0;RO=0;RPP=9.52472;RPPR=0;RUN=1;SAF=0;SAP=9.52472;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:113:-9.98004,-0.84255,0
+chr_1	4299	.	C	T	48.7928	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=3.73412;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=37.6667;MQMR=48;NS=1;NUMALT=1;ODDS=2.04069;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=100;QR=34;RO=1;RPP=9.52472;RPPR=5.18177;RUN=1;SAF=2;SAP=3.73412;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:4:1:34:3:100:-7.69498,0,-2.01683
+chr_1	4311	.	A	G	138.174	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=6.91895;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40.2;MQMR=0;NS=1;NUMALT=1;ODDS=9.8711;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=179;QR=0;RO=0;RPP=3.44459;RPPR=0;RUN=1;SAF=3;SAP=3.44459;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:179:-10,-1.38387,0
+chr_1	4357	.	C	T	141.385	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=5;CIGAR=1X;DP=5;DPB=5;DPRA=0;EPP=3.44459;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=40.2;MQMR=0;NS=1;NUMALT=1;ODDS=9.87061;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=181;QR=0;RO=0;RPP=3.44459;RPPR=0;RUN=1;SAF=2;SAP=3.44459;SAR=3;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:5:0:0:5:181:-10,-1.38366,0
+chr_1	4372	.	C	T	57.8383	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=3.73412;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=40;MQMR=48;NS=1;NUMALT=1;ODDS=0.86483;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=110;QR=40;RO=1;RPP=3.73412;RPPR=5.18177;RUN=1;SAF=2;SAP=3.73412;SAR=1;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:4:1:40:3:110:-8.53351,0,-2.5275
+chr_1	4389	.	C	T	176.339	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=7;CIGAR=1X;DP=8;DPB=8;DPRA=0;EPP=5.80219;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=45.4286;MQMR=48;NS=1;NUMALT=1;ODDS=6.11702;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=247;QR=37;RO=1;RPP=3.32051;RPPR=5.18177;RUN=1;SAF=3;SAP=3.32051;SAR=4;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:8:1:37:7:247:-10,0,-1.14959
+chr_1	4398	.	T	C	197.868	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=7;CIGAR=1X;DP=7;DPB=7;DPRA=0;EPP=5.80219;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=45.4286;MQMR=0;NS=1;NUMALT=1;ODDS=12.5039;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=243;QR=0;RO=0;RPP=3.32051;RPPR=0;RUN=1;SAF=3;SAP=3.32051;SAR=4;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:7:0:0:7:243:-10,-1.92523,0
+chr_1	4404	.	T	C	168.543	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=6;CIGAR=1X;DP=6;DPB=6;DPRA=0;EPP=4.45795;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=46.3333;MQMR=0;NS=1;NUMALT=1;ODDS=11.1873;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=209;QR=0;RO=0;RPP=4.45795;RPPR=0;RUN=1;SAF=2;SAP=4.45795;SAR=4;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:6:0:0:6:209:-10,-1.65448,0
+chr_1	4475	.	C	T	81.0612	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=47;MQMR=0;NS=1;NUMALT=1;ODDS=7.2379;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=110;QR=0;RO=0;RPP=9.52472;RPPR=0;RUN=1;SAF=1;SAP=3.73412;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:110:-9.86084,-0.842352,0
+chr_1	4540	.	C	T	72.5101	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=37.6667;MQMR=0;NS=1;NUMALT=1;ODDS=7.23698;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=101;QR=0;RO=0;RPP=9.52472;RPPR=0;RUN=1;SAF=1;SAP=3.73412;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:101:-9.00573,-0.841952,0
+chr_1	4580	.	C	T	81.3345	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=9.52472;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=37.6667;MQMR=0;NS=1;NUMALT=1;ODDS=7.23817;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=119;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=1;SAP=3.73412;SAR=2;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:119:-9.88816,-0.842465,0
+chr_1	4611	.	C	G	51.9857	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=7.35324;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=41.5;MQMR=0;NS=1;NUMALT=1;ODDS=5.92133;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=69;QR=0;RO=0;RPP=3.0103;RPPR=0;RUN=1;SAF=1;SAP=3.0103;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:69:-6.40152,-0.5716,0
+chr_1	4661	.	A	G	19.7502	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=35;MQMR=43;NS=1;NUMALT=1;ODDS=0.834078;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=76;QR=35;RO=1;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:35:2:76:-5.08162,0,-2.36476
+chr_1	4678	.	G	A	21.951	.	AB=0.666667;ABP=3.73412;AC=1;AF=0.5;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.0103;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=35;MQMR=43;NS=1;NUMALT=1;ODDS=0.136458;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=68;QR=41;RO=1;RPP=3.0103;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=5.18177;SRR=1;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	0/1:3:1:41:2:68:-4.94794,0,-2.78626
+chr_1	4686	.	C	T	81.6957	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=3;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=3.73412;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=37.6667;MQMR=0;NS=1;NUMALT=1;ODDS=7.23731;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=110;QR=0;RO=0;RPP=3.73412;RPPR=0;RUN=1;SAF=2;SAP=3.73412;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:0:0:3:110:-9.44717,-0.842096,0
+chr_1	4699	.	G	A	103.379	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=4;CIGAR=1X;DP=4;DPB=4;DPRA=0;EPP=3.0103;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=36.75;MQMR=0;NS=1;NUMALT=1;ODDS=8.55324;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=140;QR=0;RO=0;RPP=5.18177;RPPR=0;RUN=1;SAF=3;SAP=5.18177;SAR=1;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:4:0:0:4:140:-10,-1.11256,0
+chr_1	4717	.	C	T	18.6085	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=3;DPB=3;DPRA=0;EPP=7.35324;EPPR=5.18177;GTI=0;LEN=1;MEANALT=1;MQM=35;MQMR=34;NS=1;NUMALT=1;ODDS=1.12012;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=66;QR=40;RO=1;RPP=7.35324;RPPR=5.18177;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=1;SRP=5.18177;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:3:1:40:2:66:-4.87583,0,-2.24054
+chr_1	4727	.	G	A	43.4619	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=3.0103;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=32;MQMR=0;NS=1;NUMALT=1;ODDS=5.91984;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=66;QR=0;RO=0;RPP=3.0103;RPPR=0;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:66:-5.54913,-0.570955,0
+chr_1	4747	.	C	T	40.3421	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=2;CIGAR=1X;DP=2;DPB=2;DPRA=0;EPP=7.35324;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=34;MQMR=0;NS=1;NUMALT=1;ODDS=5.92045;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=68;QR=0;RO=0;RPP=7.35324;RPPR=0;RUN=1;SAF=2;SAP=7.35324;SAR=0;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1	GT:DP:RO:QR:AO:QA:GL	1/1:2:0:0:2:68:-5.83919,-0.571218,0
+chr_1	3305168	.	T	A,G	280.615	.	AB=0.75,0.25;ABP=9.52472,9.52472;AC=1,1;AF=0.5,0.5;AN=2;AO=9,3;CIGAR=1X,1X;DP=12;DPB=12;DPRA=0,0;EPP=9.04217,3.73412;EPPR=0;GTI=0;LEN=1,1;MEANALT=2,2;MQM=60,60;MQMR=0;NS=1;NUMALT=2;ODDS=4.632;PAIRED=1,1;PAIREDR=0;PAO=0,0;PQA=0,0;PQR=0;PRO=0;QA=319,107;QR=0;RO=0;RPP=9.04217,9.52472;RPPR=0;RUN=1,1;SAF=4,2;SAP=3.25157,3.73412;SAR=5,1;SRF=0;SRP=0;SRR=0;TYPE=snp,snp;technology.illumina=1,1	GT:DP:RO:QR:AO:QA:GL	1/2:12:0:0:9,3:319,107:-10,-8.89435,-6.43456,-10,0,-10
+chr_1	3305169	.	T	A,G	280.615	.	AB=0.25,0.75;ABP=9.52472,9.52472;AC=1,1;AF=0.5,0.5;AN=2;AO=9,3;CIGAR=1X,1X;DP=12;DPB=12;DPRA=0,0;EPP=9.04217,3.73412;EPPR=0;GTI=0;LEN=1,1;MEANALT=2,2;MQM=60,60;MQMR=0;NS=1;NUMALT=2;ODDS=4.632;PAIRED=1,1;PAIREDR=0;PAO=0,0;PQA=0,0;PQR=0;PRO=0;QA=319,107;QR=0;RO=0;RPP=9.04217,9.52472;RPPR=0;RUN=1,1;SAF=4,2;SAP=3.25157,3.73412;SAR=5,1;SRF=0;SRP=0;SRR=0;TYPE=snp,snp;technology.illumina=1,1	GT:DP:RO:QR:AO:QA:GL	1/2:12:0:0:9,3:319,107:-10,-8.89435,-6.43456,-10,0,-10
diff -r 000000000000 -r 3552a8d9f51c test-data/chr17.VCF
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/chr17.VCF	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,21 @@
+##fileformat=VCFv4.1
+##fileDate=20140725
+##source=freeBayes v0.9.13-2-ga830efd
+##reference=exmple.fsa
+##phasing=none
+##DetectedFormat=freebayes
+##FILTER=<ID=G_AN,Description="The SNP has been filtered ; out of AN range(over 2)">
+##FILTER=<ID=G_AF,Description="The SNP has been filtered ; out of AF range(under 0.9)">
+##FILTER=<ID=G_DP,Description="The SNP has been filtered ; out of DP range(15 - 35)">
+##FILTER=<ID=InDel,Description="The SNP has been filtered ; InDel detected">
+##FILTER=<ID=Nmatch,Description="The SNP has been filtered ; reference base detected : N">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	V1
+chr_17	17	.	A	G	529.213	G_AF;G_DP	AB=0.583333;ABP=5.18177;AC=1;AF=0.5;AN=2;AO=21;CIGAR=1X;DP=36;DPB=36;DPRA=0;EPP=3.1137;EPPR=3.15506;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=60;NS=1;NUMALT=1;ODDS=77.012;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=751;QR=535;RO=15;RPP=5.59539;RPPR=4.31318;RUN=1;SAF=11;SAP=3.1137;SAR=10;SRF=5;SRP=6.62942;SRR=10;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.58;G_DP=36;G_Base=G	GT:DP:RO:QR:AO:QA:GL	0/1:36:15:535:21:751:-10,0,-10
+chr_17	37	.	C	G	1082.38	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=34;CIGAR=1X;DP=34;DPB=34;DPRA=0;EPP=3.26577;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=48.0391;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=1243;QR=0;RO=0;RPP=15.5282;RPPR=0;RUN=1;SAF=18;SAP=3.26577;SAR=16;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=34;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:34:0:0:34:1243:-10,-9.23017,0
+chr_17	40	.	T	T	825.518	G_AF	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=29;CIGAR=1X;DP=34;DPB=34;DPRA=0;EPP=6.67934;EPPR=13.8677;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=60;NS=1;NUMALT=1;ODDS=8.92992;PAIRED=1;PAIREDR=1;PAO=0;PQA=0;PQR=0;PRO=0;QA=1082;QR=178;RO=5;RPP=9.07545;RPPR=13.8677;RUN=1;SAF=13;SAP=3.68421;SAR=16;SRF=5;SRP=13.8677;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=0.85;G_DP=34;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:34:5:178:29:1082:-10,0,-6.82575
+chr_17	60	.	A	.	699.741	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=22;CIGAR=1X;DP=22;DPB=22;DPRA=0;EPP=17.2236;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=32.2544;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=823;QR=0;RO=0;RPP=9.32731;RPPR=0;RUN=1;SAF=12;SAP=3.40511;SAR=10;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=22;G_Base=G	GT:DP:RO:QR:AO:QA:GL	1/1:22:0:0:22:823:-10,-5.98732,0
+chr_17	73	.	T	.	846.299	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=27;CIGAR=1X;DP=27;DPB=27;DPRA=0;EPP=16.6021;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=38.84;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=1002;QR=0;RO=0;RPP=5.02092;RPPR=0;RUN=1;SAF=21;SAP=21.1059;SAR=6;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=27;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:27:0:0:27:1002:-10,-7.34226,0
+chr_17	81	.	C	T	764.464	.	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=25;CIGAR=1X;DP=25;DPB=25;DPRA=0;EPP=13.5202;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=36.1324;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=902;QR=0;RO=0;RPP=3.79203;RPPR=0;RUN=1;SAF=19;SAP=17.6895;SAR=6;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=25;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:25:0:0:25:902:-10,-6.76842,0
+chr_17	105	.	C	T	1154	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=37;CIGAR=1X;DP=37;DPB=37;DPRA=0;EPP=5.88603;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=52.0047;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=1336;QR=0;RO=0;RPP=19.9713;RPPR=0;RUN=1;SAF=23;SAP=7.76406;SAR=14;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=37;G_Base=T	GT:DP:RO:QR:AO:QA:GL	1/1:37:0:0:37:1336:-10,-10,0
+chr_17	112	.	G	A	1276.25	G_DP	AB=0;ABP=0;AC=2;AF=1;AN=2;AO=40;CIGAR=1X;DP=40;DPB=40;DPRA=0;EPP=10.8276;EPPR=0;GTI=0;LEN=1;MEANALT=1;MQM=60;MQMR=0;NS=1;NUMALT=1;ODDS=55.9501;PAIRED=1;PAIREDR=0;PAO=0;PQA=0;PQR=0;PRO=0;QA=1471;QR=0;RO=0;RPP=10.8276;RPPR=0;RUN=1;SAF=26;SAP=10.8276;SAR=14;SRF=0;SRP=0;SRR=0;TYPE=snp;technology.illumina=1;G_AN=2;G_AF=1.00;G_DP=40;G_Base=A	GT:DP:RO:QR:AO:QA:GL	1/1:40:0:0:40:1471:-10,-10,0
+
diff -r 000000000000 -r 3552a8d9f51c test-data/chr17.fa
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/chr17.fa	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,3 @@
+>chr_17
+ccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaaccctaa
+TACGCGCGCGCCTAACCCTACGACTTTAACCTACTCTAAACTCTCCTACTAGTACGTCTT
diff -r 000000000000 -r 3552a8d9f51c tool_dependencies.xml
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tool_dependencies.xml	Tue Nov 10 08:30:56 2015 -0500
@@ -0,0 +1,19 @@
+<?xml version="1.0"?>
+<tool_dependency>
+	<package name="VCF_Gandalf_Tools" version="1.0">
+		<install version="1.0">
+			<actions>
+				<action type="download_by_url">http://10.0.0.108/VCFtools-1.2.tar.gz</action>
+				<action type="shell_command">python setup_VCFtools.py install</action>
+				<action type="move_directory_files">
+					<source_directory>.</source_directory>
+					<destination_directory>$INSTALL_DIR</destination_directory>
+				</action>
+				<action type="set_environment">
+					<environment_variable name="PYTHONPATH" action="prepend_to">$INSTALL_DIR</environment_variable>
+					<environment_variable name="PATH" action="prepend_to">$INSTALL_DIR/bin</environment_variable>
+				</action>
+			</actions>
+		</install>
+	</package>
+</tool_dependency>