diff tests/test_plot.py @ 0:ca58e9466cbf

First commit

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/tests/test_plot.py	Mon Jun 29 16:38:36 2015 +0100
@@ -0,0 +1,52 @@
+import os
+import logging
+import unittest
+
+from riboplot import core, config, plot
+
+# use testing configuration
+CONFIG = plot.CONFIG = config.TestingConfig()
+logging.disable(logging.CRITICAL)
+
+RIBO_FILE = os.path.join(CONFIG.DATA_DIR, '5hRPFsorted.bam')
+RNA_FILE = os.path.join(CONFIG.DATA_DIR, '5hmRNAsorted.bam')
+TRANSCRIPT_NAME = 'gi|148357119|ref|NM_001098396.1|'
+TRANSCRIPTOME_FASTA = os.path.join(CONFIG.DATA_DIR, 'zebrafish.fna')
+TRANSCRIPTOME_FASTA_MINUS1 = os.path.join(CONFIG.DATA_DIR, 'zebrafish_minus1.fna')
+
+class RNACountsTestCase(unittest.TestCase):
+
+    def test_get_rna_counts(self):
+        """Test get RNA counts for transcript from RNA-Seq BAM file"""
+        counts = plot.get_rna_counts(rna_file=RNA_FILE, transcript_name=TRANSCRIPT_NAME)
+        self.assertIsInstance(counts, dict)
+        self.assertTrue(len(counts) > 0)
+
+    def test_missing_rna_file(self):
+        """Exit with error if RNA BAM file does not exist. """
+        self.assertRaises(OSError, plot.get_rna_counts, rna_file='{}.absent'.format(RNA_FILE),
+                          transcript_name=TRANSCRIPT_NAME)
+
+    def test_missing_bedtools(self):
+        """Exit with error if bedtools is missing."""
+        # reset env temporarily
+        paths = os.environ['PATH']
+        os.environ['PATH'] = ''
+        self.assertRaises(OSError, plot.get_rna_counts, rna_file=RNA_FILE,
+                          transcript_name=TRANSCRIPT_NAME)
+        os.environ['PATH'] = paths
+
+
+class PlotTestCase(unittest.TestCase):
+
+    def test_get_codon_positions(self):
+        """Test get codon positions. """
+        # input is the sequence obtained from get_transcript so no new lines.
+        fasta = ('AACCGGAGCACCCAGAGAAAACCCACGCAAACGCAGGGAGAATTTGCAAACTCCACACA'
+                 'GAAATGCCAGCTGATCCAGCCGAGCCTCGAGTCAGCATCCTTGCTTGTTGGATGCCTGA'
+                 'TTGCAGTTCAACTCCAAACTCAGTTGGACCAGCTGATCAGTG')
+        codon_positions = plot.get_start_stops(fasta)
+        expected = {1: {'starts': [], 'stops': []},
+                    2: {'starts': [], 'stops': [71, 116, 152]},
+                    3: {'starts': [63, 111], 'stops': []}}
+        self.assertEqual(codon_positions, expected)
\ No newline at end of file