Mercurial > repos > vipints > fml_gff3togtf
changeset 9:7d67331368f3
fixing the new version upload manually
| author | vipints <vipin@cbio.mskcc.org> |
|---|---|
| date | Thu, 23 Apr 2015 17:57:49 -0400 |
| parents | d4f9b7beb52f |
| children | c42c69aa81f8 |
| files | GFFParser.py README bed_to_gff.py bed_to_gff.xml gbk_to_gff.py gbk_to_gff.xml gff_fmap.py gff_fmap.xml gff_to_bed.py gff_to_bed.xml gff_to_gbk.py gff_to_gbk.xml gff_to_gtf.py gff_to_gtf.xml gffparser_bcbio.py gtf_to_gff.py gtf_to_gff.xml helper.py test-data/CCDS30770.bed test-data/CCDS30770.gff test-data/MB7_3R.bed test-data/MB7_3R.gff3 test-data/aceview_hs_37.gff3 test-data/aceview_hs_37.gtf test-data/ens_mm9_chr18.gff3 test-data/ens_mm9_chr18.gtf test-data/gencode_ens_hav.gtf test-data/s_cerevisiae_SCU49845.gff test-data/s_cerevisiae_SCU49845.gff3 test-data/single_parent_feature_record.gff3 tool_conf.xml.sample |
| diffstat | 31 files changed, 13963 insertions(+), 3173 deletions(-) [+] |
line wrap: on
line diff
--- a/GFFParser.py Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,495 +0,0 @@ -#!/usr/bin/env python -""" -Extract genome annotation from a GFF (a tab delimited format for storing sequence features and annotations) file. - -Requirements: - Numpy :- http://numpy.org/ - Scipy :- http://scipy.org/ - -Copyright (C) - -2009-2012 Friedrich Miescher Laboratory of the Max Planck Society, Tubingen, Germany. -2012-2014 Memorial Sloan Kettering Cancer Center, New York City, USA. -""" - -import re -import os -import sys -import urllib -import numpy as np -import scipy.io as sio -from collections import defaultdict -import helper as utils - -def attribute_tags(col9): - """ - Split the key-value tags from the attribute column, it takes column number 9 from GTF/GFF file - - @args col9: attribute column from GFF file - @type col9: str - """ - info = defaultdict(list) - is_gff = False - - if not col9: - return is_gff, info - - # trim the line ending semi-colon ucsc may have some white-space - col9 = col9.rstrip(';| ') - # attributes from 9th column - atbs = col9.split(" ; ") - if len(atbs) == 1: - atbs = col9.split("; ") - if len(atbs) == 1: - atbs = col9.split(";") - # check the GFF3 pattern which has key value pairs like: - gff3_pat = re.compile("\w+=") - # sometime GTF have: gene_id uc002zkg.1; - gtf_pat = re.compile("\s?\w+\s") - - key_vals = [] - - if gff3_pat.match(atbs[0]): # gff3 pattern - is_gff = True - key_vals = [at.split('=') for at in atbs] - elif gtf_pat.match(atbs[0]): # gtf pattern - for at in atbs: - key_vals.append(at.strip().split(" ",1)) - else: - # to handle attribute column has only single value - key_vals.append(['ID', atbs[0]]) - # get key, val items - for item in key_vals: - key, val = item - # replace the double qoutes from feature identifier - val = re.sub('"', '', val) - # replace the web formating place holders to plain text format - info[key].extend([urllib.unquote(v) for v in val.split(',') if v]) - - return is_gff, info - -def spec_features_keywd(gff_parts): - """ - Specify the feature key word according to the GFF specifications - - @args gff_parts: attribute field key - @type gff_parts: str - """ - for t_id in ["transcript_id", "transcriptId", "proteinId"]: - try: - gff_parts["info"]["Parent"] = gff_parts["info"][t_id] - break - except KeyError: - pass - for g_id in ["gene_id", "geneid", "geneId", "name", "gene_name", "genename"]: - try: - gff_parts["info"]["GParent"] = gff_parts["info"][g_id] - break - except KeyError: - pass - ## TODO key words - for flat_name in ["Transcript", "CDS"]: - if gff_parts["info"].has_key(flat_name): - # parents - if gff_parts['type'] in [flat_name] or re.search(r'transcript', gff_parts['type'], re.IGNORECASE): - if not gff_parts['id']: - gff_parts['id'] = gff_parts['info'][flat_name][0] - #gff_parts["info"]["ID"] = [gff_parts["id"]] - # children - elif gff_parts["type"] in ["intron", "exon", "three_prime_UTR", - "coding_exon", "five_prime_UTR", "CDS", "stop_codon", - "start_codon"]: - gff_parts["info"]["Parent"] = gff_parts["info"][flat_name] - break - return gff_parts - -def Parse(ga_file): - """ - Parsing GFF/GTF file based on feature relationship, it takes the input file. - - @args ga_file: input file name - @type ga_file: str - """ - child_map = defaultdict(list) - parent_map = dict() - - ga_handle = utils.open_file(ga_file) - - for rec in ga_handle: - rec = rec.strip('\n\r') - - # skip empty line fasta identifier and commented line - if not rec or rec[0] in ['#', '>']: - continue - # skip the genome sequence - if not re.search('\t', rec): - continue - - parts = rec.split('\t') - assert len(parts) >= 8, rec - - # process the attribute column (9th column) - ftype, tags = attribute_tags(parts[-1]) - if not tags: # skip the line if no attribute column. - continue - - # extract fields - if parts[1]: - tags["source"] = parts[1] - if parts[7]: - tags["phase"] = parts[7] - - gff_info = dict() - gff_info['info'] = dict(tags) - gff_info["is_gff3"] = ftype - gff_info['chr'] = parts[0] - gff_info['score'] = parts[5] - - if parts[3] and parts[4]: - gff_info['location'] = [int(parts[3]) , - int(parts[4])] - gff_info['type'] = parts[2] - gff_info['id'] = tags.get('ID', [''])[0] - if parts[6] in ['?', '.']: - parts[6] = None - gff_info['strand'] = parts[6] - - # key word according to the GFF spec. - # is_gff3 flag is false check this condition and get the attribute fields - if not ftype: - gff_info = spec_features_keywd(gff_info) - - # link the feature relationships - if gff_info['info'].has_key('Parent'): - for p in gff_info['info']['Parent']: - if p == gff_info['id']: - gff_info['id'] = '' - break - rec_category = 'child' - elif gff_info['id']: - rec_category = 'parent' - else: - rec_category = 'record' - - # depends on the record category organize the features - if rec_category == 'child': - for p in gff_info['info']['Parent']: - # create the data structure based on source and feature id - child_map[(gff_info['chr'], gff_info['info']['source'], p)].append( - dict( type = gff_info['type'], - location = gff_info['location'], - strand = gff_info['strand'], - score = gff_info['score'], - ID = gff_info['id'], - gene_id = gff_info['info'].get('GParent', '') - )) - elif rec_category == 'parent': - parent_map[(gff_info['chr'], gff_info['info']['source'], gff_info['id'])] = dict( - type = gff_info['type'], - location = gff_info['location'], - strand = gff_info['strand'], - score = gff_info['score'], - name = tags.get('Name', [''])[0]) - elif rec_category == 'record': - #TODO how to handle plain records? - c = 1 - ga_handle.close() - - # depends on file type create parent feature - if not ftype: - parent_map, child_map = create_missing_feature_type(parent_map, child_map) - - # connecting parent child relations - # essentially the parent child features are here from any type of GTF/GFF2/GFF3 file - gene_mat = format_gene_models(parent_map, child_map) - - return gene_mat - -def format_gene_models(parent_nf_map, child_nf_map): - """ - Genarate GeneObject based on the parsed file contents - - @args parent_nf_map: parent features with source and chromosome information - @type parent_nf_map: collections defaultdict - @args child_nf_map: transctipt and exon information are encoded - @type child_nf_map: collections defaultdict - """ - - g_cnt = 0 - gene = np.zeros((len(parent_nf_map),), dtype = utils.init_gene()) - - for pkey, pdet in parent_nf_map.items(): - # considering only gene features - #if not re.search(r'gene', pdet.get('type', '')): - # continue - - # infer the gene start and stop if not there in the - if not pdet.get('location', []): - GNS, GNE = [], [] - # multiple number of transcripts - for L1 in child_nf_map[pkey]: - GNS.append(L1.get('location', [])[0]) - GNE.append(L1.get('location', [])[1]) - GNS.sort() - GNE.sort() - pdet['location'] = [GNS[0], GNE[-1]] - - orient = pdet.get('strand', '') - gene[g_cnt]['id'] = g_cnt +1 - gene[g_cnt]['chr'] = pkey[0] - gene[g_cnt]['source'] = pkey[1] - gene[g_cnt]['name'] = pkey[-1] - gene[g_cnt]['start'] = pdet.get('location', [])[0] - gene[g_cnt]['stop'] = pdet.get('location', [])[1] - gene[g_cnt]['strand'] = orient - gene[g_cnt]['score'] = pdet.get('score','') - - # default value - gene[g_cnt]['is_alt_spliced'] = gene[g_cnt]['is_alt'] = 0 - if len(child_nf_map[pkey]) > 1: - gene[g_cnt]['is_alt_spliced'] = gene[g_cnt]['is_alt'] = 1 - - # complete sub-feature for all transcripts - dim = len(child_nf_map[pkey]) - TRS = np.zeros((dim,), dtype=np.object) - TR_TYP = np.zeros((dim,), dtype=np.object) - EXON = np.zeros((dim,), dtype=np.object) - UTR5 = np.zeros((dim,), dtype=np.object) - UTR3 = np.zeros((dim,), dtype=np.object) - CDS = np.zeros((dim,), dtype=np.object) - TISc = np.zeros((dim,), dtype=np.object) - TSSc = np.zeros((dim,), dtype=np.object) - CLV = np.zeros((dim,), dtype=np.object) - CSTOP = np.zeros((dim,), dtype=np.object) - TSTAT = np.zeros((dim,), dtype=np.object) - - # fetching corresponding transcripts - for xq, Lv1 in enumerate(child_nf_map[pkey]): - - TID = Lv1.get('ID', '') - TRS[xq]= np.array([TID]) - - TYPE = Lv1.get('type', '') - TR_TYP[xq] = np.array('') - TR_TYP[xq] = np.array(TYPE) if TYPE else TR_TYP[xq] - - orient = Lv1.get('strand', '') - - # fetching different sub-features - child_feat = defaultdict(list) - for Lv2 in child_nf_map[(pkey[0], pkey[1], TID)]: - E_TYP = Lv2.get('type', '') - child_feat[E_TYP].append(Lv2.get('location')) - - # make general ascending order of coordinates - if orient == '-': - for etype, excod in child_feat.items(): - if len(excod) > 1: - if excod[0][0] > excod[-1][0]: - excod.reverse() - child_feat[etype] = excod - - # make exon coordinate from cds and utr regions - if not child_feat.get('exon'): - if child_feat.get('CDS'): - exon_cod = utils.make_Exon_cod( orient, - NonetoemptyList(child_feat.get('five_prime_UTR')), - NonetoemptyList(child_feat.get('CDS')), - NonetoemptyList(child_feat.get('three_prime_UTR'))) - child_feat['exon'] = exon_cod - else: - # TODO only UTR's - # searching through keys to find a pattern describing exon feature - ex_key_pattern = [k for k in child_feat if k.endswith("exon")] - if ex_key_pattern: - child_feat['exon'] = child_feat[ex_key_pattern[0]] - - # stop_codon are seperated from CDS, add the coordinates based on strand - if child_feat.get('stop_codon'): - if orient == '+': - if child_feat.get('stop_codon')[0][0] - child_feat.get('CDS')[-1][1] == 1: - child_feat['CDS'][-1] = [child_feat.get('CDS')[-1][0], child_feat.get('stop_codon')[0][1]] - else: - child_feat['CDS'].append(child_feat.get('stop_codon')[0]) - elif orient == '-': - if child_feat.get('CDS')[0][0] - child_feat.get('stop_codon')[0][1] == 1: - child_feat['CDS'][0] = [child_feat.get('stop_codon')[0][0], child_feat.get('CDS')[0][1]] - else: - child_feat['CDS'].insert(0, child_feat.get('stop_codon')[0]) - - # transcript signal sites - TIS, cdsStop, TSS, cleave = [], [], [], [] - cds_status, exon_status, utr_status = 0, 0, 0 - - if child_feat.get('exon'): - TSS = [child_feat.get('exon')[-1][1]] - TSS = [child_feat.get('exon')[0][0]] if orient == '+' else TSS - cleave = [child_feat.get('exon')[0][0]] - cleave = [child_feat.get('exon')[-1][1]] if orient == '+' else cleave - exon_status = 1 - - if child_feat.get('CDS'): - if orient == '+': - TIS = [child_feat.get('CDS')[0][0]] - cdsStop = [child_feat.get('CDS')[-1][1]-3] - else: - TIS = [child_feat.get('CDS')[-1][1]] - cdsStop = [child_feat.get('CDS')[0][0]+3] - cds_status = 1 - # cds phase calculation - child_feat['CDS'] = utils.add_CDS_phase(orient, child_feat.get('CDS')) - - # sub-feature status - if child_feat.get('three_prime_UTR') or child_feat.get('five_prime_UTR'): - utr_status =1 - - if utr_status == cds_status == exon_status == 1: - t_status = 1 - else: - t_status = 0 - - # add sub-feature # make array for export to different out - TSTAT[xq] = t_status - EXON[xq] = np.array(child_feat.get('exon'), np.float64) - UTR5[xq] = np.array(NonetoemptyList(child_feat.get('five_prime_UTR'))) - UTR3[xq] = np.array(NonetoemptyList(child_feat.get('three_prime_UTR'))) - CDS[xq] = np.array(NonetoemptyList(child_feat.get('CDS'))) - TISc[xq] = np.array(TIS) - CSTOP[xq] = np.array(cdsStop) - TSSc[xq] = np.array(TSS) - CLV[xq] = np.array(cleave) - - # add sub-features to the parent gene feature - gene[g_cnt]['transcript_status'] = TSTAT - gene[g_cnt]['transcripts'] = TRS - gene[g_cnt]['exons'] = EXON - gene[g_cnt]['utr5_exons'] = UTR5 - gene[g_cnt]['cds_exons'] = CDS - gene[g_cnt]['utr3_exons'] = UTR3 - gene[g_cnt]['transcript_type'] = TR_TYP - gene[g_cnt]['tis'] = TISc - gene[g_cnt]['cdsStop'] = CSTOP - gene[g_cnt]['tss'] = TSSc - gene[g_cnt]['cleave'] = CLV - - gene[g_cnt]['gene_info'] = dict( ID = pkey[-1], - Name = pdet.get('name'), - Source = pkey[1]) - # few empty fields // TODO fill this: - gene[g_cnt]['anno_id'] = [] - gene[g_cnt]['confgenes_id'] = [] - gene[g_cnt]['alias'] = '' - gene[g_cnt]['name2'] = [] - gene[g_cnt]['chr_num'] = [] - gene[g_cnt]['paralogs'] = [] - gene[g_cnt]['transcript_info'] = [] - gene[g_cnt]['transcript_valid'] = [] - gene[g_cnt]['exons_confirmed'] = [] - gene[g_cnt]['tis_conf'] = [] - gene[g_cnt]['tis_info'] = [] - gene[g_cnt]['cdsStop_conf'] = [] - gene[g_cnt]['cdsStop_info'] = [] - gene[g_cnt]['tss_info'] = [] - gene[g_cnt]['tss_conf'] = [] - gene[g_cnt]['cleave_info'] = [] - gene[g_cnt]['cleave_conf'] = [] - gene[g_cnt]['polya_info'] = [] - gene[g_cnt]['polya_conf'] = [] - gene[g_cnt]['is_valid'] = [] - gene[g_cnt]['transcript_complete'] = [] - gene[g_cnt]['is_complete'] = [] - gene[g_cnt]['is_correctly_gff3_referenced'] = '' - gene[g_cnt]['splicegraph'] = [] - g_cnt += 1 - - ## deleting empty gene records from the main array - XPFLG=0 - for XP, ens in enumerate(gene): - if ens[0]==0: - XPFLG=1 - break - - if XPFLG==1: - XQC = range(XP, len(gene)+1) - gene = np.delete(gene, XQC) - - return gene - -def NonetoemptyList(XS): - """ - Convert a None type to empty list - - @args XS: None type - @type XS: str - """ - return [] if XS is None else XS - -def create_missing_feature_type(p_feat, c_feat): - """ - GFF/GTF file defines only child features. This function tries to create - the parent feature from the information provided in the attribute column. - - example: - chr21 hg19_knownGene exon 9690071 9690100 0.000000 + . gene_id "uc002zkg.1"; transcript_id "uc002zkg.1"; - chr21 hg19_knownGene exon 9692178 9692207 0.000000 + . gene_id "uc021wgt.1"; transcript_id "uc021wgt.1"; - chr21 hg19_knownGene exon 9711935 9712038 0.000000 + . gene_id "uc011abu.2"; transcript_id "uc011abu.2"; - - This function gets the parsed feature annotations. - - @args p_feat: Parent feature map - @type p_feat: collections defaultdict - @args c_feat: Child feature map - @type c_feat: collections defaultdict - """ - - child_n_map = defaultdict(list) - for fid, det in c_feat.items(): - # get the details from grand child - GID = STRD = SCR = None - SPOS, EPOS = [], [] - TYP = dict() - for gchild in det: - GID = gchild.get('gene_id', [''])[0] - SPOS.append(gchild.get('location', [])[0]) - EPOS.append(gchild.get('location', [])[1]) - STRD = gchild.get('strand', '') - SCR = gchild.get('score', '') - if gchild.get('type', '') == "gene": ## gencode GTF file has this problem - continue - TYP[gchild.get('type', '')] = 1 - SPOS.sort() - EPOS.sort() - - # infer transcript type - transcript_type = 'transcript' - transcript_type = 'mRNA' if TYP.get('CDS', '') or TYP.get('cds', '') else transcript_type - - # gene id and transcript id are same - transcript_id = fid[-1] - if GID == transcript_id: - transcript_id = 'Transcript:' + str(GID) - - # level -1 feature type - p_feat[(fid[0], fid[1], GID)] = dict( type = 'gene', - location = [], ## infer location based on multiple transcripts - strand = STRD, - name = GID ) - # level -2 feature type - child_n_map[(fid[0], fid[1], GID)].append( - dict( type = transcript_type, - location = [SPOS[0], EPOS[-1]], - strand = STRD, - score = SCR, - ID = transcript_id, - gene_id = '' )) - # reorganizing the grand child - for gchild in det: - child_n_map[(fid[0], fid[1], transcript_id)].append( - dict( type = gchild.get('type', ''), - location = gchild.get('location'), - strand = gchild.get('strand'), - ID = gchild.get('ID'), - score = gchild.get('score'), - gene_id = '' )) - return p_feat, child_n_map -
--- a/README Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,61 +0,0 @@ -A collection of tools for converting genome annotation between GTF (Gene Transfer Format), -BED (Browser Extensible Data) and GFF (Generic Feature Format). - -INTRODUCTION - -Several genome annotation centers provide their data in GTF, BED, GFF3 etc. I have few programs -they mainly deals with converting between GTF, BED and GFF3 formats. They are extensively tested -with files from different centers like ENSEMBL, UCSC, JGI and NCBI AceView. Please follow the -instructions below to clone these tools into your galaxy instance. - -CONTENTS - -Tool configuration files in *.xml format. - - gtf_to_gff.xml - gff_to_gtf.xml - bed_to_gff.xml - gff_to_bed.xml - gbk_to_gff.xml - gff_fmap.xml - -Python based scripts. - - gtf_to_gff.py: convert data from GTF to valid GFF3. - gff_to_gtf.py: convert data from GFF3 to GTF. - bed_to_gff.py: convert data from a 12 column UCSC wiggle BED format to GFF3. - gff_to_bed.py: convert gene transcript annotation from GFF3 to UCSC wiggle 12 column BED format. - gbk_to_gff.py: convert data from genbank format to GFF. - gff_fmap.py: find the relation between different features described in a GFF file. - GFFParser.py: Parse GFF/GTF files. - helper.py: Utility functions. - -test-data: Test data set. (move to your galaxy_root_folder/test-data/) - - You may need to move the test files into your test-data directory so galaxy can find them. - If you want to run the functional tests eg as: - - exmaple: - sh run_functional_tests.sh -id fml_gtf2gff - -REQUIREMENTS - - python - -COMMENTS/QUESTIONS - -I can be reached at vipin [at] cbio.mskcc.org - -LICENSE - -Copyright (C) 2009-2012 Friedrich Miescher Laboratory of the Max Planck Society - 2013-2014 Memorial Sloan Kettering Cancer Center - -This program is free software; you can redistribute it and/or modify -it under the terms of the GNU General Public License as published by -the Free Software Foundation; either version 3 of the License, or -(at your option) any later version. - -COURTESY - -To the Galaxy Team.
--- a/bed_to_gff.py Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,70 +0,0 @@ -#!/usr/bin/env python -""" -Convert genome annotation data in a 12 column BED format to GFF3. - -Usage: python bed_to_gff.py in.bed > out.gff - -Requirement: - helper.py : https://github.com/vipints/GFFtools-GX/blob/master/helper.py - -Copyright (C) - 2009-2012 Friedrich Miescher Laboratory of the Max Planck Society, Tubingen, Germany. - 2012-2014 Memorial Sloan Kettering Cancer Center New York City, USA. -""" - -import re -import sys -import helper - -def __main__(): - """ - main function - """ - - try: - bed_fname = sys.argv[1] - except: - print __doc__ - sys.exit(-1) - - bed_fh = helper.open_file(bed_fname) - - for line in bed_fh: - line = line.strip( '\n\r' ) - - if not line or line[0] in ['#']: - continue - - parts = line.split('\t') - assert len(parts) >= 12, line - - rstarts = parts[-1].split(',') - rstarts.pop() if rstarts[-1] == '' else rstarts - - exon_lens = parts[-2].split(',') - exon_lens.pop() if exon_lens[-1] == '' else exon_lens - - if len(rstarts) != len(exon_lens): - continue # checking the consistency col 11 and col 12 - - if len(rstarts) != int(parts[-3]): - continue # checking the number of exons and block count are same - - if not parts[5] in ['+', '-']: - parts[5] = '.' # replace the unknown strand with '.' - - # bed2gff result line - print '%s\tbed2gff\tgene\t%d\t%s\t%s\t%s\t.\tID=Gene:%s;Name=Gene:%s' % (parts[0], int(parts[1])+1, parts[2], parts[4], parts[5], parts[3], parts[3]) - print '%s\tbed2gff\ttranscript\t%d\t%s\t%s\t%s\t.\tID=%s;Name=%s;Parent=Gene:%s' % (parts[0], int(parts[1])+1, parts[2], parts[4], parts[5], parts[3], parts[3], parts[3]) - - st = int(parts[1]) - for ex_cnt in range(int(parts[-3])): - start = st + int(rstarts[ex_cnt]) + 1 - stop = start + int(exon_lens[ex_cnt]) - 1 - print '%s\tbed2gff\texon\t%d\t%d\t%s\t%s\t.\tParent=%s' % (parts[0], start, stop, parts[4], parts[5], parts[3]) - - bed_fh.close() - - -if __name__ == "__main__": - __main__()
--- a/bed_to_gff.xml Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,89 +0,0 @@ -<tool id="fml_bed2gff" name="BED-to-GFF" version="2.0.0"> - <description>converter</description> - <command interpreter="python">bed_to_gff.py $inf_bed > $gff_format - </command> - <inputs> - <param format="bed" name="inf_bed" type="data" label="Convert this query" help="Provide genome annotation in 12 column BED format."/> - </inputs> - <outputs> - <data format="gff3" name="gff_format" label="${tool.name} on ${on_string}: Converted" /> - </outputs> - <tests> - <test> - <param name="inf_bed" value="ccds_genes.bed" /> - <output name="gff_format" file="ccds_genes.gff3" /> - </test> - <test> - <param name="inf_bed" value="hs_2009.bed" /> - <output name="gff_format" file="hs_2009.gff3" /> - </test> - </tests> - <help> - -**What it does** - -This tool converts data from a 12 column UCSC wiggle BED format to GFF3 (scroll down for format description). - --------- - -**Example** - -- The following data in UCSC Wiggle BED format:: - - chr1 11873 14409 uc001aaa.3 0 + 11873 11873 0 3 354,109,1189, 0,739,1347, - -- Will be converted to GFF3:: - - ##gff-version 3 - chr1 bed2gff gene 11874 14409 0 + . ID=Gene:uc001aaa.3;Name=Gene:uc001aaa.3 - chr1 bed2gff transcript 11874 14409 0 + . ID=uc001aaa.3;Name=uc001aaa.3;Parent=Gene:uc001aaa.3 - chr1 bed2gff exon 11874 12227 0 + . Parent=uc001aaa.3 - chr1 bed2gff exon 12613 12721 0 + . Parent=uc001aaa.3 - chr1 bed2gff exon 13221 14409 0 + . Parent=uc001aaa.3 - --------- - -**About formats** - -**BED format** Browser Extensible Data format was designed at UCSC for displaying data tracks in the Genome Browser. It has three required fields and several additional optional ones: - -The first three BED fields (required) are:: - - 1. chrom - The name of the chromosome (e.g. chr1, chrY_random). - 2. chromStart - The starting position in the chromosome. (The first base in a chromosome is numbered 0.) - 3. chromEnd - The ending position in the chromosome, plus 1 (i.e., a half-open interval). - -The additional BED fields (optional) are:: - - 4. name - The name of the BED line. - 5. score - A score between 0 and 1000. - 6. strand - Defines the strand - either '+' or '-'. - 7. thickStart - The starting position where the feature is drawn thickly at the Genome Browser. - 8. thickEnd - The ending position where the feature is drawn thickly at the Genome Browser. - 9. reserved - This should always be set to zero. - 10. blockCount - The number of blocks (exons) in the BED line. - 11. blockSizes - A comma-separated list of the block sizes. The number of items in this list should correspond to blockCount. - 12. blockStarts - A comma-separated list of block starts. All of the blockStart positions should be calculated relative to chromStart. The number of items in this list should correspond to blockCount. - -**GFF3 format** General Feature Format is a format for describing genes and other features associated with DNA, RNA and Protein sequences. GFF3 lines have nine tab-separated fields:: - - 1. seqid - Must be a chromosome or scaffold or contig. - 2. source - The program that generated this feature. - 3. type - The name of this type of feature. Some examples of standard feature types are "gene", "CDS", "protein", "mRNA", and "exon". - 4. start - The starting position of the feature in the sequence. The first base is numbered 1. - 5. stop - The ending position of the feature (inclusive). - 6. score - A score between 0 and 1000. If there is no score value, enter ".". - 7. strand - Valid entries include '+', '-', or '.' (for don't know/care). - 8. phase - If the feature is a coding exon, frame should be a number between 0-2 that represents the reading frame of the first base. If the feature is not a coding exon, the value should be '.'. - 9. attributes - All lines with the same group are linked together into a single item. - --------- - -**Copyright** - -2009-2014 Max Planck Society, University of Tübingen & Memorial Sloan Kettering Cancer Center - -Sreedharan VT, Schultheiss SJ, Jean G, Kahles A, Bohnert R, Drewe P, Mudrakarta P, Görnitz N, Zeller G, Rätsch G. Oqtans: the RNA-seq workbench in the cloud for complete and reproducible quantitative transcriptome analysis. Bioinformatics 10.1093/bioinformatics/btt731 (2014) - - </help> -</tool>
--- a/gbk_to_gff.py Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,213 +0,0 @@ -#!/usr/bin/env python -""" -Convert data from Genbank format to GFF. - -Usage: -python gbk_to_gff.py in.gbk > out.gff - -Requirements: - BioPython:- http://biopython.org/ - helper.py : https://github.com/vipints/GFFtools-GX/blob/master/helper.py - -Copyright (C) - 2009-2012 Friedrich Miescher Laboratory of the Max Planck Society, Tubingen, Germany. - 2012-2014 Memorial Sloan Kettering Cancer Center New York City, USA. -""" - -import os -import re -import sys -import collections -from Bio import SeqIO -import helper - -def feature_table(chr_id, source, orient, genes, transcripts, cds, exons, unk): - """ - Write the feature information - """ - - for gname, ginfo in genes.items(): - line = [str(chr_id), - 'gbk_to_gff', - ginfo[3], - str(ginfo[0]), - str(ginfo[1]), - '.', - ginfo[2], - '.', - 'ID=%s;Name=%s' % (str(gname), str(gname))] - print '\t'.join(line) - ## construct the transcript line is not defined in the original file - t_line = [str(chr_id), 'gbk_to_gff', source, 0, 1, '.', ginfo[2], '.'] - - if not transcripts: - t_line.append('ID=Transcript:%s;Parent=%s' % (str(gname), str(gname))) - - if exons: ## get the entire transcript region from the defined feature - t_line[3] = str(exons[gname][0][0]) - t_line[4] = str(exons[gname][0][-1]) - elif cds: - t_line[3] = str(cds[gname][0][0]) - t_line[4] = str(cds[gname][0][-1]) - print '\t'.join(t_line) - - if exons: - exon_line_print(t_line, exons[gname], 'Transcript:'+str(gname), 'exon') - - if cds: - exon_line_print(t_line, cds[gname], 'Transcript:'+str(gname), 'CDS') - if not exons: - exon_line_print(t_line, cds[gname], 'Transcript:'+str(gname), 'exon') - - else: ## transcript is defined - for idx in transcripts[gname]: - t_line[2] = idx[3] - t_line[3] = str(idx[0]) - t_line[4] = str(idx[1]) - t_line.append('ID='+str(idx[2])+';Parent='+str(gname)) - print '\t'.join(t_line) - - ## feature line print call - if exons: - exon_line_print(t_line, exons[gname], str(idx[2]), 'exon') - if cds: - exon_line_print(t_line, cds[gname], str(idx[2]), 'CDS') - if not exons: - exon_line_print(t_line, cds[gname], str(idx[2]), 'exon') - - if len(genes) == 0: ## feature entry with fragment information - - line = [str(chr_id), 'gbk_to_gff', source, 0, 1, '.', orient, '.'] - fStart = fStop = None - - for eid, ex in cds.items(): - fStart = ex[0][0] - fStop = ex[0][-1] - - for eid, ex in exons.items(): - fStart = ex[0][0] - fStop = ex[0][-1] - - if fStart or fStart: - - line[2] = 'gene' - line[3] = str(fStart) - line[4] = str(fStop) - line.append('ID=Unknown_Gene_' + str(unk) + ';Name=Unknown_Gene_' + str(unk)) - print "\t".join(line) - - if not cds: - line[2] = 'transcript' - else: - line[2] = 'mRNA' - - line[8] = 'ID=Unknown_Transcript_' + str(unk) + ';Parent=Unknown_Gene_' + str(unk) - print "\t".join(line) - - if exons: - exon_line_print(line, cds[None], 'Unknown_Transcript_' + str(unk), 'exon') - - if cds: - exon_line_print(line, cds[None], 'Unknown_Transcript_' + str(unk), 'CDS') - if not exons: - exon_line_print(line, cds[None], 'Unknown_Transcript_' + str(unk), 'exon') - - unk +=1 - - return unk - -def exon_line_print(temp_line, trx_exons, parent, ftype): - """ - Print the EXON feature line - """ - - for ex in trx_exons: - temp_line[2] = ftype - temp_line[3] = str(ex[0]) - temp_line[4] = str(ex[1]) - temp_line[8] = 'Parent=%s' % parent - print '\t'.join(temp_line) - -def gbk_parse(fname): - """ - Extract genome annotation recods from genbank format - - @args fname: gbk file name - @type fname: str - """ - - fhand = helper.open_file(gbkfname) - unk = 1 - - for record in SeqIO.parse(fhand, "genbank"): - - gene_tags = dict() - tx_tags = collections.defaultdict(list) - exon = collections.defaultdict(list) - cds = collections.defaultdict(list) - mol_type, chr_id = None, None - - for rec in record.features: - - if rec.type == 'source': - try: - mol_type = rec.qualifiers['mol_type'][0] - except: - mol_type = '.' - pass - try: - chr_id = rec.qualifiers['chromosome'][0] - except: - chr_id = record.name - continue - - strand='-' - strand='+' if rec.strand>0 else strand - - fid = None - try: - fid = rec.qualifiers['gene'][0] - except: - pass - - transcript_id = None - try: - transcript_id = rec.qualifiers['transcript_id'][0] - except: - pass - - if re.search(r'gene', rec.type): - gene_tags[fid] = (rec.location._start.position+1, - rec.location._end.position, - strand, - rec.type - ) - elif rec.type == 'exon': - exon[fid].append((rec.location._start.position+1, - rec.location._end.position)) - elif rec.type=='CDS': - cds[fid].append((rec.location._start.position+1, - rec.location._end.position)) - else: - # get all transcripts - if transcript_id: - tx_tags[fid].append((rec.location._start.position+1, - rec.location._end.position, - transcript_id, - rec.type)) - # record extracted, generate feature table - unk = feature_table(chr_id, mol_type, strand, gene_tags, tx_tags, cds, exon, unk) - - fhand.close() - - -if __name__=='__main__': - - try: - gbkfname = sys.argv[1] - except: - print __doc__ - sys.exit(-1) - - ## extract gbk records - gbk_parse(gbkfname)
--- a/gbk_to_gff.xml Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,91 +0,0 @@ -<tool id="fml_gbk2gff" name="GBK-to-GFF" version="2.0.0"> - <description>converter</description> - <command interpreter="python">gbk_to_gff.py $inf_gbk > $gff_format - </command> - <inputs> - <param format="gb,gbk,genbank,txt" name="inf_gbk" type="data" label="Convert this query" help="GenBank flat file format consists of an annotation section and a sequence section."/> - </inputs> - <outputs> - <data format="gff3" name="gff_format" label="${tool.name} on ${on_string}: Converted"/> - </outputs> - <tests> - <test> - <param name="inf_gbk" value="s_cerevisiae_SCU49845.gbk" /> - <output name="gff_format" file="s_cerevisiae_SCU49845.gff3" /> - </test> - </tests> - <help> - -**What it does** - -This tool converts data from a GenBank_ flat file format to GFF (scroll down for format description). - -.. _GenBank: http://www.ncbi.nlm.nih.gov/genbank/ - ------- - -**Example** - -- The following data in GenBank format:: - - LOCUS NM_001202705 2406 bp mRNA linear PLN 28-MAY-2011 - DEFINITION Arabidopsis thaliana thiamine biosynthesis protein ThiC (THIC) - mRNA, complete cds. - ACCESSION NM_001202705 - VERSION NM_001202705.1 GI:334184566......... - FEATURES Location/Qualifiers - source 1..2406 - /organism="Arabidopsis thaliana" - /mol_type="mRNA" - /db_xref="taxon:3702"........ - gene 1..2406 - /gene="THIC" - /locus_tag="AT2G29630" - /gene_synonym="PY; PYRIMIDINE REQUIRING; T27A16.27;........ - ORIGIN - 1 aagcctttcg ctttaggctg cattgggccg tgacaatatt cagacgattc aggaggttcg - 61 ttcctttttt aaaggaccct aatcactctg agtaccactg actcactcag tgtgcgcgat - 121 tcatttcaaa aacgagccag cctcttcttc cttcgtctac tagatcagat ccaaagcttc - 181 ctcttccagc tatggctgct tcagtacact gtaccttgat gtccgtcgta tgcaacaaca - // - - -- Will be converted to GFF3:: - - ##gff-version 3 - NM_001202705 gbk_to_gff chromosome 1 2406 . + 1 ID=NM_001202705;Alias=2;Dbxref=taxon:3702;Name=NM_001202705 - NM_001202705 gbk_to_gff gene 1 2406 . + 1 ID=AT2G29630;Dbxref=GeneID:817513,TAIR:AT2G29630;Name=THIC - NM_001202705 gbk_to_gff mRNA 192 2126 . + 1 ID=AT2G29630.t01;Parent=AT2G29630 - NM_001202705 gbk_to_gff CDS 192 2126 . + 1 ID=AT2G29630.p01;Parent=AT2G29630.t01 - NM_001202705 gbk_to_gff exon 192 2126 . + 1 Parent=AT2G29630.t01 - ------- - -**About formats** - -**GenBank format** An example of a GenBank record may be viewed here_ - -.. _here: http://www.ncbi.nlm.nih.gov/Sitemap/samplerecord.html - -**GFF3** Generic Feature Format is a format for describing genes and other features associated with DNA, RNA and Protein sequences. GFF3 lines have nine tab-separated fields:: - - 1. seqid - Must be a chromosome or scaffold or contig. - 2. source - The program that generated this feature. - 3. type - The name of this type of feature. Some examples of standard feature types are "gene", "CDS", "protein", "mRNA", and "exon". - 4. start - The starting position of the feature in the sequence. The first base is numbered 1. - 5. stop - The ending position of the feature (inclusive). - 6. score - A score between 0 and 1000. If there is no score value, enter ".". - 7. strand - Valid entries include '+', '-', or '.' (for don't know/care). - 8. phase - If the feature is a coding exon, frame should be a number between 0-2 that represents the reading frame of the first base. If the feature is not a coding exon, the value should be '.'. - 9. attributes - All lines with the same group are linked together into a single item. - --------- - -**Copyright** - -2009-2014 Max Planck Society, University of Tübingen & Memorial Sloan Kettering Cancer Center - -Sreedharan VT, Schultheiss SJ, Jean G, Kahles A, Bohnert R, Drewe P, Mudrakarta P, Görnitz N, Zeller G, Rätsch G. Oqtans: the RNA-seq workbench in the cloud for complete and reproducible quantitative transcriptome analysis. Bioinformatics 10.1093/bioinformatics/btt731 (2014) - - </help> -</tool>
--- a/gff_fmap.py Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,203 +0,0 @@ -#!/usr/bin/env python -""" -GFF feature mapping program, to find the relation between different features described in a given GFF file. - -Usage: -python gff_fmap.py in.gff > out.txt - -Courtesy: Brad Chapman - Few functions are inherited from bcbio-GFFParser program. -""" - -import re -import sys -import urllib -import collections -from helper import open_file - -def _gff_line_map(line): - """Parses a line of GFF into a dictionary. - Given an input line from a GFF file, this: - - breaks it into component elements - - determines the type of attribute (flat, parent, child or annotation) - - generates a dictionary of GFF info - """ - gff3_kw_pat = re.compile("\w+=") - def _split_keyvals(keyval_str): - """Split key-value pairs in a GFF2, GTF and GFF3 compatible way. - GFF3 has key value pairs like: - count=9;gene=amx-2;sequence=SAGE:aacggagccg - GFF2 and GTF have: - Sequence "Y74C9A" ; Note "Clone Y74C9A; Genbank AC024206" - name "fgenesh1_pg.C_chr_1000003"; transcriptId 869 - """ - quals = collections.defaultdict(list) - if keyval_str is None: - return quals - # ensembl GTF has a stray semi-colon at the end - if keyval_str[-1] == ';': - keyval_str = keyval_str[:-1] - # GFF2/GTF has a semi-colon with at least one space after it. - # It can have spaces on both sides; wormbase does this. - # GFF3 works with no spaces. - # Split at the first one we can recognize as working - parts = keyval_str.split(" ; ") - if len(parts) == 1: - parts = keyval_str.split("; ") - if len(parts) == 1: - parts = keyval_str.split(";") - # check if we have GFF3 style key-vals (with =) - is_gff2 = True - if gff3_kw_pat.match(parts[0]): - is_gff2 = False - key_vals = [p.split('=') for p in parts] - # otherwise, we are separated by a space with a key as the first item - else: - pieces = [] - for p in parts: - # fix misplaced semi-colons in keys in some GFF2 files - if p and p[0] == ';': - p = p[1:] - pieces.append(p.strip().split(" ")) - key_vals = [(p[0], " ".join(p[1:])) for p in pieces] - for key, val in key_vals: - # remove quotes in GFF2 files - if (len(val) > 0 and val[0] == '"' and val[-1] == '"'): - val = val[1:-1] - if val: - quals[key].extend(val.split(',')) - # if we don't have a value, make this a key=True/False style - # attribute - else: - quals[key].append('true') - for key, vals in quals.items(): - quals[key] = [urllib.unquote(v) for v in vals] - return quals, is_gff2 - - def _nest_gff2_features(gff_parts): - """Provide nesting of GFF2 transcript parts with transcript IDs. - - exons and coding sequences are mapped to a parent with a transcript_id - in GFF2. This is implemented differently at different genome centers - and this function attempts to resolve that and map things to the GFF3 - way of doing them. - """ - # map protein or transcript ids to a parent - for transcript_id in ["transcript_id", "transcriptId", "proteinId"]: - try: - gff_parts["quals"]["Parent"] = \ - gff_parts["quals"][transcript_id] - break - except KeyError: - pass - # case for WormBase GFF -- everything labelled as Transcript or CDS - for flat_name in ["Transcript", "CDS"]: - if gff_parts["quals"].has_key(flat_name): - # parent types - if gff_parts["type"] in [flat_name]: - if not gff_parts["id"]: - gff_parts["id"] = gff_parts["quals"][flat_name][0] - gff_parts["quals"]["ID"] = [gff_parts["id"]] - # children types - elif gff_parts["type"] in ["intron", "exon", "three_prime_UTR", - "coding_exon", "five_prime_UTR", "CDS", "stop_codon", - "start_codon"]: - gff_parts["quals"]["Parent"] = gff_parts["quals"][flat_name] - break - - return gff_parts - - line = line.strip() - if line == '':return [('directive', line)] # sometimes the blank lines will be there - if line[0] == '>':return [('directive', '')] # sometimes it will be a FATSA header - if line[0] == "#": - return [('directive', line[2:])] - elif line: - parts = line.split('\t') - if len(parts) == 1 and re.search(r'\w+', parts[0]):return [('directive', '')] ## GFF files with FASTA sequence together - assert len(parts) == 9, line - gff_parts = [(None if p == '.' else p) for p in parts] - gff_info = dict() - - # collect all of the base qualifiers for this item - quals, is_gff2 = _split_keyvals(gff_parts[8]) - - gff_info["is_gff2"] = is_gff2 - - if gff_parts[1]:quals["source"].append(gff_parts[1]) - gff_info['quals'] = dict(quals) - - # if we are describing a location, then we are a feature - if gff_parts[3] and gff_parts[4]: - gff_info['type'] = gff_parts[2] - gff_info['id'] = quals.get('ID', [''])[0] - - if is_gff2:gff_info = _nest_gff2_features(gff_info) - # features that have parents need to link so we can pick up - # the relationship - if gff_info['quals'].has_key('Parent'): - final_key = 'child' - elif gff_info['id']: - final_key = 'parent' - # Handle flat features - else: - final_key = 'feature' - # otherwise, associate these annotations with the full record - else: - final_key = 'annotation' - return [(final_key, gff_info)] - -def parent_child_id_map(gff_handle): - """ - Provide a mapping of parent to child relationships in the file. - Gives a dictionary of parent child relationships: - - keys -- tuple of (source, type) for each parent - values -- tuple of (source, type) as children of that parent - """ - # collect all of the parent and child types mapped to IDs - parent_sts = dict() - child_sts = collections.defaultdict(list) - for line in gff_handle: - line_type, line_info = _gff_line_map(line)[0] - if (line_type == 'parent' or (line_type == 'child' and line_info['id'])): - parent_sts[line_info['id']] = (line_info['quals']['source'][0], line_info['type']) - if line_type == 'child': - for parent_id in line_info['quals']['Parent']: - child_sts[parent_id].append((line_info['quals']['source'][0], line_info['type'])) - gff_handle.close() - # generate a dictionary of the unique final type relationships - pc_map = collections.defaultdict(list) - for parent_id, parent_type in parent_sts.items(): - for child_type in child_sts[parent_id]: - pc_map[parent_type].append(child_type) - pc_final_map = dict() - for ptype, ctypes in pc_map.items(): - unique_ctypes = list(set(ctypes)) - unique_ctypes.sort() - pc_final_map[ptype] = unique_ctypes - # some cases the GFF file represents a single feature type - if not pc_final_map: - for fid, stypes in parent_sts.items(): - pc_final_map[stypes] = dict() - # generate a report on feature id mapping in the file - print '+---------------------+---------------------------------+' - print '| Parent feature type | Associated child feature type(s)|' - print '+---------------------+---------------------------------+' - for key, value in pc_final_map.items(): - print key[0], key[1] - for child_to in value: - print '\t\t\t|-',child_to[0], child_to[1] - print '+---------------------+---------------------------------+' - - -if __name__=='__main__': - - try: - gff_file = sys.argv[1] - except: - print __doc__ - sys.exit(-1) - - gff_handle = open_file(gff_file) - parent_child_id_map(gff_handle)
--- a/gff_fmap.xml Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,83 +0,0 @@ -<tool id="fml_gfffmap" name="GFF-map" version="2.0.0"> - <description>features</description> - <command interpreter="python"> - gff_fmap.py $gff_input > $idmapping - </command> - <inputs> - <param format="gff3,gff" name="gff_input" type="data" label="Query file" help="Provide genome annotation file in GFF."/> - </inputs> - <outputs> - <data format="txt" name="idmapping" label="${tool.name} on ${on_string}: parent child id map"/> - </outputs> - <tests> - <test> - <param name="gff_input" value="Feature_ID_mapping_W.gff3" /> - <output name="idmapping" file="Feature_ID_mapping_W.txt" /> - </test> - <test> - <param name="gff_input" value="Aly_JGI.gff3" /> - <output name="idmapping" file="Feature_ID_mapping_R.txt" /> - </test> - </tests> - <help> - -**What it does** - -GFF-map provides the features (gene, mRNA, UTR's, exon, CDS etc) relationship based on their identifier mapping in a given GFF file. - --------- - -**Example** - -- The features ID mapping in the following data in GFF3:: - - ##gff-version 3 - 17 protein_coding gene 7255208 7258258 . + . ID=ENSG00000213859;Name=KCTD11 - 17 protein_coding mRNA 7255208 7258258 . + . ID=ENST00000333751;Name=KCTD11-001;Parent=ENSG00000213859 - 17 protein_coding protein 7256262 7256960 . + 0 ID=ENSP00000328352;Name=ENSP00000328352 - 17 protein_coding five_prime_UTR 7255208 7256261 . + . Parent=ENST00000333751 - 17 protein_coding CDS 7256262 7256960 . + 0 Name=CDS:KCTD11;Parent=ENST00000333751,ENSP00000328352 - 17 protein_coding three_prime_UTR 7256961 7258258 . + . Parent=ENST00000333751 - 17 protein_coding exon 7255208 7258258 . + . Parent=ENST00000333751 - -- Will be displayed as:: - - +-----------------------+---------------------------------+ - | Parent feature type | Associated child feature type(s)| - +-----------------------+---------------------------------+ - | protein_coding gene | protein_coding mRNA | - +-----------------------+---------------------------------+ - | protein_coding protein| protein_coding CDS | - +-----------------------+---------------------------------+ - | protein_coding mRNA | protein_coding CDS | - | | protein_coding exon | - | | protein_coding five_prime_UTR | - | | protein_coding three_prime_UTR | - +-----------------------+---------------------------------+ - --------- - -**About formats** - -**GFF3 format** General Feature Format is a format for describing genes and other features associated with DNA, RNA and Protein sequences. GFF3 lines have nine tab-separated fields:: - - 1. seqid - Must be a chromosome or scaffold. - 2. source - The program that generated this feature. - 3. type - The name of this type of feature. Some examples of standard feature types are "gene", "CDS", "protein", "mRNA", and "exon". - 4. start - The starting position of the feature in the sequence. The first base is numbered 1. - 5. stop - The ending position of the feature (inclusive). - 6. score - A score between 0 and 1000. If there is no score value, enter ".". - 7. strand - Valid entries include '+', '-', or '.' (for don't know/care). - 8. phase - If the feature is a coding exon, frame should be a number between 0-2 that represents the reading frame of the first base. If the feature is not a coding exon, the value should be '.'. - 9. attributes - All lines with the same group are linked together into a single item. - --------- - -**Copyright** - -2009-2014 Max Planck Society, University of Tübingen & Memorial Sloan Kettering Cancer Center - -Sreedharan VT, Schultheiss SJ, Jean G, Kahles A, Bohnert R, Drewe P, Mudrakarta P, Görnitz N, Zeller G, Rätsch G. Oqtans: the RNA-seq workbench in the cloud for complete and reproducible quantitative transcriptome analysis. Bioinformatics 10.1093/bioinformatics/btt731 (2014) - -</help> -</tool>
--- a/gff_to_bed.py Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,96 +0,0 @@ -#!/usr/bin/env python -""" -Convert genome annotation data in GFF/GTF to a 12 column BED format. -BED format typically represents the transcript models. - -Usage: python gff_to_bed.py in.gff > out.bed - -Requirement: - GFFParser.py: https://github.com/vipints/GFFtools-GX/blob/master/GFFParser.py - -Copyright (C) - 2009-2012 Friedrich Miescher Laboratory of the Max Planck Society, Tubingen, Germany. - 2012-2014 Memorial Sloan Kettering Cancer Center New York City, USA. -""" - -import re -import sys -import GFFParser - -def writeBED(tinfo): - """ - writing result files in bed format - - @args tinfo: list of genes - @args tinfo: numpy object - """ - - for ent1 in tinfo: - child_flag = False - - for idx, tid in enumerate(ent1['transcripts']): - child_flag = True - exon_cnt = len(ent1['exons'][idx]) - exon_len = '' - exon_cod = '' - rel_start = None - rel_stop = None - for idz, ex_cod in enumerate(ent1['exons'][idx]):#check for exons of corresponding transcript - exon_len += '%d,' % (ex_cod[1]-ex_cod[0]+1) - if idz == 0: #calculate the relative start position - exon_cod += '0,' - rel_start = int(ex_cod[0]) - rel_stop = ex_cod[1] - else: - exon_cod += '%d,' % (ex_cod[0]-rel_start) - rel_stop = int(ex_cod[1]) - - if exon_len: - score = '0' - score = ent1['score'][0] if ent1['score'] else score - out_print = [ent1['chr'], - str(rel_start), - str(rel_stop), - tid[0], - score, - ent1['strand'], - str(rel_start), - str(rel_stop), - '0', - str(exon_cnt), - exon_len, - exon_cod] - print '\t'.join(out_print) - - if not child_flag: # file just contains only a single parent type i.e, gff3 defines only one feature type - score = '0' - score = ent1['score'][0] if ent1['score'] else score - - out_print = [ent1['chr'], - '%d' % int(ent1['start']), - '%d' % int(ent1['stop']), - ent1['name'], - score, - ent1['strand'], - '%d' % int(ent1['start']), - '%d' % int(ent1['stop']), - '0', - '1', - '%d,' % (int(ent1['stop'])-int(ent1['start'])+1), - '0,'] - - print '\t'.join(out_print) - - -def __main__(): - try: - query_file = sys.argv[1] - except: - print __doc__ - sys.exit(-1) - - Transcriptdb = GFFParser.Parse(query_file) - writeBED(Transcriptdb) - -if __name__ == "__main__": - __main__()
--- a/gff_to_bed.xml Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,90 +0,0 @@ -<tool id="fml_gff2bed" name="GFF-to-BED" version="2.0.0"> - <description>converter</description> - <command interpreter="python">gff_to_bed.py $inf_gff > $bed_format - </command> - <inputs> - <param format="gtf,gff,gff3" name="inf_gff" type="data" label="Convert this query" help="Provide genome annotation file in GFF, GTF, GFF3."/> - </inputs> - <outputs> - <data format="bed" name="bed_format" label="${tool.name} on ${on_string}: Converted" /> - </outputs> - <tests> - <test> - <param name="inf_gff" value="Aly_JGI.gff3" /> - <output name="bed_format" file="Aly_JGI.bed" /> - </test> - <test> - <param name="inf_gff" value="MB7_3R.gff3" /> - <output name="bed_format" file="MB7_3R.bed" /> - </test> - </tests> - <help> - -**What it does** - -This tool converts gene transcript annotation from GTF or GFF or GFF3 to UCSC wiggle 12 column BED format. - --------- - -**Example** - -- The following data in GFF3:: - - ##gff-version 3 - chr1 protein_coding gene 11874 14409 0 + . ID=Gene:uc001aaa.3;Name=Gene:uc001aaa.3 - chr1 protein_coding transcript 11874 14409 0 + . ID=uc001aaa.3;Name=uc001aaa.3;Parent=Gene:uc001aaa.3 - chr1 protein_coding exon 11874 12227 0 + . Parent=uc001aaa.3 - chr1 protein_coding exon 12613 12721 0 + . Parent=uc001aaa.3 - chr1 protein_coding exon 13221 14409 0 + . Parent=uc001aaa.3 - -- Will be converted to UCSC Wiggle BED format:: - - chr1 11874 14409 uc001aaa.3 0 + 11874 14409 0 3 354,109,1189, 0,739,1347, - --------- - -**About formats** - -**GFF3 format** General Feature Format is a format for describing genes and other features associated with DNA, RNA and Protein sequences. GFF3 lines have nine tab-separated fields:: - - - 1. seqid - Must be a chromosome or scaffold or contig. - 2. source - The program that generated this feature. - 3. type - The name of this type of feature. Some examples of standard feature types are "gene", "CDS", "protein", "mRNA", and "exon". - 4. start - The starting position of the feature in the sequence. The first base is numbered 1. - 5. stop - The ending position of the feature (inclusive). - 6. score - A score between 0 and 1000. If there is no score value, enter ".". - 7. strand - Valid entries include '+', '-', or '.' (for don't know/care). - 8. phase - If the feature is a coding exon, frame should be a number between 0-2 that represents the reading frame of the first base. If the feature is not a coding exon, the value should be '.'. - 9. attributes - All lines with the same group are linked together into a single item. - -**BED format** Browser Extensible Data format was designed at UCSC for displaying data tracks in the Genome Browser. It has three required fields and several additional optional ones: - -The first three BED fields (required) are:: - - 1. chrom - The name of the chromosome (e.g. chr1, chrY_random). - 2. chromStart - The starting position in the chromosome. (The first base in a chromosome is numbered 0.) - 3. chromEnd - The ending position in the chromosome, plus 1 (i.e., a half-open interval). - -The additional BED fields (optional) are:: - - 4. name - The name of the BED line. - 5. score - A score between 0 and 1000. - 6. strand - Defines the strand - either '+' or '-'. - 7. thickStart - The starting position where the feature is drawn thickly at the Genome Browser. - 8. thickEnd - The ending position where the feature is drawn thickly at the Genome Browser. - 9. reserved - This should always be set to zero. - 10. blockCount - The number of blocks (exons) in the BED line. - 11. blockSizes - A comma-separated list of the block sizes. The number of items in this list should correspond to blockCount. - 12. blockStarts - A comma-separated list of block starts. All of the blockStart positions should be calculated relative to chromStart. The number of items in this list should correspond to blockCount. - --------- - -**Copyright** - -2009-2014 Max Planck Society, University of Tübingen & Memorial Sloan Kettering Cancer Center - -Sreedharan VT, Schultheiss SJ, Jean G, Kahles A, Bohnert R, Drewe P, Mudrakarta P, Görnitz N, Zeller G, Rätsch G. Oqtans: the RNA-seq workbench in the cloud for complete and reproducible quantitative transcriptome analysis. Bioinformatics 10.1093/bioinformatics/btt731 (2014) - - </help> -</tool>
--- a/gff_to_gbk.py Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,54 +0,0 @@ -#!/usr/bin/env python -""" -Convert data from GFF and associated genome sequence in fasta file into GenBank. - -Usage: -python gff_to_gbk.py in.gff in.fasta out.gbk - -Requirements: - BioPython:- http://biopython.org/ - helper.py : https://github.com/vipints/GFFtools-GX/blob/master/helper.py - -Copyright (C) - 2010-2012 Friedrich Miescher Laboratory of the Max Planck Society, Tubingen, Germany. - 2012-2014 Memorial Sloan Kettering Cancer Center New York City, USA. -""" - -import sys -import helper -import gffparser_bcbio - -from Bio import SeqIO -from Bio.Alphabet import generic_dna - -def __main__(): - """ - main wrapper - """ - - try: - gff_fname = sys.argv[1] - fasta_fname = sys.argv[2] - gb_fname = sys.argv[3] - except: - print __doc__ - sys.exit(-1) - - fasta_fh = helper.open_file(fasta_fname) - - fasta_rec = SeqIO.to_dict(SeqIO.parse(fasta_fh, "fasta", generic_dna)) - fasta_fh.close() - - gff_rec = gffparser_bcbio.parse(gff_fname, fasta_rec) - - try: - gb_fh = open(gb_fname, "w") - except: - print 'file not ready for writing %s' % gb_fname - sys.exit(-1) - - SeqIO.write(gff_rec, gb_fh, "genbank") - gb_fh.close() - -if __name__=="__main__": - __main__()
--- a/gff_to_gbk.xml Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,98 +0,0 @@ -<tool id="fml_gff2gbk" name="GFF-to-GBK" version="2.0.0"> - <description>converter</description> - <command interpreter="python">gff_to_gbk.py $inf_gff $inf_fas $gbk_format - </command> - <inputs> - <param format="gff,gff3" name="inf_gff" type="data" label="Convert this query" help="Genome annotation in GFF file format."/> - <param format="fa,fasta" name="inf_fas" type="data" label="Genome Sequence" help="Genome sequence in FASTA format."/> - </inputs> - <outputs> - <data format="genbank" name="gbk_format" label="${tool.name} on ${on_string}: Converted"/> - </outputs> - <tests> - <test> - <param name="inf_gff" value="s_cerevisiae_SCU49845.gff3" /> - <param name="inf_fas" value="s_cerevisiae_SCU49845.fasta" /> - <output name="gbk_format" file="s_cerevisiae_SCU49845.gbk" /> - </test> - </tests> - <help> - -**What it does** - -This tool converts annotations in GFF to GenBank_ format (scroll down for format description). - -.. _GenBank: http://www.ncbi.nlm.nih.gov/genbank/ - ------- - -**Example** - -- The following data in GFF:: - - ##gff-version 3 - # sequence-region NM_001202705 1 2406 - NM_001202705 GenBank chromosome 1 2406 . + 1 ID=NM_001202705;Alias=2;Dbxref=taxon:3702;Name=NM_001202705;Note=Arabidopsis thaliana thiamine biosynthesis protein ThiC (THIC) mRNA%2C complete cds.,REVIEWED REFSEQ; - NM_001202705 GenBank gene 1 2406 . + 1 ID=AT2G29630;Dbxref=GeneID:817513,TAIR:AT2G29630;Name=THIC;locus_tag=AT2G29630 - NM_001202705 GenBank mRNA 192 2126 . + 1 ID=AT2G29630.t01;Parent=AT2G29630 - NM_001202705 GenBank CDS 192 2126 . + 1 ID=AT2G29630.p01;Parent=AT2G29630.t01;Dbxref=GI:334184567,GeneID:817513,TAIR:AT2G29630;Name=THIC;Note=thiaminC (THIC)%3B CONTAINS InterPro DOMAIN;rotein_id=NP_001189634.1; - NM_001202705 GenBank exon 192 2126 . + 1 Parent=AT2G29630.t01 - ##FASTA - >NM_001202705 - AAGCCTTTCGCTTTAGGCTGCATTGGGCCGTGACAATATTCAGACGATTCAGGAGGTTCG - TTCCTTTTTTAAAGGACCCTAATCACTCTGAGTACCACTGACTCACTCAGTGTGCGCGAT - -- Will be converted to GenBank format:: - - LOCUS NM_001202705 2406 bp mRNA linear PLN 28-MAY-2011 - DEFINITION Arabidopsis thaliana thiamine biosynthesis protein ThiC (THIC) - mRNA, complete cds. - ACCESSION NM_001202705 - VERSION NM_001202705.1 GI:334184566......... - FEATURES Location/Qualifiers - source 1..2406 - /organism="Arabidopsis thaliana" - /mol_type="mRNA" - /db_xref="taxon:3702"........ - gene 1..2406 - /gene="THIC" - /locus_tag="AT2G29630" - /gene_synonym="PY; PYRIMIDINE REQUIRING; T27A16.27;........ - ORIGIN - 1 aagcctttcg ctttaggctg cattgggccg tgacaatatt cagacgattc aggaggttcg - 61 ttcctttttt aaaggaccct aatcactctg agtaccactg actcactcag tgtgcgcgat - 121 tcatttcaaa aacgagccag cctcttcttc cttcgtctac tagatcagat ccaaagcttc - 181 ctcttccagc tatggctgct tcagtacact gtaccttgat gtccgtcgta tgcaacaaca - // - ------- - -**About formats** - -**GFF** Generic Feature Format is a format for describing genes and other features associated with DNA, RNA and Protein sequences. GFF lines have nine tab-separated fields:: - - 1. seqid - Must be a chromosome or scaffold or contig. - 2. source - The program that generated this feature. - 3. type - The name of this type of feature. Some examples of standard feature types are "gene", "CDS", "protein", "mRNA", and "exon". - 4. start - The starting position of the feature in the sequence. The first base is numbered 1. - 5. stop - The ending position of the feature (inclusive). - 6. score - A score between 0 and 1000. If there is no score value, enter ".". - 7. strand - Valid entries include '+', '-', or '.' (for don't know/care). - 8. phase - If the feature is a coding exon, frame should be a number between 0-2 that represents the reading frame of the first base. If the feature is not a coding exon, the value should be '.'. - 9. attributes - All lines with the same group are linked together into a single item. - -**GenBank format** Consists of an annotation section and a sequence section. Sample record_ - -.. _record: http://www.ncbi.nlm.nih.gov/Sitemap/samplerecord.html - - --------- - -**Copyright** - -2010-2014 Max Planck Society, University of Tübingen & Memorial Sloan Kettering Cancer Center - -Sreedharan VT, Schultheiss SJ, Jean G, Kahles A, Bohnert R, Drewe P, Mudrakarta P, Görnitz N, Zeller G, Rätsch G. Oqtans: the RNA-seq workbench in the cloud for complete and reproducible quantitative transcriptome analysis. Bioinformatics 10.1093/bioinformatics/btt731 (2014) - - </help> -</tool>
--- a/gff_to_gtf.py Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,76 +0,0 @@ -#!/usr/bin/env python -""" -Program to convert data from GFF to GTF - -Usage: python gff_to_gtf.py in.gff > out.gtf - -Requirement: - GFFParser.py: https://github.com/vipints/GFFtools-GX/blob/master/GFFParser.py - -Copyright (C) - 2009-2012 Friedrich Miescher Laboratory of the Max Planck Society, Tubingen, Germany. - 2012-2014 Memorial Sloan Kettering Cancer Center New York City, USA. -""" - -import re -import sys -import GFFParser - -def printGTF(tinfo): - """ - writing result file in GTF format - - @args tinfo: parsed object from gff file - @type tinfo: numpy array - """ - - for ent1 in tinfo: - for idx, tid in enumerate(ent1['transcripts']): - - exons = ent1['exons'][idx] - cds_exons = ent1['cds_exons'][idx] - - stop_codon = start_codon = () - - if ent1['strand'] == '+': - if cds_exons.any(): - start_codon = (cds_exons[0][0], cds_exons[0][0]+2) - stop_codon = (cds_exons[-1][1]-2, cds_exons[-1][1]) - elif ent1['strand'] == '-': - if cds_exons.any(): - start_codon = (cds_exons[-1][1]-2, cds_exons[-1][1]) - stop_codon = (cds_exons[0][0], cds_exons[0][0]+2) - else: - print 'STRAND information missing - %s, skip the transcript - %s' % (ent1['strand'], tid[0]) - pass - - last_cds_cod = 0 - for idz, ex_cod in enumerate(exons): - - print '%s\t%s\texon\t%d\t%d\t.\t%s\t.\tgene_id "%s"; transcript_id "%s"; exon_number "%d"; gene_name "%s"; ' % (ent1['chr'], ent1['source'], ex_cod[0], ex_cod[1], ent1['strand'], ent1['name'], tid[0], idz+1, ent1['gene_info']['Name']) - - if cds_exons.any(): - try: - print '%s\t%s\tCDS\t%d\t%d\t.\t%s\t%d\tgene_id "%s"; transcript_id "%s"; exon_number "%d"; gene_name "%s"; ' % (ent1['chr'], ent1['source'], cds_exons[idz][0], cds_exons[idz][1], ent1['strand'], cds_exons[idz][2], ent1['name'], tid[0], idz+1, ent1['gene_info']['Name']) - last_cds_cod = idz - except: - pass - - if idz == 0: - print '%s\t%s\tstart_codon\t%d\t%d\t.\t%s\t%d\tgene_id "%s"; transcript_id "%s"; exon_number "%d"; gene_name "%s"; ' % (ent1['chr'], ent1['source'], start_codon[0], start_codon[1], ent1['strand'], cds_exons[idz][2], ent1['name'], tid[0], idz+1, ent1['gene_info']['Name']) - - if stop_codon: - print '%s\t%s\tstop_codon\t%d\t%d\t.\t%s\t%d\tgene_id "%s"; transcript_id "%s"; exon_number "%d"; gene_name "%s"; ' % (ent1['chr'], ent1['source'], stop_codon[0], stop_codon[1], ent1['strand'], cds_exons[last_cds_cod][2], ent1['name'], tid[0], idz+1, ent1['gene_info']['Name']) - - -if __name__ == "__main__": - - try: - gff_fname = sys.argv[1] - except: - print __doc__ - sys.exit(-1) - - Transcriptdb = GFFParser.Parse(gff_fname) - - printGTF(Transcriptdb)
--- a/gff_to_gtf.xml Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,88 +0,0 @@ -<tool id="fml_gff2gtf" name="GFF-to-GTF" version="2.0.0"> - <description>converter</description> - <command interpreter="python">gff_to_gtf.py $inf_gff3 > $gtf_format - </command> - <inputs> - <param format="gff3,gff" name="inf_gff3" type="data" label="Convert this query" help="Provide genome annotation file in GFF or GFF3."/> - </inputs> - <outputs> - <data format="gtf" name="gtf_format" label="${tool.name} on ${on_string}: Converted" /> - </outputs> - <tests> - <test> - <param name="inf_gff3" value="AceView_ncbi_37.gff3" /> - <output name="gtf_format" file="AceView_gff3_to_gtf.gtf" /> - </test> - <test> - <param name="inf_gff3" value="ENSEMBL_mm9.gff3" /> - <output name="gtf_format" file="ENSEMBL_mm9_gff3_to_gtf.gtf" /> - </test> - </tests> - <help> - -**What it does** - -This tool converts data from GFF3 to GTF file format (scroll down for format description). - --------- - -**Example** - -- The following data in GFF3 format:: - - ##gff-version 3 - 17 protein_coding gene 7255208 7258258 . + . ID=ENSG00000213859;Name=KCTD11 - 17 protein_coding mRNA 7255208 7258258 . + . ID=ENST00000333751;Name=KCTD11-001;Parent=ENSG00000213859 - 17 protein_coding protein 7256262 7256960 . + . ID=ENSP00000328352;Name=KCTD11-001;Parent=ENST00000333751 - 17 protein_coding five_prime_UTR 7255208 7256261 . + . Parent=ENST00000333751 - 17 protein_coding CDS 7256262 7256960 . + 0 Name=CDS:KCTD11;Parent=ENST00000333751,ENSP00000328352 - 17 protein_coding three_prime_UTR 7256961 7258258 . + . Parent=ENST00000333751 - 17 protein_coding exon 7255208 7258258 . + . Parent=ENST00000333751 - -- Will be converted to GTF format:: - - 17 protein_coding exon 7255208 7258258 . + . gene_id "ENSG00000213859"; transcript_id "ENST00000333751"; exon_number "1"; gene_name "KCTD11"; transcript_name "KCTD11-001"; - 17 protein_coding CDS 7256262 7256957 . + 0 gene_id "ENSG00000213859"; transcript_id "ENST00000333751"; exon_number "1"; gene_name "KCTD11"; transcript_name "KCTD11-001"; protein_id "ENSP00000328352"; - 17 protein_coding start_codon 7256262 7256264 . + 0 gene_id "ENSG00000213859"; transcript_id "ENST00000333751"; exon_number "1"; gene_name "KCTD11"; transcript_name "KCTD11-001"; - 17 protein_coding stop_codon 7256958 7256960 . + 0 gene_id "ENSG00000213859"; transcript_id "ENST00000333751"; exon_number "1"; gene_name "KCTD11"; transcript_name "KCTD11-001"; - --------- - -**About formats** - - -**GFF3 format** General Feature Format is a format for describing genes and other features associated with DNA, RNA and Protein sequences. GFF3 lines have nine tab-separated fields:: - - 1. seqid - Must be a chromosome or scaffold. - 2. source - The program that generated this feature. - 3. type - The name of this type of feature. Some examples of standard feature types are "gene", "CDS", "protein", "mRNA", and "exon". - 4. start - The starting position of the feature in the sequence. The first base is numbered 1. - 5. stop - The ending position of the feature (inclusive). - 6. score - A score between 0 and 1000. If there is no score value, enter ".". - 7. strand - Valid entries include '+', '-', or '.' (for don't know/care). - 8. phase - If the feature is a coding exon, frame should be a number between 0-2 that represents the reading frame of the first base. If the feature is not a coding exon, the value should be '.'. - 9. attributes - All lines with the same group are linked together into a single item. - - -**GTF format** Gene Transfer Format, it borrows from GFF, but has additional structure that warrants a separate definition and format name. GTF lines have nine tab-seaparated fields:: - - 1. seqname - The name of the sequence. - 2. source - This indicating where the annotation came from. - 3. feature - The name of the feature types. The following feature types are required: 'CDS', 'start_codon' and 'stop_codon' - 4. start - The starting position of the feature in the sequence. The first base is numbered 1. - 5. end - The ending position of the feature (inclusive). - 6. score - The score field indicates a degree of confidence in the feature's existence and coordinates. - 7. strand - Valid entries include '+', '-', or '.' - 8. frame - If the feature is a coding exon, frame should be a number between 0-2 that represents the reading frame of the first base. - 9. attributes - These attributes are designed for handling multiple transcripts from the same genomic region. - --------- - -**Copyright** - -2009-2014 Max Planck Society, University of Tübingen & Memorial Sloan Kettering Cancer Center - -Sreedharan VT, Schultheiss SJ, Jean G, Kahles A, Bohnert R, Drewe P, Mudrakarta P, Görnitz N, Zeller G, Rätsch G. Oqtans: the RNA-seq workbench in the cloud for complete and reproducible quantitative transcriptome analysis. Bioinformatics 10.1093/bioinformatics/btt731 (2014) - - </help> -</tool>
--- a/gffparser_bcbio.py Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,828 +0,0 @@ -"""Parse GFF files into features attached to Biopython SeqRecord objects. - -This deals with GFF3 formatted files, a tab delimited format for storing -sequence features and annotations: - -http://www.sequenceontology.org/gff3.shtml - -It will also deal with older GFF versions (GTF/GFF2): - -http://www.sanger.ac.uk/Software/formats/GFF/GFF_Spec.shtml -http://mblab.wustl.edu/GTF22.html - -The implementation utilizes map/reduce parsing of GFF using Disco. Disco -(http://discoproject.org) is a Map-Reduce framework for Python utilizing -Erlang for parallelization. The code works on a single processor without -Disco using the same architecture. -""" -import os -import copy -import re -import collections -import urllib -import itertools - -# Make defaultdict compatible with versions of python older than 2.4 -try: - collections.defaultdict -except AttributeError: - import _utils - collections.defaultdict = _utils.defaultdict - -from Bio.Seq import Seq, UnknownSeq -from Bio.SeqRecord import SeqRecord -from Bio.SeqFeature import SeqFeature, FeatureLocation -from Bio import SeqIO - -def _gff_line_map(line, params): - """Map part of Map-Reduce; parses a line of GFF into a dictionary. - - Given an input line from a GFF file, this: - - decides if the file passes our filtering limits - - if so: - - breaks it into component elements - - determines the type of attribute (flat, parent, child or annotation) - - generates a dictionary of GFF info which can be serialized as JSON - """ - gff3_kw_pat = re.compile("\w+=") - def _split_keyvals(keyval_str): - """Split key-value pairs in a GFF2, GTF and GFF3 compatible way. - - GFF3 has key value pairs like: - count=9;gene=amx-2;sequence=SAGE:aacggagccg - GFF2 and GTF have: - Sequence "Y74C9A" ; Note "Clone Y74C9A; Genbank AC024206" - name "fgenesh1_pg.C_chr_1000003"; transcriptId 869 - """ - quals = collections.defaultdict(list) - if keyval_str is None: - return quals - # ensembl GTF has a stray semi-colon at the end - if keyval_str[-1] == ';': - keyval_str = keyval_str[:-1] - # GFF2/GTF has a semi-colon with at least one space after it. - # It can have spaces on both sides; wormbase does this. - # GFF3 works with no spaces. - # Split at the first one we can recognize as working - parts = keyval_str.split(" ; ") - if len(parts) == 1: - parts = keyval_str.split("; ") - if len(parts) == 1: - parts = keyval_str.split(";") - # check if we have GFF3 style key-vals (with =) - is_gff2 = True - if gff3_kw_pat.match(parts[0]): - is_gff2 = False - key_vals = [p.split('=') for p in parts] - # otherwise, we are separated by a space with a key as the first item - else: - pieces = [] - for p in parts: - # fix misplaced semi-colons in keys in some GFF2 files - if p and p[0] == ';': - p = p[1:] - pieces.append(p.strip().split(" ")) - key_vals = [(p[0], " ".join(p[1:])) for p in pieces] - for item in key_vals: - # standard in-spec items are key=value - if len(item) == 2: - key, val = item - # out-of-spec files can have just key values. We set an empty value - # which will be changed to true later to standardize. - else: - assert len(item) == 1, item - key = item[0] - val = '' - # remove quotes in GFF2 files - if (len(val) > 0 and val[0] == '"' and val[-1] == '"'): - val = val[1:-1] - if val: - quals[key].extend([v for v in val.split(',') if v]) - # if we don't have a value, make this a key=True/False style - # attribute - else: - quals[key].append('true') - for key, vals in quals.items(): - quals[key] = [urllib.unquote(v) for v in vals] - return quals, is_gff2 - - def _nest_gff2_features(gff_parts): - """Provide nesting of GFF2 transcript parts with transcript IDs. - - exons and coding sequences are mapped to a parent with a transcript_id - in GFF2. This is implemented differently at different genome centers - and this function attempts to resolve that and map things to the GFF3 - way of doing them. - """ - # map protein or transcript ids to a parent - for transcript_id in ["transcript_id", "transcriptId", "proteinId"]: - try: - gff_parts["quals"]["Parent"] = \ - gff_parts["quals"][transcript_id] - break - except KeyError: - pass - # case for WormBase GFF -- everything labelled as Transcript or CDS - for flat_name in ["Transcript", "CDS"]: - if gff_parts["quals"].has_key(flat_name): - # parent types - if gff_parts["type"] in [flat_name]: - if not gff_parts["id"]: - gff_parts["id"] = gff_parts["quals"][flat_name][0] - gff_parts["quals"]["ID"] = [gff_parts["id"]] - # children types - elif gff_parts["type"] in ["intron", "exon", "three_prime_UTR", - "coding_exon", "five_prime_UTR", "CDS", "stop_codon", - "start_codon"]: - gff_parts["quals"]["Parent"] = gff_parts["quals"][flat_name] - break - - return gff_parts - - strand_map = {'+' : 1, '-' : -1, '?' : None, None: None} - line = line.strip() - if line[:2] == "##": - return [('directive', line[2:])] - elif line and line[0] != "#": - parts = line.split('\t') - should_do = True - if params.limit_info: - for limit_name, limit_values in params.limit_info.items(): - cur_id = tuple([parts[i] for i in - params.filter_info[limit_name]]) - if cur_id not in limit_values: - should_do = False - break - if should_do: - assert len(parts) >= 8, line - # not python2.4 compatible but easier to understand - #gff_parts = [(None if p == '.' else p) for p in parts] - gff_parts = [] - for p in parts: - if p == ".": - gff_parts.append(None) - else: - gff_parts.append(p) - gff_info = dict() - # collect all of the base qualifiers for this item - if len(parts) > 8: - quals, is_gff2 = _split_keyvals(gff_parts[8]) - else: - quals, is_gff2 = dict(), False - gff_info["is_gff2"] = is_gff2 - if gff_parts[1]: - quals["source"].append(gff_parts[1]) - if gff_parts[5]: - quals["score"].append(gff_parts[5]) - if gff_parts[7]: - quals["phase"].append(gff_parts[7]) - gff_info['quals'] = dict(quals) - gff_info['rec_id'] = gff_parts[0] - # if we are describing a location, then we are a feature - if gff_parts[3] and gff_parts[4]: - gff_info['location'] = [int(gff_parts[3]) - 1, - int(gff_parts[4])] - gff_info['type'] = gff_parts[2] - gff_info['id'] = quals.get('ID', [''])[0] - gff_info['strand'] = strand_map.get(gff_parts[6], None) - if is_gff2: - gff_info = _nest_gff2_features(gff_info) - # features that have parents need to link so we can pick up - # the relationship - if gff_info['quals'].has_key('Parent'): - # check for self referential parent/child relationships - # remove the ID, which is not useful - for p in gff_info['quals']['Parent']: - if p == gff_info['id']: - gff_info['id'] = '' - del gff_info['quals']['ID'] - break - final_key = 'child' - elif gff_info['id']: - final_key = 'parent' - # Handle flat features - else: - final_key = 'feature' - # otherwise, associate these annotations with the full record - else: - final_key = 'annotation' - if params.jsonify: - return [(final_key, simplejson.dumps(gff_info))] - else: - return [(final_key, gff_info)] - return [] - -def _gff_line_reduce(map_results, out, params): - """Reduce part of Map-Reduce; combines results of parsed features. - """ - final_items = dict() - for gff_type, final_val in map_results: - if params.jsonify and gff_type not in ['directive']: - final_val = simplejson.loads(final_val) - try: - final_items[gff_type].append(final_val) - except KeyError: - final_items[gff_type] = [final_val] - for key, vals in final_items.items(): - if params.jsonify: - vals = simplejson.dumps(vals) - out.add(key, vals) - -class _MultiIDRemapper: - """Provide an ID remapping for cases where a parent has a non-unique ID. - - Real life GFF3 cases have non-unique ID attributes, which we fix here - by using the unique sequence region to assign children to the right - parent. - """ - def __init__(self, base_id, all_parents): - self._base_id = base_id - self._parents = all_parents - - def remap_id(self, feature_dict): - rstart, rend = feature_dict['location'] - for index, parent in enumerate(self._parents): - pstart, pend = parent['location'] - if rstart >= pstart and rend <= pend: - if index > 0: - return ("%s_%s" % (self._base_id, index + 1)) - else: - return self._base_id - raise ValueError("Did not find remapped ID location: %s, %s, %s" % ( - self._base_id, [p['location'] for p in self._parents], - feature_dict['location'])) - -class _AbstractMapReduceGFF: - """Base class providing general GFF parsing for local and remote classes. - - This class should be subclassed to provide a concrete class to parse - GFF under specific conditions. These classes need to implement - the _gff_process function, which returns a dictionary of SeqRecord - information. - """ - def __init__(self, create_missing=True): - """Initialize GFF parser - - create_missing - If True, create blank records for GFF ids not in - the base_dict. If False, an error will be raised. - """ - self._create_missing = create_missing - self._map_fn = _gff_line_map - self._reduce_fn = _gff_line_reduce - self._examiner = GFFExaminer() - - def _gff_process(self, gff_files, limit_info, target_lines=None): - raise NotImplementedError("Derived class must define") - - def parse(self, gff_files, base_dict=None, limit_info=None): - """Parse a GFF file, returning an iterator of SeqRecords. - - limit_info - A dictionary specifying the regions of the GFF file - which should be extracted. This allows only relevant portions of a file - to be parsed. - - base_dict - A base dictionary of SeqRecord objects which may be - pre-populated with sequences and other features. The new features from - the GFF file will be added to this dictionary. - """ - for rec in self.parse_in_parts(gff_files, base_dict, limit_info): - yield rec - - def parse_in_parts(self, gff_files, base_dict=None, limit_info=None, - target_lines=None): - """Parse a region of a GFF file specified, returning info as generated. - - target_lines -- The number of lines in the file which should be used - for each partial parse. This should be determined based on available - memory. - """ - for results in self.parse_simple(gff_files, limit_info, target_lines): - if base_dict is None: - cur_dict = dict() - else: - cur_dict = copy.deepcopy(base_dict) - cur_dict = self._results_to_features(cur_dict, results) - all_ids = cur_dict.keys() - all_ids.sort() - for cur_id in all_ids: - yield cur_dict[cur_id] - - def parse_simple(self, gff_files, limit_info=None, target_lines=1): - """Simple parse which does not build or nest features. - - This returns a simple dictionary representation of each line in the - GFF file. - """ - # gracefully handle a single file passed - if not isinstance(gff_files, (list, tuple)): - gff_files = [gff_files] - limit_info = self._normalize_limit_info(limit_info) - for results in self._gff_process(gff_files, limit_info, target_lines): - yield results - - def _normalize_limit_info(self, limit_info): - """Turn all limit information into tuples for identical comparisons. - """ - final_limit_info = {} - if limit_info: - for key, values in limit_info.items(): - final_limit_info[key] = [] - for v in values: - if isinstance(v, str): - final_limit_info[key].append((v,)) - else: - final_limit_info[key].append(tuple(v)) - return final_limit_info - - def _results_to_features(self, base, results): - """Add parsed dictionaries of results to Biopython SeqFeatures. - """ - base = self._add_annotations(base, results.get('annotation', [])) - for feature in results.get('feature', []): - (_, base) = self._add_toplevel_feature(base, feature) - base = self._add_parent_child_features(base, results.get('parent', []), - results.get('child', [])) - base = self._add_seqs(base, results.get('fasta', [])) - base = self._add_directives(base, results.get('directive', [])) - return base - - def _add_directives(self, base, directives): - """Handle any directives or meta-data in the GFF file. - - Relevant items are added as annotation meta-data to each record. - """ - dir_keyvals = collections.defaultdict(list) - for directive in directives: - parts = directive.split() - if len(parts) > 1: - key = parts[0] - if len(parts) == 2: - val = parts[1] - else: - val = tuple(parts[1:]) - dir_keyvals[key].append(val) - for key, vals in dir_keyvals.items(): - for rec in base.values(): - self._add_ann_to_rec(rec, key, vals) - return base - - def _add_seqs(self, base, recs): - """Add sequence information contained in the GFF3 to records. - """ - for rec in recs: - if base.has_key(rec.id): - base[rec.id].seq = rec.seq - else: - base[rec.id] = rec - return base - - def _add_parent_child_features(self, base, parents, children): - """Add nested features with parent child relationships. - """ - multi_remap = self._identify_dup_ids(parents) - # add children features - children_prep = collections.defaultdict(list) - for child_dict in children: - child_feature = self._get_feature(child_dict) - for pindex, pid in enumerate(child_feature.qualifiers['Parent']): - if multi_remap.has_key(pid): - pid = multi_remap[pid].remap_id(child_dict) - child_feature.qualifiers['Parent'][pindex] = pid - children_prep[pid].append((child_dict['rec_id'], - child_feature)) - children = dict(children_prep) - # add children to parents that exist - for cur_parent_dict in parents: - cur_id = cur_parent_dict['id'] - if multi_remap.has_key(cur_id): - cur_parent_dict['id'] = multi_remap[cur_id].remap_id( - cur_parent_dict) - cur_parent, base = self._add_toplevel_feature(base, cur_parent_dict) - cur_parent, children = self._add_children_to_parent(cur_parent, - children) - # create parents for children without them (GFF2 or split/bad files) - while len(children) > 0: - parent_id, cur_children = itertools.islice(children.items(), - 1).next() - # one child, do not nest it - if len(cur_children) == 1: - rec_id, child = cur_children[0] - loc = (child.location.nofuzzy_start, child.location.nofuzzy_end) - rec, base = self._get_rec(base, - dict(rec_id=rec_id, location=loc)) - rec.features.append(child) - del children[parent_id] - else: - cur_parent, base = self._add_missing_parent(base, parent_id, - cur_children) - cur_parent, children = self._add_children_to_parent(cur_parent, - children) - return base - - def _identify_dup_ids(self, parents): - """Identify duplicated ID attributes in potential nested parents. - - According to the GFF3 spec ID attributes are supposed to be unique - for a file, but this is not always true in practice. This looks - for duplicates, and provides unique IDs sorted by locations. - """ - multi_ids = collections.defaultdict(list) - for parent in parents: - multi_ids[parent['id']].append(parent) - multi_ids = [(mid, parents) for (mid, parents) in multi_ids.items() - if len(parents) > 1] - multi_remap = dict() - for mid, parents in multi_ids: - multi_remap[mid] = _MultiIDRemapper(mid, parents) - return multi_remap - - def _add_children_to_parent(self, cur_parent, children): - """Recursively add children to parent features. - """ - if children.has_key(cur_parent.id): - cur_children = children[cur_parent.id] - for rec_id, cur_child in cur_children: - cur_child, children = self._add_children_to_parent(cur_child, - children) - cur_parent.location_operator = "join" - cur_parent.sub_features.append(cur_child) - del children[cur_parent.id] - return cur_parent, children - - def _add_annotations(self, base, anns): - """Add annotation data from the GFF file to records. - """ - # add these as a list of annotations, checking not to overwrite - # current values - for ann in anns: - rec, base = self._get_rec(base, ann) - for key, vals in ann['quals'].items(): - self._add_ann_to_rec(rec, key, vals) - return base - - def _add_ann_to_rec(self, rec, key, vals): - """Add a key/value annotation to the given SeqRecord. - """ - if rec.annotations.has_key(key): - try: - rec.annotations[key].extend(vals) - except AttributeError: - rec.annotations[key] = [rec.annotations[key]] + vals - else: - rec.annotations[key] = vals - - def _get_rec(self, base, info_dict): - """Retrieve a record to add features to. - """ - max_loc = info_dict.get('location', (0, 1))[1] - try: - cur_rec = base[info_dict['rec_id']] - # update generated unknown sequences with the expected maximum length - if isinstance(cur_rec.seq, UnknownSeq): - cur_rec.seq._length = max([max_loc, cur_rec.seq._length]) - return cur_rec, base - except KeyError: - if self._create_missing: - new_rec = SeqRecord(UnknownSeq(max_loc), info_dict['rec_id']) - base[info_dict['rec_id']] = new_rec - return new_rec, base - else: - raise - - def _add_missing_parent(self, base, parent_id, cur_children): - """Add a new feature that is missing from the GFF file. - """ - base_rec_id = list(set(c[0] for c in cur_children)) - assert len(base_rec_id) == 1 - feature_dict = dict(id=parent_id, strand=None, - type="inferred_parent", quals=dict(ID=[parent_id]), - rec_id=base_rec_id[0]) - coords = [(c.location.nofuzzy_start, c.location.nofuzzy_end) - for r, c in cur_children] - feature_dict["location"] = (min([c[0] for c in coords]), - max([c[1] for c in coords])) - return self._add_toplevel_feature(base, feature_dict) - - def _add_toplevel_feature(self, base, feature_dict): - """Add a toplevel non-nested feature to the appropriate record. - """ - new_feature = self._get_feature(feature_dict) - rec, base = self._get_rec(base, feature_dict) - rec.features.append(new_feature) - return new_feature, base - - def _get_feature(self, feature_dict): - """Retrieve a Biopython feature from our dictionary representation. - """ - location = FeatureLocation(*feature_dict['location']) - new_feature = SeqFeature(location, feature_dict['type'], - id=feature_dict['id'], strand=feature_dict['strand']) - new_feature.qualifiers = feature_dict['quals'] - return new_feature - - def _parse_fasta(self, in_handle): - """Parse FASTA sequence information contained in the GFF3 file. - """ - return list(SeqIO.parse(in_handle, "fasta")) - -class _GFFParserLocalOut: - """Provide a collector for local GFF MapReduce file parsing. - """ - def __init__(self, smart_breaks=False): - self._items = dict() - self._smart_breaks = smart_breaks - self._missing_keys = collections.defaultdict(int) - self._last_parent = None - self.can_break = True - self.num_lines = 0 - - def add(self, key, vals): - if self._smart_breaks: - # if we are not GFF2 we expect parents and break - # based on not having missing ones - if key == 'directive': - if vals[0] == '#': - self.can_break = True - self._last_parent = None - elif not vals[0].get("is_gff2", False): - self._update_missing_parents(key, vals) - self.can_break = (len(self._missing_keys) == 0) - # break when we are done with stretches of child features - elif key != 'child': - self.can_break = True - self._last_parent = None - # break when we have lots of child features in a row - # and change between parents - else: - cur_parent = vals[0]["quals"]["Parent"][0] - if (self._last_parent): - self.can_break = (cur_parent != self._last_parent) - self._last_parent = cur_parent - self.num_lines += 1 - try: - self._items[key].extend(vals) - except KeyError: - self._items[key] = vals - - def _update_missing_parents(self, key, vals): - # smart way of deciding if we can break this. - # if this is too much, can go back to not breaking in the - # middle of children - if key in ["child"]: - for val in vals: - for p_id in val["quals"]["Parent"]: - self._missing_keys[p_id] += 1 - for val in vals: - try: - del self._missing_keys[val["quals"]["ID"][0]] - except KeyError: - pass - - def has_items(self): - return len(self._items) > 0 - - def get_results(self): - self._last_parent = None - return self._items - -class GFFParser(_AbstractMapReduceGFF): - """Local GFF parser providing standardized parsing of GFF3 and GFF2 files. - """ - def __init__(self, line_adjust_fn=None, create_missing=True): - _AbstractMapReduceGFF.__init__(self, create_missing=create_missing) - self._line_adjust_fn = line_adjust_fn - - def _gff_process(self, gff_files, limit_info, target_lines): - """Process GFF addition without any parallelization. - - In addition to limit filtering, this accepts a target_lines attribute - which provides a number of lines to parse before returning results. - This allows partial parsing of a file to prevent memory issues. - """ - line_gen = self._file_line_generator(gff_files) - for out in self._lines_to_out_info(line_gen, limit_info, target_lines): - yield out - - def _file_line_generator(self, gff_files): - """Generate single lines from a set of GFF files. - """ - for gff_file in gff_files: - if hasattr(gff_file, "read"): - need_close = False - in_handle = gff_file - else: - need_close = True - in_handle = open(gff_file) - found_seqs = False - while 1: - line = in_handle.readline() - if not line: - break - yield line - if need_close: - in_handle.close() - - def _lines_to_out_info(self, line_iter, limit_info=None, - target_lines=None): - """Generate SeqRecord and SeqFeatures from GFF file lines. - """ - params = self._examiner._get_local_params(limit_info) - out_info = _GFFParserLocalOut((target_lines is not None and - target_lines > 1)) - found_seqs = False - for line in line_iter: - results = self._map_fn(line, params) - if self._line_adjust_fn and results: - if results[0][0] not in ['directive']: - results = [(results[0][0], - self._line_adjust_fn(results[0][1]))] - self._reduce_fn(results, out_info, params) - if (target_lines and out_info.num_lines >= target_lines and - out_info.can_break): - yield out_info.get_results() - out_info = _GFFParserLocalOut((target_lines is not None and - target_lines > 1)) - if (results and results[0][0] == 'directive' and - results[0][1] == 'FASTA'): - found_seqs = True - break - - class FakeHandle: - def __init__(self, line_iter): - self._iter = line_iter - def read(self): - return "".join(l for l in self._iter) - def readline(self): - try: - return self._iter.next() - except StopIteration: - return "" - - if found_seqs: - fasta_recs = self._parse_fasta(FakeHandle(line_iter)) - out_info.add('fasta', fasta_recs) - if out_info.has_items(): - yield out_info.get_results() - -class DiscoGFFParser(_AbstractMapReduceGFF): - """GFF Parser with parallelization through Disco (http://discoproject.org. - """ - def __init__(self, disco_host, create_missing=True): - """Initialize parser. - - disco_host - Web reference to a Disco host which will be used for - parallelizing the GFF reading job. - """ - _AbstractMapReduceGFF.__init__(self, create_missing=create_missing) - self._disco_host = disco_host - - def _gff_process(self, gff_files, limit_info, target_lines=None): - """Process GFF addition, using Disco to parallelize the process. - """ - assert target_lines is None, "Cannot split parallelized jobs" - # make these imports local; only need them when using disco - import simplejson - import disco - # absolute path names unless they are special disco files - full_files = [] - for f in gff_files: - if f.split(":")[0] != "disco": - full_files.append(os.path.abspath(f)) - else: - full_files.append(f) - results = disco.job(self._disco_host, name="gff_reader", - input=full_files, - params=disco.Params(limit_info=limit_info, jsonify=True, - filter_info=self._examiner._filter_info), - required_modules=["simplejson", "collections", "re"], - map=self._map_fn, reduce=self._reduce_fn) - processed = dict() - for out_key, out_val in disco.result_iterator(results): - processed[out_key] = simplejson.loads(out_val) - yield processed - -def parse(gff_files, base_dict=None, limit_info=None, target_lines=None): - """High level interface to parse GFF files into SeqRecords and SeqFeatures. - """ - parser = GFFParser() - for rec in parser.parse_in_parts(gff_files, base_dict, limit_info, - target_lines): - yield rec - -def _file_or_handle(fn): - """Decorator to handle either an input handle or a file. - """ - def _file_or_handle_inside(*args, **kwargs): - in_file = args[1] - if hasattr(in_file, "read"): - need_close = False - in_handle = in_file - else: - need_close = True - in_handle = open(in_file) - args = (args[0], in_handle) + args[2:] - out = fn(*args, **kwargs) - if need_close: - in_handle.close() - return out - return _file_or_handle_inside - -class GFFExaminer: - """Provide high level details about a GFF file to refine parsing. - - GFF is a spec and is provided by many different centers. Real life files - will present the same information in slightly different ways. Becoming - familiar with the file you are dealing with is the best way to extract the - information you need. This class provides high level summary details to - help in learning. - """ - def __init__(self): - self._filter_info = dict(gff_id = [0], gff_source_type = [1, 2], - gff_source = [1], gff_type = [2]) - - def _get_local_params(self, limit_info=None): - class _LocalParams: - def __init__(self): - self.jsonify = False - params = _LocalParams() - params.limit_info = limit_info - params.filter_info = self._filter_info - return params - - @_file_or_handle - def available_limits(self, gff_handle): - """Return dictionary information on possible limits for this file. - - This returns a nested dictionary with the following structure: - - keys -- names of items to filter by - values -- dictionary with: - keys -- filter choice - value -- counts of that filter in this file - - Not a parallelized map-reduce implementation. - """ - cur_limits = dict() - for filter_key in self._filter_info.keys(): - cur_limits[filter_key] = collections.defaultdict(int) - for line in gff_handle: - # when we hit FASTA sequences, we are done with annotations - if line.startswith("##FASTA"): - break - # ignore empty and comment lines - if line.strip() and line.strip()[0] != "#": - parts = [p.strip() for p in line.split('\t')] - assert len(parts) == 9, line - for filter_key, cur_indexes in self._filter_info.items(): - cur_id = tuple([parts[i] for i in cur_indexes]) - cur_limits[filter_key][cur_id] += 1 - # get rid of the default dicts - final_dict = dict() - for key, value_dict in cur_limits.items(): - if len(key) == 1: - key = key[0] - final_dict[key] = dict(value_dict) - gff_handle.close() - return final_dict - - @_file_or_handle - def parent_child_map(self, gff_handle): - """Provide a mapping of parent to child relationships in the file. - - Returns a dictionary of parent child relationships: - - keys -- tuple of (source, type) for each parent - values -- tuple of (source, type) as children of that parent - - Not a parallelized map-reduce implementation. - """ - # collect all of the parent and child types mapped to IDs - parent_sts = dict() - child_sts = collections.defaultdict(list) - for line in gff_handle: - # when we hit FASTA sequences, we are done with annotations - if line.startswith("##FASTA"): - break - if line.strip(): - line_type, line_info = _gff_line_map(line, - self._get_local_params())[0] - if (line_type == 'parent' or (line_type == 'child' and - line_info['id'])): - parent_sts[line_info['id']] = ( - line_info['quals']['source'][0], line_info['type']) - if line_type == 'child': - for parent_id in line_info['quals']['Parent']: - child_sts[parent_id].append(( - line_info['quals']['source'][0], line_info['type'])) - #print parent_sts, child_sts - # generate a dictionary of the unique final type relationships - pc_map = collections.defaultdict(list) - for parent_id, parent_type in parent_sts.items(): - for child_type in child_sts[parent_id]: - pc_map[parent_type].append(child_type) - pc_final_map = dict() - for ptype, ctypes in pc_map.items(): - unique_ctypes = list(set(ctypes)) - unique_ctypes.sort() - pc_final_map[ptype] = unique_ctypes - return pc_final_map
--- a/gtf_to_gff.py Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,85 +0,0 @@ -#!/usr/bin/env python -""" -Convert Gene Transfer Format [GTF] to Generic Feature Format Version 3 [GFF3]. - -Usage: python gtf_to_gff.py in.gtf > out.gff3 - -Requirement: - GFFParser.py: https://github.com/vipints/GFFtools-GX/blob/master/GFFParser.py - helper.py : https://github.com/vipints/GFFtools-GX/blob/master/helper.py - -Copyright (C) - 2009-2012 Friedrich Miescher Laboratory of the Max Planck Society, Tubingen, Germany. - 2012-2014 Memorial Sloan Kettering Cancer Center New York City, USA. -""" - -import re -import sys -import GFFParser -import helper - -def GFFWriter(gtf_content): - """ - write the feature information to GFF format - - @args gtf_content: Parsed object from gtf file - @type gtf_content: numpy array - """ - - print '##gff-version 3' - - for ent1 in gtf_content: - - chr_name = ent1['chr'] - strand = ent1['strand'] - start = ent1['start'] - stop = ent1['stop'] - source = ent1['source'] - ID = ent1['name'] - Name = ent1['gene_info']['Name'] - - Name = ID if not Name else Name - - print '%s\t%s\tgene\t%d\t%d\t.\t%s\t.\tID=%s;Name=%s' % (chr_name, source, start, stop, strand, ID, Name) - - for idx, tid in enumerate(ent1['transcripts']): - print idx - print tid - - t_start = ent1['exons'][idx][0][0] - t_stop = ent1['exons'][idx][-1][-1] - t_type = ent1['transcript_type'][idx] - - utr5_exons, utr3_exons = [], [] - if ent1['exons'][idx].any() and ent1['cds_exons'][idx].any(): - utr5_exons, utr3_exons = helper.buildUTR(ent1['cds_exons'][idx], ent1['exons'][idx], strand) - - print '%s\t%s\t%s\t%d\t%d\t.\t%s\t.\tID=%s;Parent=%s' % (chr_name, source, t_type, t_start, t_stop, strand, tid[0], ID) - - for ex_cod in utr5_exons: - print '%s\t%s\tfive_prime_UTR\t%d\t%d\t.\t%s\t.\tParent=%s' % (chr_name, source, ex_cod[0], ex_cod[1], strand, tid[0]) - - for ex_cod in ent1['cds_exons'][idx]: - print '%s\t%s\tCDS\t%d\t%d\t.\t%s\t%d\tParent=%s' % (chr_name, source, ex_cod[0], ex_cod[1], strand, ex_cod[2], tid[0]) - - for ex_cod in utr3_exons: - print '%s\t%s\tthree_prime_UTR\t%d\t%d\t.\t%s\t.\tParent=%s' % (chr_name, source, ex_cod[0], ex_cod[1], strand, tid[0]) - - for ex_cod in ent1['exons'][idx]: - print '%s\t%s\texon\t%d\t%d\t.\t%s\t.\tParent=%s' % (chr_name, source, ex_cod[0], ex_cod[1], strand, tid[0]) - - -def __main__(): - - try: - gtf_fname = sys.argv[1] - except: - print __doc__ - sys.exit(-1) - - gtf_file_content = GFFParser.Parse(gtf_fname) - - GFFWriter(gtf_file_content) - -if __name__ == "__main__": - __main__()
--- a/gtf_to_gff.xml Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,94 +0,0 @@ -<tool id="fml_gtf2gff" name="GTF-to-GFF" version="2.0.0"> - <description>converter</description> - <command interpreter="python">gtf_to_gff.py $inf_gtf > $gff3_format - </command> - <inputs> - <param format="gtf" name="inf_gtf" type="data" label="Convert this query" help="Provide genome annotation file in GTF."/> - </inputs> - <outputs> - <data format="gff3" name="gff3_format" label="${tool.name} on ${on_string}: Converted" /> - </outputs> - <tests> - <test> - <param name="inf_gtf" value="UCSC_transcripts.gtf" /> - <output name="gff3_format" file="UCSC_transcripts.gff3" /> - </test> - <test> - <param name="inf_gtf" value="JGI_genes.gtf" /> - <output name="gff3_format" file="JGI_genes.gff3" /> - </test> - <test> - <param name="inf_gtf" value="ENSEMBL_mm9.gtf" /> - <output name="gff3_format" file="ENSEMBL_mm9.gff3" /> - </test> - <test> - <param name="inf_gtf" value="AceView_ncbi_37.gtf" /> - <output name="gff3_format" file="AceView_ncbi_37.gff3" /> - </test> - </tests> - <help> - -**What it does** - -This tool converts data from GTF to a valid GFF3 file (scroll down for format description). - --------- - -**Example** - -- The following data in GTF format:: - - 17 protein_coding exon 7255208 7258258 . + . gene_id "ENSG00000213859"; transcript_id "ENST00000333751"; exon_number "1"; gene_name "KCTD11"; transcript_name "KCTD11-001"; - 17 protein_coding CDS 7256262 7256957 . + 0 gene_id "ENSG00000213859"; transcript_id "ENST00000333751"; exon_number "1"; gene_name "KCTD11"; transcript_name "KCTD11-001"; protein_id "ENSP00000328352"; - 17 protein_coding start_codon 7256262 7256264 . + 0 gene_id "ENSG00000213859"; transcript_id "ENST00000333751"; exon_number "1"; gene_name "KCTD11"; transcript_name "KCTD11-001"; - 17 protein_coding stop_codon 7256958 7256960 . + 0 gene_id "ENSG00000213859"; transcript_id "ENST00000333751"; exon_number "1"; gene_name "KCTD11"; transcript_name "KCTD11-001"; - -- Will be converted to GFF3 format:: - - ##gff-version 3 - 17 protein_coding gene 7255208 7258258 . + . ID=ENSG00000213859;Name=KCTD11 - 17 protein_coding mRNA 7255208 7258258 . + . ID=ENST00000333751;Name=KCTD11-001;Parent=ENSG00000213859 - 17 protein_coding protein 7256262 7256960 . + . ID=ENSP00000328352;Name=KCTD11-001;Parent=ENST00000333751 - 17 protein_coding five_prime_UTR 7255208 7256261 . + . Parent=ENST00000333751 - 17 protein_coding CDS 7256262 7256960 . + 0 Name=CDS:KCTD11;Parent=ENST00000333751,ENSP00000328352 - 17 protein_coding three_prime_UTR 7256961 7258258 . + . Parent=ENST00000333751 - 17 protein_coding exon 7255208 7258258 . + . Parent=ENST00000333751 - --------- - -**About formats** - -**GTF format** Gene Transfer Format, it borrows from GFF, but has additional structure that warrants a separate definition and format name. GTF lines have nine tab-seaparated fields:: - - 1. seqname - The name of the sequence. - 2. source - This indicating where the annotation came from. - 3. feature - The name of the feature types. The following feature types are required: 'CDS', 'start_codon' and 'stop_codon' - 4. start - The starting position of the feature in the sequence. The first base is numbered 1. - 5. end - The ending position of the feature (inclusive). - 6. score - The score field indicates a degree of confidence in the feature's existence and coordinates. - 7. strand - Valid entries include '+', '-', or '.' - 8. frame - If the feature is a coding exon, frame should be a number between 0-2 that represents the reading frame of the first base. - 9. attributes - These attributes are designed for handling multiple transcripts from the same genomic region. - -**GFF3 format** General Feature Format is a format for describing genes and other features associated with DNA, RNA and Protein sequences. GFF3 lines have nine tab-separated fields:: - - 1. seqid - Must be a chromosome or scaffold. - 2. source - The program that generated this feature. - 3. type - The name of this type of feature. Some examples of standard feature types are "gene", "CDS", "protein", "mRNA", and "exon". - 4. start - The starting position of the feature in the sequence. The first base is numbered 1. - 5. stop - The ending position of the feature (inclusive). - 6. score - A score between 0 and 1000. If there is no score value, enter ".". - 7. strand - Valid entries include '+', '-', or '.' (for don't know/care). - 8. phase - If the feature is a coding exon, frame should be a number between 0-2 that represents the reading frame of the first base. If the feature is not a coding exon, the value should be '.'. - 9. attributes - All lines with the same group are linked together into a single item. - --------- - -**Copyright** - -2009-2014 Max Planck Society, University of Tübingen & Memorial Sloan Kettering Cancer Center - -Sreedharan VT, Schultheiss SJ, Jean G, Kahles A, Bohnert R, Drewe P, Mudrakarta P, Görnitz N, Zeller G, Rätsch G. Oqtans: the RNA-seq workbench in the cloud for complete and reproducible quantitative transcriptome analysis. Bioinformatics 10.1093/bioinformatics/btt731 (2014) - - </help> -</tool>
--- a/helper.py Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,332 +0,0 @@ -#!/usr/bin/env python -""" -Common utility functions -""" - -import os -import re -import sys -import gzip -import bz2 -import numpy - -def init_gene(): - """ - Initializing the gene structure - """ - - gene_det = [('id', 'f8'), - ('anno_id', numpy.dtype), - ('confgenes_id', numpy.dtype), - ('name', 'S25'), - ('source', 'S25'), - ('gene_info', numpy.dtype), - ('alias', 'S15'), - ('name2', numpy.dtype), - ('strand', 'S2'), - ('score', 'S15'), - ('chr', 'S15'), - ('chr_num', numpy.dtype), - ('paralogs', numpy.dtype), - ('start', 'f8'), - ('stop', 'f8'), - ('transcripts', numpy.dtype), - ('transcript_type', numpy.dtype), - ('transcript_info', numpy.dtype), - ('transcript_status', numpy.dtype), - ('transcript_valid', numpy.dtype), - ('exons', numpy.dtype), - ('exons_confirmed', numpy.dtype), - ('cds_exons', numpy.dtype), - ('utr5_exons', numpy.dtype), - ('utr3_exons', numpy.dtype), - ('tis', numpy.dtype), - ('tis_conf', numpy.dtype), - ('tis_info', numpy.dtype), - ('cdsStop', numpy.dtype), - ('cdsStop_conf', numpy.dtype), - ('cdsStop_info', numpy.dtype), - ('tss', numpy.dtype), - ('tss_info', numpy.dtype), - ('tss_conf', numpy.dtype), - ('cleave', numpy.dtype), - ('cleave_info', numpy.dtype), - ('cleave_conf', numpy.dtype), - ('polya', numpy.dtype), - ('polya_info', numpy.dtype), - ('polya_conf', numpy.dtype), - ('is_alt', 'f8'), - ('is_alt_spliced', 'f8'), - ('is_valid', numpy.dtype), - ('transcript_complete', numpy.dtype), - ('is_complete', numpy.dtype), - ('is_correctly_gff3_referenced', 'S5'), - ('splicegraph', numpy.dtype) ] - - return gene_det - -def open_file(fname): - """ - Open the file (supports .gz .bz2) and returns the handler - - @args fname: input file name for reading - @type fname: str - """ - - try: - if os.path.splitext(fname)[1] == ".gz": - FH = gzip.open(fname, 'rb') - elif os.path.splitext(fname)[1] == ".bz2": - FH = bz2.BZ2File(fname, 'rb') - else: - FH = open(fname, 'rU') - except Exception as error: - sys.exit(error) - - return FH - -def add_CDS_phase(strand, cds): - """ - Calculate CDS phase and add to the CDS exons - - @args strand: feature strand information - @type strand: +/- - @args cds: coding exon coordinates - @type cds: numpy array [[int, int, int]] - """ - - cds_region, cds_flag = [], 0 - if strand == '+': - for cdspos in cds: - if cds_flag == 0: - cdspos = (cdspos[0], cdspos[1], 0) - diff = (cdspos[1]-(cdspos[0]-1))%3 - else: - xy = 0 - if diff == 0: - cdspos = (cdspos[0], cdspos[1], 0) - elif diff == 1: - cdspos = (cdspos[0], cdspos[1], 2) - xy = 2 - elif diff == 2: - cdspos = (cdspos[0], cdspos[1], 1) - xy = 1 - diff = ((cdspos[1]-(cdspos[0]-1))-xy)%3 - cds_region.append(cdspos) - cds_flag = 1 - elif strand == '-': - cds.reverse() - for cdspos in cds: - if cds_flag == 0: - cdspos = (cdspos[0], cdspos[1], 0) - diff = (cdspos[1]-(cdspos[0]-1))%3 - else: - xy = 0 - if diff == 0: - cdspos = (cdspos[0], cdspos[1], 0) - elif diff == 1: - cdspos = (cdspos[0], cdspos[1], 2) - xy = 2 - elif diff == 2: - cdspos = (cdspos[0], cdspos[1], 1) - xy = 1 - diff = ((cdspos[1]-(cdspos[0]-1))-xy)%3 - cds_region.append(cdspos) - cds_flag = 1 - cds_region.reverse() - return cds_region - -def buildUTR(cc, ec, strand): - """ - Build UTR regions from a given set of CDS and exon coordiantes of a gene - - @args cc: coding exon coordinates - @type cc: numpy array [[int, int, int]] - @args ec: exon coordinates - @type ec: numpy array [[int, int]] - @args strand: feature strand information - @type strand: +/- - """ - - utr5 = [] - utr3 = [] - if strand == '+': - cds_s = cc[0][0] - for ex in ec: - if ex[0] <= cds_s and cds_s <= ex[1]: - if ex[0] != cds_s:utr5.append((ex[0], cds_s-1)) - break - else: - utr5.append(ex) - cds_e = cc[-1][1] - for i in range(len(ec)): - i += 1 - if ec[-i][0] <= cds_e and cds_e <= ec[-i][1]: - if ec[-i][1] != cds_e:utr3.append((cds_e +1, ec[-i][1])) - break - else: - utr3.append(ec[-i]) - utr3.reverse() - elif strand == '-': - cds_s = cc[-1][1] - for i in range(len(ec)): - i += 1 - if ec[-i][0] <= cds_s and cds_s <= ec[-i][1]: - if ec[-i][1] != cds_s:utr5.append((cds_s+1, ec[-i][1])) - break - else: - utr5.append(ec[-i]) - utr5.reverse() - cds_e = cc[0][0] - for ex in ec: - if ex[0] <= cds_e and cds_e <= ex[1]: - if ex[0] != cds_e:utr3.append((ex[0], cds_e-1)) - break - else: - utr3.append(ex) - return utr5, utr3 - -def make_Exon_cod(strand_p, five_p_utr, cds_cod, three_p_utr): - """ - Create exon cordinates from UTR's and CDS region - - @args strand_p: feature strand information - @type strand_p: +/- - @args five_p_utr: five prime utr exon coordinates - @type five_p_utr: numpy array [[int, int]] - @args cds_cod: coding exon coordinates - @type cds_cod: numpy array [[int, int, int]] - @args three_p_utr: three prime utr exon coordinates - @type three_p_utr: numpy array [[int, int]] - """ - - exon_pos = [] - if strand_p == '+': - utr5_start, utr5_end = 0, 0 - if five_p_utr != []: - utr5_start, utr5_end = five_p_utr[-1][0], five_p_utr[-1][1] - cds_5start, cds_5end = cds_cod[0][0], cds_cod[0][1] - jun_exon = [] - if cds_5start-utr5_end == 0 or cds_5start-utr5_end == 1: - jun_exon = [utr5_start, cds_5end] - if len(cds_cod) == 1: - five_prime_flag = 0 - if jun_exon != []: - five_p_utr = five_p_utr[:-1] - five_prime_flag = 1 - for utr5 in five_p_utr: - exon_pos.append(utr5) - jun_exon = [] - utr3_start, utr3_end = 0, 0 - if three_p_utr != []: - utr3_start = three_p_utr[0][0] - utr3_end = three_p_utr[0][1] - if utr3_start-cds_5end == 0 or utr3_start-cds_5end == 1: - jun_exon = [cds_5start, utr3_end] - three_prime_flag = 0 - if jun_exon != []: - cds_cod = cds_cod[:-1] - three_p_utr = three_p_utr[1:] - three_prime_flag = 1 - if five_prime_flag == 1 and three_prime_flag == 1: - exon_pos.append([utr5_start, utr3_end]) - if five_prime_flag == 1 and three_prime_flag == 0: - exon_pos.append([utr5_start, cds_5end]) - cds_cod = cds_cod[:-1] - if five_prime_flag == 0 and three_prime_flag == 1: - exon_pos.append([cds_5start, utr3_end]) - for cds in cds_cod: - exon_pos.append(cds) - for utr3 in three_p_utr: - exon_pos.append(utr3) - else: - if jun_exon != []: - five_p_utr = five_p_utr[:-1] - cds_cod = cds_cod[1:] - for utr5 in five_p_utr: - exon_pos.append(utr5) - exon_pos.append(jun_exon) if jun_exon != [] else '' - jun_exon = [] - utr3_start, utr3_end = 0, 0 - if three_p_utr != []: - utr3_start = three_p_utr[0][0] - utr3_end = three_p_utr[0][1] - cds_3start = cds_cod[-1][0] - cds_3end = cds_cod[-1][1] - if utr3_start-cds_3end == 0 or utr3_start-cds_3end == 1: - jun_exon = [cds_3start, utr3_end] - if jun_exon != []: - cds_cod = cds_cod[:-1] - three_p_utr = three_p_utr[1:] - for cds in cds_cod: - exon_pos.append(cds) - exon_pos.append(jun_exon) if jun_exon != [] else '' - for utr3 in three_p_utr: - exon_pos.append(utr3) - elif strand_p == '-': - utr3_start, utr3_end = 0, 0 - if three_p_utr != []: - utr3_start = three_p_utr[-1][0] - utr3_end = three_p_utr[-1][1] - cds_3start = cds_cod[0][0] - cds_3end = cds_cod[0][1] - jun_exon = [] - if cds_3start-utr3_end == 0 or cds_3start-utr3_end == 1: - jun_exon = [utr3_start, cds_3end] - if len(cds_cod) == 1: - three_prime_flag = 0 - if jun_exon != []: - three_p_utr = three_p_utr[:-1] - three_prime_flag = 1 - for utr3 in three_p_utr: - exon_pos.append(utr3) - jun_exon = [] - (utr5_start, utr5_end) = (0, 0) - if five_p_utr != []: - utr5_start = five_p_utr[0][0] - utr5_end = five_p_utr[0][1] - if utr5_start-cds_3end == 0 or utr5_start-cds_3end == 1: - jun_exon = [cds_3start, utr5_end] - five_prime_flag = 0 - if jun_exon != []: - cds_cod = cds_cod[:-1] - five_p_utr = five_p_utr[1:] - five_prime_flag = 1 - if three_prime_flag == 1 and five_prime_flag == 1: - exon_pos.append([utr3_start, utr5_end]) - if three_prime_flag == 1 and five_prime_flag == 0: - exon_pos.append([utr3_start, cds_3end]) - cds_cod = cds_cod[:-1] - if three_prime_flag == 0 and five_prime_flag == 1: - exon_pos.append([cds_3start, utr5_end]) - for cds in cds_cod: - exon_pos.append(cds) - for utr5 in five_p_utr: - exon_pos.append(utr5) - else: - if jun_exon != []: - three_p_utr = three_p_utr[:-1] - cds_cod = cds_cod[1:] - for utr3 in three_p_utr: - exon_pos.append(utr3) - if jun_exon != []: - exon_pos.append(jun_exon) - jun_exon = [] - (utr5_start, utr5_end) = (0, 0) - if five_p_utr != []: - utr5_start = five_p_utr[0][0] - utr5_end = five_p_utr[0][1] - cds_5start = cds_cod[-1][0] - cds_5end = cds_cod[-1][1] - if utr5_start-cds_5end == 0 or utr5_start-cds_5end == 1: - jun_exon = [cds_5start, utr5_end] - if jun_exon != []: - cds_cod = cds_cod[:-1] - five_p_utr = five_p_utr[1:] - for cds in cds_cod: - exon_pos.append(cds) - if jun_exon != []: - exon_pos.append(jun_exon) - for utr5 in five_p_utr: - exon_pos.append(utr5) - return exon_pos
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/CCDS30770.bed Thu Apr 23 17:57:49 2015 -0400 @@ -0,0 +1,20 @@ +chr1 92149295 92327088 CCDS30770.1 0 - 92149295 92327088 0 16 119,108,42,121,300,159,141,153,338,190,148,169,184,138,185,61, 0,11933,14350,24924,28504,32497,32829,35573,36154,38216,43920,46066,51037,74874,113548,177732, +chr1 67000041 67208778 CCDS30744.1 0 + 67000041 67208778 0 25 10,64,25,72,57,55,176,12,12,25,52,86,93,75,501,128,127,60,112,156,133,203,65,165,23, 0,91488,98711,101585,105418,108451,109185,126154,133171,136636,137585,138922,142645,145319,147510,154789,155831,161075,184935,194905,199389,204976,206299,206913,208714, +chr1 8384389 8404073 CCDS30577.1 0 + 8384389 8404073 0 8 397,93,225,728,154,177,206,267, 0,968,1488,5879,11107,13486,15163,19417, +chr1 16767256 16785385 CCDS44067.1 0 + 16767256 16785385 0 8 14,101,105,82,109,178,76,49, 0,2870,7108,7298,8331,11076,15056,18080, +chr1 16767256 16785491 CCDS44066.1 0 + 16767256 16785491 0 7 92,101,105,82,109,178,155, 0,2870,7108,7298,8331,11076,18080, +chr1 16767256 16785385 CCDS173.1 0 + 16767256 16785385 0 8 92,101,105,82,109,178,76,49, 0,2870,7108,7298,8331,11076,15056,18080, +chr1 25072044 25167428 CCDS256.1 0 + 25072044 25167428 0 6 72,110,126,107,182,165, 0,52188,68540,81456,94306,95219, +chr1 33547850 33585783 CCDS375.1 0 + 33547850 33585783 0 9 105,174,173,135,166,163,113,215,139, 0,1704,9800,11032,12298,14457,15817,35652,37794, +chr1 48999844 50489468 CCDS44137.1 0 - 48999844 50489468 0 14 121,27,97,163,153,112,115,90,40,217,95,125,123,34, 0,717,5469,52831,56660,100320,119164,128979,333018,511411,711597,1163140,1317223,1489590, +chr1 100661810 100715376 CCDS767.1 0 - 100661810 100715376 0 11 168,72,192,78,167,217,122,182,76,124,51, 0,9975,10190,14439,18562,19728,22371,34478,39181,44506,53515, +chr1 150981108 151006710 CCDS977.1 0 + 150981108 151006710 0 8 39,93,203,185,159,95,159,429, 0,9179,9834,15978,16882,18600,20153,25173, +chr1 175914288 176176114 CCDS44279.1 0 - 175914288 176176114 0 19 18,45,161,125,118,117,82,109,144,136,115,58,77,69,120,65,98,60,407, 0,2042,41790,43135,44209,82419,98033,98557,101028,135999,140623,171471,189857,203853,217716,218674,230757,239480,261419, +chr1 175914288 176176114 CCDS30944.1 0 - 175914288 176176114 0 20 18,45,161,125,118,117,82,109,144,136,115,58,77,60,69,120,77,98,60,407, 0,2042,41790,43135,44209,82419,98033,98557,101028,135999,140623,171471,189857,191335,203853,217716,218662,230757,239480,261419, +chr1 184446643 184588690 CCDS1362.1 0 + 184446643 184588690 0 5 94,95,77,61,39, 0,30078,113229,120891,142008, +chr1 226420201 226496888 CCDS1553.1 0 - 226420201 226496888 0 15 106,98,180,126,81,102,120,134,158,126,134,105,95,33,79, 0,595,843,6470,18338,33032,33712,35456,45274,53832,55163,63341,65218,68672,76608, +chr1 1982069 2116448 CCDS37.1 0 + 1982069 2116448 0 18 71,122,90,51,86,132,82,53,189,98,87,136,88,120,80,90,116,88, 0,4810,5853,8910,84631,93579,95396,98241,100159,105364,118887,121424,121670,123266,124123,124593,133952,134291, +chr1 2075777 2116448 CCDS41229.1 0 + 2075777 2116448 0 13 3,82,53,189,98,87,136,88,120,80,90,116,88, 0,1688,4533,6451,11656,25179,27716,27962,29558,30415,30885,40244,40583, +chr1 2985823 3350375 CCDS44048.1 0 + 2985823 3350375 0 17 37,350,51,135,103,208,148,154,1417,85,170,78,170,175,237,175,78, 0,116865,174827,315892,327231,333531,335479,336235,342124,345303,348568,349407,356321,356791,361612,362706,364474, +chr1 2985823 3350375 CCDS41236.1 0 + 2985823 3350375 0 17 37,350,51,135,103,208,148,154,1417,85,170,78,170,175,237,175,135, 0,116865,174827,315892,327231,333531,335479,336235,342124,345303,348568,349407,356321,356791,361612,362706,364417, +chr1 6285139 6295971 CCDS61.1 0 - 6285139 6295971 0 5 183,218,170,89,195, 0,6822,8394,9806,10637,
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/CCDS30770.gff Thu Apr 23 17:57:49 2015 -0400 @@ -0,0 +1,289 @@ +chr1 bed2gff gene 92149296 92327088 0 - . ID=Gene:CCDS30770.1;Name=Gene:CCDS30770.1 +chr1 bed2gff transcript 92149296 92327088 0 - . ID=CCDS30770.1;Name=CCDS30770.1;Parent=Gene:CCDS30770.1 +chr1 bed2gff exon 92149296 92149414 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92161229 92161336 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92163646 92163687 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92174220 92174340 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92177800 92178099 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92181793 92181951 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92182125 92182265 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92184869 92185021 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92185450 92185787 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92187512 92187701 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92193216 92193363 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92195362 92195530 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92200333 92200516 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92224170 92224307 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92262844 92263028 0 - . Parent=CCDS30770.1 +chr1 bed2gff exon 92327028 92327088 0 - . Parent=CCDS30770.1 +chr1 bed2gff gene 67000042 67208778 0 + . ID=Gene:CCDS30744.1;Name=Gene:CCDS30744.1 +chr1 bed2gff transcript 67000042 67208778 0 + . ID=CCDS30744.1;Name=CCDS30744.1;Parent=Gene:CCDS30744.1 +chr1 bed2gff exon 67000042 67000051 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67091530 67091593 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67098753 67098777 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67101627 67101698 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67105460 67105516 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67108493 67108547 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67109227 67109402 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67126196 67126207 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67133213 67133224 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67136678 67136702 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67137627 67137678 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67138964 67139049 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67142687 67142779 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67145361 67145435 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67147552 67148052 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67154831 67154958 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67155873 67155999 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67161117 67161176 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67184977 67185088 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67194947 67195102 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67199431 67199563 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67205018 67205220 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67206341 67206405 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67206955 67207119 0 + . Parent=CCDS30744.1 +chr1 bed2gff exon 67208756 67208778 0 + . Parent=CCDS30744.1 +chr1 bed2gff gene 8384390 8404073 0 + . ID=Gene:CCDS30577.1;Name=Gene:CCDS30577.1 +chr1 bed2gff transcript 8384390 8404073 0 + . ID=CCDS30577.1;Name=CCDS30577.1;Parent=Gene:CCDS30577.1 +chr1 bed2gff exon 8384390 8384786 0 + . Parent=CCDS30577.1 +chr1 bed2gff exon 8385358 8385450 0 + . Parent=CCDS30577.1 +chr1 bed2gff exon 8385878 8386102 0 + . Parent=CCDS30577.1 +chr1 bed2gff exon 8390269 8390996 0 + . Parent=CCDS30577.1 +chr1 bed2gff exon 8395497 8395650 0 + . Parent=CCDS30577.1 +chr1 bed2gff exon 8397876 8398052 0 + . Parent=CCDS30577.1 +chr1 bed2gff exon 8399553 8399758 0 + . Parent=CCDS30577.1 +chr1 bed2gff exon 8403807 8404073 0 + . Parent=CCDS30577.1 +chr1 bed2gff gene 16767257 16785385 0 + . ID=Gene:CCDS44067.1;Name=Gene:CCDS44067.1 +chr1 bed2gff transcript 16767257 16785385 0 + . ID=CCDS44067.1;Name=CCDS44067.1;Parent=Gene:CCDS44067.1 +chr1 bed2gff exon 16767257 16767270 0 + . Parent=CCDS44067.1 +chr1 bed2gff exon 16770127 16770227 0 + . Parent=CCDS44067.1 +chr1 bed2gff exon 16774365 16774469 0 + . Parent=CCDS44067.1 +chr1 bed2gff exon 16774555 16774636 0 + . Parent=CCDS44067.1 +chr1 bed2gff exon 16775588 16775696 0 + . Parent=CCDS44067.1 +chr1 bed2gff exon 16778333 16778510 0 + . Parent=CCDS44067.1 +chr1 bed2gff exon 16782313 16782388 0 + . Parent=CCDS44067.1 +chr1 bed2gff exon 16785337 16785385 0 + . Parent=CCDS44067.1 +chr1 bed2gff gene 16767257 16785491 0 + . ID=Gene:CCDS44066.1;Name=Gene:CCDS44066.1 +chr1 bed2gff transcript 16767257 16785491 0 + . ID=CCDS44066.1;Name=CCDS44066.1;Parent=Gene:CCDS44066.1 +chr1 bed2gff exon 16767257 16767348 0 + . Parent=CCDS44066.1 +chr1 bed2gff exon 16770127 16770227 0 + . Parent=CCDS44066.1 +chr1 bed2gff exon 16774365 16774469 0 + . Parent=CCDS44066.1 +chr1 bed2gff exon 16774555 16774636 0 + . Parent=CCDS44066.1 +chr1 bed2gff exon 16775588 16775696 0 + . Parent=CCDS44066.1 +chr1 bed2gff exon 16778333 16778510 0 + . Parent=CCDS44066.1 +chr1 bed2gff exon 16785337 16785491 0 + . Parent=CCDS44066.1 +chr1 bed2gff gene 16767257 16785385 0 + . ID=Gene:CCDS173.1;Name=Gene:CCDS173.1 +chr1 bed2gff transcript 16767257 16785385 0 + . ID=CCDS173.1;Name=CCDS173.1;Parent=Gene:CCDS173.1 +chr1 bed2gff exon 16767257 16767348 0 + . Parent=CCDS173.1 +chr1 bed2gff exon 16770127 16770227 0 + . Parent=CCDS173.1 +chr1 bed2gff exon 16774365 16774469 0 + . Parent=CCDS173.1 +chr1 bed2gff exon 16774555 16774636 0 + . Parent=CCDS173.1 +chr1 bed2gff exon 16775588 16775696 0 + . Parent=CCDS173.1 +chr1 bed2gff exon 16778333 16778510 0 + . Parent=CCDS173.1 +chr1 bed2gff exon 16782313 16782388 0 + . Parent=CCDS173.1 +chr1 bed2gff exon 16785337 16785385 0 + . Parent=CCDS173.1 +chr1 bed2gff gene 25072045 25167428 0 + . ID=Gene:CCDS256.1;Name=Gene:CCDS256.1 +chr1 bed2gff transcript 25072045 25167428 0 + . ID=CCDS256.1;Name=CCDS256.1;Parent=Gene:CCDS256.1 +chr1 bed2gff exon 25072045 25072116 0 + . Parent=CCDS256.1 +chr1 bed2gff exon 25124233 25124342 0 + . Parent=CCDS256.1 +chr1 bed2gff exon 25140585 25140710 0 + . Parent=CCDS256.1 +chr1 bed2gff exon 25153501 25153607 0 + . Parent=CCDS256.1 +chr1 bed2gff exon 25166351 25166532 0 + . Parent=CCDS256.1 +chr1 bed2gff exon 25167264 25167428 0 + . Parent=CCDS256.1 +chr1 bed2gff gene 33547851 33585783 0 + . ID=Gene:CCDS375.1;Name=Gene:CCDS375.1 +chr1 bed2gff transcript 33547851 33585783 0 + . ID=CCDS375.1;Name=CCDS375.1;Parent=Gene:CCDS375.1 +chr1 bed2gff exon 33547851 33547955 0 + . Parent=CCDS375.1 +chr1 bed2gff exon 33549555 33549728 0 + . Parent=CCDS375.1 +chr1 bed2gff exon 33557651 33557823 0 + . Parent=CCDS375.1 +chr1 bed2gff exon 33558883 33559017 0 + . Parent=CCDS375.1 +chr1 bed2gff exon 33560149 33560314 0 + . Parent=CCDS375.1 +chr1 bed2gff exon 33562308 33562470 0 + . Parent=CCDS375.1 +chr1 bed2gff exon 33563668 33563780 0 + . Parent=CCDS375.1 +chr1 bed2gff exon 33583503 33583717 0 + . Parent=CCDS375.1 +chr1 bed2gff exon 33585645 33585783 0 + . Parent=CCDS375.1 +chr1 bed2gff gene 48999845 50489468 0 - . ID=Gene:CCDS44137.1;Name=Gene:CCDS44137.1 +chr1 bed2gff transcript 48999845 50489468 0 - . ID=CCDS44137.1;Name=CCDS44137.1;Parent=Gene:CCDS44137.1 +chr1 bed2gff exon 48999845 48999965 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 49000562 49000588 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 49005314 49005410 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 49052676 49052838 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 49056505 49056657 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 49100165 49100276 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 49119009 49119123 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 49128824 49128913 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 49332863 49332902 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 49511256 49511472 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 49711442 49711536 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 50162985 50163109 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 50317068 50317190 0 - . Parent=CCDS44137.1 +chr1 bed2gff exon 50489435 50489468 0 - . Parent=CCDS44137.1 +chr1 bed2gff gene 100661811 100715376 0 - . ID=Gene:CCDS767.1;Name=Gene:CCDS767.1 +chr1 bed2gff transcript 100661811 100715376 0 - . ID=CCDS767.1;Name=CCDS767.1;Parent=Gene:CCDS767.1 +chr1 bed2gff exon 100661811 100661978 0 - . Parent=CCDS767.1 +chr1 bed2gff exon 100671786 100671857 0 - . Parent=CCDS767.1 +chr1 bed2gff exon 100672001 100672192 0 - . Parent=CCDS767.1 +chr1 bed2gff exon 100676250 100676327 0 - . Parent=CCDS767.1 +chr1 bed2gff exon 100680373 100680539 0 - . Parent=CCDS767.1 +chr1 bed2gff exon 100681539 100681755 0 - . Parent=CCDS767.1 +chr1 bed2gff exon 100684182 100684303 0 - . Parent=CCDS767.1 +chr1 bed2gff exon 100696289 100696470 0 - . Parent=CCDS767.1 +chr1 bed2gff exon 100700992 100701067 0 - . Parent=CCDS767.1 +chr1 bed2gff exon 100706317 100706440 0 - . Parent=CCDS767.1 +chr1 bed2gff exon 100715326 100715376 0 - . Parent=CCDS767.1 +chr1 bed2gff gene 150981109 151006710 0 + . ID=Gene:CCDS977.1;Name=Gene:CCDS977.1 +chr1 bed2gff transcript 150981109 151006710 0 + . ID=CCDS977.1;Name=CCDS977.1;Parent=Gene:CCDS977.1 +chr1 bed2gff exon 150981109 150981147 0 + . Parent=CCDS977.1 +chr1 bed2gff exon 150990288 150990380 0 + . Parent=CCDS977.1 +chr1 bed2gff exon 150990943 150991145 0 + . Parent=CCDS977.1 +chr1 bed2gff exon 150997087 150997271 0 + . Parent=CCDS977.1 +chr1 bed2gff exon 150997991 150998149 0 + . Parent=CCDS977.1 +chr1 bed2gff exon 150999709 150999803 0 + . Parent=CCDS977.1 +chr1 bed2gff exon 151001262 151001420 0 + . Parent=CCDS977.1 +chr1 bed2gff exon 151006282 151006710 0 + . Parent=CCDS977.1 +chr1 bed2gff gene 175914289 176176114 0 - . ID=Gene:CCDS44279.1;Name=Gene:CCDS44279.1 +chr1 bed2gff transcript 175914289 176176114 0 - . ID=CCDS44279.1;Name=CCDS44279.1;Parent=Gene:CCDS44279.1 +chr1 bed2gff exon 175914289 175914306 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 175916331 175916375 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 175956079 175956239 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 175957424 175957548 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 175958498 175958615 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 175996708 175996824 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176012322 176012403 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176012846 176012954 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176015317 176015460 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176050288 176050423 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176054912 176055026 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176085760 176085817 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176104146 176104222 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176118142 176118210 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176132005 176132124 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176132963 176133027 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176145046 176145143 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176153769 176153828 0 - . Parent=CCDS44279.1 +chr1 bed2gff exon 176175708 176176114 0 - . Parent=CCDS44279.1 +chr1 bed2gff gene 175914289 176176114 0 - . ID=Gene:CCDS30944.1;Name=Gene:CCDS30944.1 +chr1 bed2gff transcript 175914289 176176114 0 - . ID=CCDS30944.1;Name=CCDS30944.1;Parent=Gene:CCDS30944.1 +chr1 bed2gff exon 175914289 175914306 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 175916331 175916375 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 175956079 175956239 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 175957424 175957548 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 175958498 175958615 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 175996708 175996824 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176012322 176012403 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176012846 176012954 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176015317 176015460 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176050288 176050423 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176054912 176055026 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176085760 176085817 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176104146 176104222 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176105624 176105683 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176118142 176118210 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176132005 176132124 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176132951 176133027 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176145046 176145143 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176153769 176153828 0 - . Parent=CCDS30944.1 +chr1 bed2gff exon 176175708 176176114 0 - . Parent=CCDS30944.1 +chr1 bed2gff gene 184446644 184588690 0 + . ID=Gene:CCDS1362.1;Name=Gene:CCDS1362.1 +chr1 bed2gff transcript 184446644 184588690 0 + . ID=CCDS1362.1;Name=CCDS1362.1;Parent=Gene:CCDS1362.1 +chr1 bed2gff exon 184446644 184446737 0 + . Parent=CCDS1362.1 +chr1 bed2gff exon 184476722 184476816 0 + . Parent=CCDS1362.1 +chr1 bed2gff exon 184559873 184559949 0 + . Parent=CCDS1362.1 +chr1 bed2gff exon 184567535 184567595 0 + . Parent=CCDS1362.1 +chr1 bed2gff exon 184588652 184588690 0 + . Parent=CCDS1362.1 +chr1 bed2gff gene 226420202 226496888 0 - . ID=Gene:CCDS1553.1;Name=Gene:CCDS1553.1 +chr1 bed2gff transcript 226420202 226496888 0 - . ID=CCDS1553.1;Name=CCDS1553.1;Parent=Gene:CCDS1553.1 +chr1 bed2gff exon 226420202 226420307 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226420797 226420894 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226421045 226421224 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226426672 226426797 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226438540 226438620 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226453234 226453335 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226453914 226454033 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226455658 226455791 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226465476 226465633 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226474034 226474159 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226475365 226475498 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226483543 226483647 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226485420 226485514 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226488874 226488906 0 - . Parent=CCDS1553.1 +chr1 bed2gff exon 226496810 226496888 0 - . Parent=CCDS1553.1 +chr1 bed2gff gene 1982070 2116448 0 + . ID=Gene:CCDS37.1;Name=Gene:CCDS37.1 +chr1 bed2gff transcript 1982070 2116448 0 + . ID=CCDS37.1;Name=CCDS37.1;Parent=Gene:CCDS37.1 +chr1 bed2gff exon 1982070 1982140 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 1986880 1987001 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 1987923 1988012 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 1990980 1991030 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2066701 2066786 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2075649 2075780 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2077466 2077547 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2080311 2080363 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2082229 2082417 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2087434 2087531 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2100957 2101043 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2103494 2103629 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2103740 2103827 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2105336 2105455 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2106193 2106272 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2106663 2106752 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2116022 2116137 0 + . Parent=CCDS37.1 +chr1 bed2gff exon 2116361 2116448 0 + . Parent=CCDS37.1 +chr1 bed2gff gene 2075778 2116448 0 + . ID=Gene:CCDS41229.1;Name=Gene:CCDS41229.1 +chr1 bed2gff transcript 2075778 2116448 0 + . ID=CCDS41229.1;Name=CCDS41229.1;Parent=Gene:CCDS41229.1 +chr1 bed2gff exon 2075778 2075780 0 + . Parent=CCDS41229.1 +chr1 bed2gff exon 2077466 2077547 0 + . Parent=CCDS41229.1 +chr1 bed2gff exon 2080311 2080363 0 + . Parent=CCDS41229.1 +chr1 bed2gff exon 2082229 2082417 0 + . Parent=CCDS41229.1 +chr1 bed2gff exon 2087434 2087531 0 + . Parent=CCDS41229.1 +chr1 bed2gff exon 2100957 2101043 0 + . Parent=CCDS41229.1 +chr1 bed2gff exon 2103494 2103629 0 + . Parent=CCDS41229.1 +chr1 bed2gff exon 2103740 2103827 0 + . Parent=CCDS41229.1 +chr1 bed2gff exon 2105336 2105455 0 + . Parent=CCDS41229.1 +chr1 bed2gff exon 2106193 2106272 0 + . Parent=CCDS41229.1 +chr1 bed2gff exon 2106663 2106752 0 + . Parent=CCDS41229.1 +chr1 bed2gff exon 2116022 2116137 0 + . Parent=CCDS41229.1 +chr1 bed2gff exon 2116361 2116448 0 + . Parent=CCDS41229.1 +chr1 bed2gff gene 2985824 3350375 0 + . ID=Gene:CCDS44048.1;Name=Gene:CCDS44048.1 +chr1 bed2gff transcript 2985824 3350375 0 + . ID=CCDS44048.1;Name=CCDS44048.1;Parent=Gene:CCDS44048.1 +chr1 bed2gff exon 2985824 2985860 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3102689 3103038 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3160651 3160701 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3301716 3301850 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3313055 3313157 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3319355 3319562 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3321303 3321450 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3322059 3322212 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3327948 3329364 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3331127 3331211 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3334392 3334561 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3335231 3335308 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3342145 3342314 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3342615 3342789 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3347436 3347672 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3348530 3348704 0 + . Parent=CCDS44048.1 +chr1 bed2gff exon 3350298 3350375 0 + . Parent=CCDS44048.1 +chr1 bed2gff gene 2985824 3350375 0 + . ID=Gene:CCDS41236.1;Name=Gene:CCDS41236.1 +chr1 bed2gff transcript 2985824 3350375 0 + . ID=CCDS41236.1;Name=CCDS41236.1;Parent=Gene:CCDS41236.1 +chr1 bed2gff exon 2985824 2985860 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3102689 3103038 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3160651 3160701 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3301716 3301850 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3313055 3313157 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3319355 3319562 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3321303 3321450 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3322059 3322212 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3327948 3329364 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3331127 3331211 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3334392 3334561 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3335231 3335308 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3342145 3342314 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3342615 3342789 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3347436 3347672 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3348530 3348704 0 + . Parent=CCDS41236.1 +chr1 bed2gff exon 3350241 3350375 0 + . Parent=CCDS41236.1 +chr1 bed2gff gene 6285140 6295971 0 - . ID=Gene:CCDS61.1;Name=Gene:CCDS61.1 +chr1 bed2gff transcript 6285140 6295971 0 - . ID=CCDS61.1;Name=CCDS61.1;Parent=Gene:CCDS61.1 +chr1 bed2gff exon 6285140 6285322 0 - . Parent=CCDS61.1 +chr1 bed2gff exon 6291962 6292179 0 - . Parent=CCDS61.1 +chr1 bed2gff exon 6293534 6293703 0 - . Parent=CCDS61.1 +chr1 bed2gff exon 6294946 6295034 0 - . Parent=CCDS61.1 +chr1 bed2gff exon 6295777 6295971 0 - . Parent=CCDS61.1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/MB7_3R.bed Thu Apr 23 17:57:49 2015 -0400 @@ -0,0 +1,241 @@ +3R 141309 144791 CG9778-RA 1 - 141309 144791 0 5 1519,236,333,162,488, 0,2066,2368,2760,2994, +3R 226211 227739 CG14647.a 1 + 226211 227739 0 3 649,132,417, 0,864,1111, +3R 226211 227739 CG14647-RB 1 + 226211 227739 0 3 649,132,417, 0,864,1111, +3R 752642 764363 CG34306-RA 2 + 752642 764363 0 2 5670,5912, 0,5809, +3R 56500 58054.0 CG14641.a 31 - 56500 58054.0 0 1 1554, 0, +3R 56474 58077.0 CG14641-RA 34 - 56474 58077.0 0 1 1603, 0, +3R 221814 223609 CG9855-RA 1 - 221814 223609 0 4 710,197,529,180, 0,767,1019,1615, +3R 1045389 1047270 CG1116.a 3 + 1045389 1047270 0 6 188,218,272,150,577,157, 0,248,531,868,1081,1724, +3R 1045389 1047270 CG1116-RA 1 + 1045389 1047270 0 6 188,215,272,150,577,157, 0,251,531,868,1081,1724, +3R 1045389 1047270 CG1116-RB 3 + 1045389 1047270 0 5 466,272,150,577,157, 0,531,868,1081,1724, +3R 74438 76518 CG14643-RA 1 - 74438 76518 0 4 301,655,608,62, 0,474,1190,2018, +3R 403660 404366.0 CG32945-RA.3d 31 - 403660 404366.0 0 1 706, 0, +3R 403660 404368.0 CG32945.a 34 - 403660 404368.0 0 1 708, 0, +3R 736278 771295 CG31536.a 2 + 736278 771295 0 13 529,735,233,222,244,161,75,107,116,256,1266,487,599, 0,6840,12035,12390,12677,12975,13197,14989,15337,15519,30118,31745,34418, +3R 736277 749883 CG31536-RC 1 + 736277 749883 0 7 530,735,233,222,244,161,408, 0,6841,12036,12391,12678,12976,13198, +3R 23012 30295 CG12582.a 3 + 23012 30295 0 9 272,135,552,97,289,480,422,381,361, 0,446,930,1539,1714,4552,5085,6491,6922, +3R 22996 30295 CG12582-RA 1 + 22996 30295 0 9 288,135,514,97,289,480,422,381,361, 0,462,984,1555,1730,4568,5101,6507,6938, +3R 22930 30295 CG12582.b 3 + 22930 30295 0 9 93,457,514,97,289,480,422,381,361, 0,206,1050,1621,1796,4634,5167,6573,7004, +3R 23029 30295 CG12582-RB 1 + 23029 30295 0 8 564,514,97,289,480,422,381,361, 0,951,1522,1697,4535,5068,6474,6905, +3R 531867 537915 CG31534-RC 3 + 531867 537915 0 7 220,1081,374,911,200,148,1296, 0,880,2530,3014,4031,4470,4752, +3R 531867 537915 CG31534-RB 1 + 531867 537915 0 7 220,1081,374,911,176,105,1296, 0,880,2530,3014,4031,4470,4752, +3R 531867 537915 CG31534-RA 3 + 531867 537915 0 6 220,1081,374,911,176,1296, 0,880,2530,3014,4031,4752, +3R 480549 483707 CG12001-RA 1 + 480549 483707 0 4 252,1138,307,405, 0,690,2075,2753, +3R 1084192 1084867.0 CG14666-RA 34 - 1084192 1084867.0 0 1 675, 0, +3R 576128 598807 CG31530-RA 1 - 576128 598807 0 5 2184,169,155,869,153, 0,2390,2633,7136,22526, +3R 1058267 1062011 CG12005-RB 1 + 1058267 1062011 0 6 181,384,350,1446,423,447, 0,245,839,1247,2760,3297, +3R 807720 809954 CG14662-RA 1 - 807720 809954 0 2 395,1605, 0,629, +3R 1061779 1063038 CG10233-RA 1 - 1061779 1063038 0 3 609,301,85, 0,815,1174, +3R 1062471 1063038 CG10233-RB 2 - 1062471 1063038 0 2 424,85, 0,482, +3R 606846 610444 CG17387-RA.3d 1 - 606846 610444 0 4 841,1809,148,290, 0,1162,3102,3308, +3R 701726 704255 CG14660-RA 1 - 701726 704255 0 3 727,1617,57, 0,804,2472, +3R 909774 912749.0 CG2530.a 31 - 909774 912749.0 0 1 2975, 0, +3R 909342 912749.0 CG2530-RA.5d 34 - 909342 912749.0 0 1 3407, 0, +3R 94942 102759 CG9766.a 2 - 94942 102759 0 4 568,205,246,56, 0,627,888,7761, +3R 94942 103515 CG9766-RB 1 - 94942 103515 0 4 568,205,246,165, 0,627,888,8408, +3R 976629 995849 CG12591-RA 1 + 976629 995849 0 6 379,575,1094,227,106,680, 0,2615,14430,15955,16252,18540, +3R 207031 212741 CG1084-RA 1 + 207031 212741 0 8 220,939,1686,167,873,169,134,551, 0,569,1560,3581,3811,4740,4970,5159, +3R 204643 206932 CG11739-RD 2 + 204643 206932 0 7 88,169,150,118,162,128,508, 0,528,753,1006,1187,1582,1781, +3R 204400 206932 CG11739-RA 2 + 204400 206932 0 7 331,169,150,118,162,128,508, 0,771,996,1249,1430,1825,2024, +3R 204385 206932 CG11739-RC 1 + 204385 206932 0 7 66,169,150,118,162,128,508, 0,786,1011,1264,1445,1840,2039, +3R 205028 206932 CG11739-RB 1 + 205028 206932 0 6 312,150,118,162,128,508, 0,368,621,802,1197,1396, +3R 612766 620844 CG17735-RB 3 - 612766 620844 0 7 1243,202,189,1836,989,1105,1905, 0,1329,1636,1888,3831,4913,6173, +3R 656570 657019.0 CG14659-RA.3d 31 - 656570 657019.0 0 1 449, 0, +3R 1065727 1066457 CG33293-RA 1 - 1065727 1066457 0 2 573,96, 0,634, +3R 53105 55310 CG18143-RA.5d 1 - 53105 55310 0 5 709,274,155,261,544, 0,764,1096,1344,1661, +3R 639075 641751 CG1129-RA 1 + 639075 641751 0 5 26,90,306,535,743, 0,165,317,885,1933, +3R 639057 641751 CG1129-RB 1 + 639057 641751 0 4 273,306,535,743, 0,335,903,1951, +3R 639362 641751 CG1129.a 3 + 639362 641751 0 3 336,535,743, 0,598,1646, +3R 310762 313185 CG1078-RA 1 + 310762 313185 0 4 1491,93,71,516, 0,1555,1780,1907, +3R 248609 255054 CG9809-RD 1 - 248609 255054 0 7 777,146,1832,795,106,119,358, 0,840,1045,2943,3835,3994,6087, +3R 248219 255054 CG9809-RB 1 - 248219 255054 0 7 1167,146,1832,822,106,119,358, 0,1230,1435,3333,4225,4384,6477, +3R 248219 255054 CG9809.a 1 - 248219 255054 0 6 1376,1832,822,106,119,358, 0,1435,3333,4225,4384,6477, +3R 438596 459026 CG1056-RB 3 + 438596 459026 0 8 476,1116,225,199,444,393,297,567, 0,9634,14098,14384,15031,17254,18933,19863, +3R 438596 459031 CG1056-RA 2 + 438596 459031 0 7 476,1116,225,199,444,393,1502, 0,9634,14098,14384,15031,17254,18933, +3R 438596 454784 CG1056-RD 1 + 438596 454784 0 5 476,1116,225,199,1157, 0,9634,14098,14384,15031, +3R 463730 466757 CG9775-RC 2 - 463730 466757 0 6 401,296,540,119,324,20, 0,535,1009,1625,2004,3007, +3R 463730 467317 CG9775-RA 1 - 463730 467317 0 6 401,296,540,119,324,267, 0,535,1009,1625,2004,3320, +3R 463731 467317 CG9775.a 2 - 463731 467317 0 5 830,540,119,324,267, 0,1008,1624,2003,3319, +3R 463731 467317 CG9775-RD 1 - 463731 467317 0 3 830,1319,267, 0,1008,3319, +3R 291138 304828 CG31523-RC 2 - 291138 304828 0 8 1427,279,137,163,81,191,136,474, 0,1877,2215,2427,2649,2797,3047,13216, +3R 291138 304729 CG31523-RB 2 - 291138 304729 0 8 1427,279,137,163,81,191,136,55, 0,1877,2215,2427,2649,2797,3047,13536, +3R 291138 297321 CG31523-RA 1 - 291138 297321 0 8 1427,279,137,163,81,191,136,486, 0,1877,2215,2427,2649,2797,3047,5697, +3R 291138 294355 CG31523-RD 2 - 291138 294355 0 7 1427,279,137,163,81,191,170, 0,1877,2215,2427,2649,2797,3047, +3R 170727 172372 CG9768-RA 1 - 170727 172372 0 2 778,802, 0,843, +3R 259714 261897 CG1074.a 3 + 259714 261897 0 3 167,796,669, 0,662,1514, +3R 259714 261897 CG1074-RA 1 + 259714 261897 0 3 194,796,669, 0,662,1514, +3R 252751 253927.0 CG31525-RA 34 + 252751 253927.0 0 1 1176, 0, +3R 306533 309943.0 CG14651-RB 34 + 306533 309943.0 0 1 3410, 0, +3R 306441 309937.0 CG14651.a 34 + 306441 309937.0 0 1 3496, 0, +3R 774475 776919 CG2013.a 2 - 774475 776919 0 3 1651,286,87, 0,1713,2357, +3R 774475 778406 CG2013-RA 1 - 774475 778406 0 3 1651,286,232, 0,1713,3699, +3R 470348 471316 CG9771-RA 1 - 470348 471316 0 2 450,414, 0,554, +3R 30206 41034 CG14636-RB 2 - 30206 41034 0 2 1301,190, 0,10638, +3R 30206 41034 CG14636-RA 1 - 30206 41034 0 2 1301,167, 0,10661, +3R 133629 135559 CG1102-RA 1 + 133629 135559 0 4 149,164,214,943, 0,356,712,987, +3R 644019 647150 CG14657-RB 1 - 644019 647150 0 3 1440,117,1096, 0,1496,2035, +3R 612766 627445 CG42574.a 3 - 612766 627445 0 11 1243,202,189,1836,989,1105,1847,87,579,987,511, 0,1329,1636,1888,3831,4913,6173,8692,9444,12647,14168, +3R 612766 627445 CG42574-RA 3 - 612766 627445 0 11 1243,202,189,1836,989,1105,1847,87,1209,987,511, 0,1329,1636,1888,3831,4913,6173,8692,9444,12647,14168, +3R 612766 627445 CG42574.b 3 - 612766 627445 0 9 1243,202,189,1836,989,1105,1847,987,511, 0,1329,1636,1888,3831,4913,6173,12647,14168, +3R 471652 474613 CG1058-RA 1 + 471652 474613 0 4 400,103,575,1497, 0,645,815,1464, +3R 330332 331985.0 CG34425-RA 34 - 330332 331985.0 0 1 1653, 0, +3R 228770 232914 CG14648-RA 1 + 228770 232914 0 6 232,171,719,69,211,1326, 0,1420,1652,2431,2552,2818, +3R 319125 383789 CG34357.a 3 - 319125 383789 0 15 1144,12,178,265,193,177,992,91,793,111,100,377,885,311,126, 0,1205,1531,1770,2286,2552,3072,4154,9035,10211,29584,40745,44401,63292,64538, +3R 319125 360075 CG34357.b 3 - 319125 360075 0 12 1144,12,178,265,193,177,992,91,793,111,100,205, 0,1205,1531,1770,2286,2552,3072,4154,9035,10211,29584,40745, +3R 340351 383789 CG34357-RB 1 - 340351 383789 0 6 490,100,377,885,311,126, 0,8358,19519,23175,42066,43312, +3R 603218 606053 CG14655-RA 1 - 603218 606053 0 3 843,610,713, 0,1013,2122, +3R 1047358 1049197 CG2604-RC 2 - 1047358 1049197 0 2 1510,226, 0,1613, +3R 1047346 1049197 CG2604-RA 1 - 1047346 1049197 0 2 1564,226, 0,1625, +3R 60867 66780 CG1106-RD 2 + 60867 66780 0 10 179,61,43,252,193,75,196,1706,126,181, 0,942,1093,1407,2479,3157,3424,3673,5443,5732, +3R 60867 66780 CG1106-RH 1 + 60867 66780 0 9 179,61,252,193,75,196,1706,126,181, 0,942,1407,2479,3157,3424,3673,5443,5732, +3R 60941 66780 CG1106.a 2 + 60941 66780 0 8 105,387,193,75,196,1706,126,181, 0,1333,2405,3083,3350,3599,5369,5658, +3R 60867 66781 CG1106.b 3 + 60867 66781 0 8 179,61,252,193,75,196,1896,182, 0,942,1407,2479,3157,3424,3673,5732, +3R 60867 66780 CG1106-RF 3 + 60867 66780 0 8 179,223,193,75,196,1706,126,181, 0,1436,2479,3157,3424,3673,5443,5732, +3R 60867 66780 CG1106-RB 1 + 60867 66780 0 8 179,252,193,75,196,1706,126,181, 0,1407,2479,3157,3424,3673,5443,5732, +3R 62514 66780 CG1106-RA 1 + 62514 66780 0 7 147,193,75,196,1706,126,181, 0,832,1510,1777,2026,3796,4085, +3R 60867 66780 CG1106.c 3 + 60867 66780 0 7 179,193,75,196,1706,126,181, 0,2479,3157,3424,3673,5443,5732, +3R 60867 66781 CG1106.d 3 + 60867 66781 0 7 179,223,193,75,196,1896,182, 0,1436,2479,3157,3424,3673,5732, +3R 60867 66781 CG1106.e 3 + 60867 66781 0 6 179,193,75,196,1896,182, 0,2479,3157,3424,3673,5732, +3R 64258 66780 CG1106.f 3 + 64258 66780 0 4 229,1706,126,181, 0,282,2052,2341, +3R 64258 66781 CG1106.g 3 + 64258 66781 0 3 229,1896,182, 0,282,2341, +3R 255523 260263 CG9805.a 2 - 255523 260263 0 5 367,2239,1085,322,22, 0,426,2715,3897,4718, +3R 255638 259652 CG9805-RA 1 - 255638 259652 0 4 252,2239,1085,232, 0,311,2600,3782, +3R 77613 78765 CG14644.a 2 - 77613 78765 0 3 351,417,229, 0,406,923, +3R 77613 78765 CG14644-RA 1 - 77613 78765 0 3 351,517,168, 0,406,984, +3R 1079069 1081125 CG1113-RA 3 + 1079069 1081125 0 3 322,1045,430, 0,527,1626, +3R 15413 15982.0 CG18090.a 31 - 15413 15982.0 0 1 569, 0, +3R 15387 16170.0 CG18090-RA 34 - 15387 16170.0 0 1 783, 0, +3R 135363 136669 CG9779-RA 1 - 135363 136669 0 3 717,241,161, 0,772,1145, +3R 216096 217839 CG14646-RA 1 + 216096 217839 0 2 684,1007, 0,736, +3R 68506 68868 CG34305-RA 1 - 68506 68868 0 2 275,25, 0,337, +3R 233158 241835 CG32944-RE 2 - 233158 241835 0 8 567,182,126,127,71,166,56,431, 0,622,5444,5804,5999,7096,7323,8246, +3R 58764 60763.0 CG14637-RA 31 + 58764 60763.0 0 1 1999, 0, +3R 66854 68508 CG14642-RB 3 - 66854 68508 0 5 566,165,110,116,449, 0,622,845,1025,1205, +3R 66766 68508 CG14642-RA 1 - 66766 68508 0 5 88,667,110,99,449, 0,208,933,1130,1293, +3R 812221 836754 CG2022-RB 1 - 812221 836754 0 4 387,208,228,80, 0,1751,2038,24453, +3R 1051881 1053248 CG1115-RA 1 + 1051881 1053248 0 2 819,203, 0,1164, +3R 360 10200 CG12581-RB 3 + 360 10200 0 4 149,1336,866,762, 0,217,7423,9078, +3R 379 10200 CG12581-RA 1 + 379 10200 0 3 1534,866,762, 0,7404,9059, +3R 17135 21871 DMG5-MB6.chr3R.1.002.a.a 2 + 17135 21871 0 6 116,95,486,540,168,281, 0,2817,2978,3535,4231,4455, +3R 137257 140094 CG9791.a 3 + 137257 140094 0 7 439,285,151,310,135,630,531, 0,494,847,1061,1425,1622,2306, +3R 137248 140094 CG9791.b 3 + 137248 140094 0 7 67,319,504,310,135,630,531, 0,129,503,1070,1434,1631,2315, +3R 137257 140094 CG9791-RC 1 + 137257 140094 0 6 439,504,310,135,630,531, 0,494,1061,1425,1622,2306, +3R 1090665 1094320 CG31543-RB.3d 1 + 1090665 1094320 0 5 259,280,81,140,1137, 0,1809,2177,2319,2518, +3R 1090663 1094197 CG31543-RA 1 + 1090663 1094197 0 5 696,280,81,140,1014, 0,1811,2179,2321,2520, +3R 1082762 1094197 CG31543-RC 1 + 1082762 1094197 0 5 1081,280,81,140,1014, 0,9712,10080,10222,10421, +3R 642055 643498 CG1126-RA 1 + 642055 643498 0 5 95,149,196,238,534, 0,153,362,618,909, +3R 642054 643489 CG1126.a 1 + 642054 643489 0 4 96,405,238,525, 0,154,619,910, +3R 732339 735803 CG1119-RB 1 + 732339 735803 0 4 105,1331,909,933, 0,171,1564,2531, +3R 732339 735803 CG1119-RA 1 + 732339 735803 0 4 105,1331,843,933, 0,171,1630,2531, +3R 999323 1043147 CG42312-RE 1 - 999323 1043147 0 20 394,122,2026,217,249,119,248,525,466,207,245,55,122,353,82,519,194,109,211,493, 0,454,663,3692,4035,7455,7634,7946,8818,10175,10677,10985,11767,13706,28043,28466,29058,29448,29622,43331, +3R 998391 1043147 CG42312-RC 1 - 998391 1043147 0 17 1326,122,2026,217,249,119,248,525,466,122,353,82,519,194,109,211,493, 0,1386,1595,4624,4967,8387,8566,8878,9750,12699,14638,28975,29398,29990,30380,30554,44263, +3R 601322 603213 CG2503-RA 1 + 601322 603213 0 3 179,967,628, 0,237,1263, +3R 791167 794226 CG1124-RA 1 + 791167 794226 0 4 202,110,415,407, 0,1683,2175,2652, +3R 1081175 1082423 CG12173-RA 1 - 1081175 1082423 0 3 166,257,454, 0,228,794, +3R 1081165 1082423 CG12173-RB 1 - 1081165 1082423 0 3 176,257,454, 0,238,804, +3R 145413 151818 CG9795.a 2 + 145413 151818 0 11 199,203,148,392,203,212,174,85,82,617,400, 0,2153,2656,3539,3995,4261,4645,4896,5038,5181,6005, +3R 145411 151817 CG9795-RA 1 + 145411 151817 0 11 201,203,148,392,203,212,174,85,82,589,399, 0,2155,2658,3541,3997,4263,4647,4898,5040,5183,6007, +3R 145411 152096 CG9795-RD 1 + 145411 152096 0 10 167,203,392,203,212,174,85,82,617,678, 0,2155,3541,3997,4263,4647,4898,5040,5183,6007, +3R 145411 151818 CG9795.b 2 + 145411 151818 0 10 201,203,392,203,212,174,85,82,617,400, 0,2155,3541,3997,4263,4647,4898,5040,5183,6007, +3R 145411 151817 CG9795-RC 3 + 145411 151817 0 10 201,203,392,203,212,174,85,82,589,399, 0,2155,3541,3997,4263,4647,4898,5040,5183,6007, +3R 145411 151817 CG9795-RB 3 + 145411 151817 0 10 167,203,392,203,212,174,85,82,589,399, 0,2155,3541,3997,4263,4647,4898,5040,5183,6007, +3R 634057 637788 CG2525-RA 1 - 634057 637788 0 2 939,84, 0,3647, +3R 560135 574777 CG9765-RA 1 - 560135 574777 0 10 933,150,162,105,72,62,308,2331,202,265, 0,994,1228,2609,2767,2900,3059,7438,10050,14377, +3R 560131 572136 CG9765-RD 3 - 560131 572136 0 10 937,150,162,105,72,65,266,2331,202,573, 0,998,1232,2613,2771,2904,3063,7442,10054,11432, +3R 560131 572136 CG9765-RC 1 - 560131 572136 0 10 937,150,162,105,72,65,266,2331,202,618, 0,998,1232,2613,2771,2904,3063,7442,10054,11387, +3R 560131 564709 CG9765.a 2 - 560131 564709 0 9 937,150,162,105,72,65,308,117,104, 0,998,1232,2613,2771,2904,3063,3655,4474, +3R 560131 565269 CG9765.b 2 - 560131 565269 0 8 937,150,162,105,72,65,290,37, 0,998,1232,2613,2771,2904,3063,5101, +3R 560131 565354 CG9765.c 2 - 560131 565354 0 8 937,150,162,105,72,65,266,61, 0,998,1232,2613,2771,2904,3063,5162, +3R 560131 565269 CG9765-RG 2 - 560131 565269 0 8 937,150,162,105,72,65,308,37, 0,998,1232,2613,2771,2904,3063,5101, +3R 560131 565269 CG9765-RF 2 - 560131 565269 0 8 937,150,162,105,72,65,266,37, 0,998,1232,2613,2771,2904,3063,5101, +3R 485304 530979 CG31531-RC 2 + 485304 530979 0 9 311,161,54,59,352,207,143,157,4100, 0,656,11214,21196,37608,38466,40134,40588,41575, +3R 485304 530979 CG31531-RA 2 + 485304 530979 0 9 94,161,54,59,352,207,143,157,4100, 0,656,11214,21196,37608,38466,40134,40588,41575, +3R 485304 530979 CG31531.a 2 + 485304 530979 0 9 94,164,54,59,352,207,143,157,4100, 0,653,11214,21196,37608,38466,40134,40588,41575, +3R 485322 530979 CG31531-RB 1 + 485322 530979 0 8 799,54,59,352,207,143,157,4100, 0,11196,21178,37590,38448,40116,40570,41557, +3R 779224 780974 CG14661-RA 1 - 779224 780974 0 3 776,95,215, 0,833,1535, +3R 962778 963295.0 CG12589-RA.3d 31 - 962778 963295.0 0 1 517, 0, +3R 1098664 1149566 CG32464.a 3 - 1098664 1149566 0 19 1140,170,160,122,202,163,152,173,550,155,107,489,288,104,72,509,368,138,406, 0,1206,1792,2023,19697,20055,20276,21119,21363,22698,22914,23204,25259,26527,31168,40046,40995,50045,50496, +3R 1098664 1149566 CG32464-RN 3 - 1098664 1149566 0 19 1140,170,160,122,202,163,152,173,550,155,107,489,288,104,72,509,368,138,153, 0,1206,1792,2023,19697,20055,20276,21119,21363,22698,22914,23204,25259,26527,31168,40046,40995,50045,50749, +3R 1098664 1149566 CG32464-RJ 3 - 1098664 1149566 0 19 1140,170,160,122,202,163,152,173,550,155,107,489,288,104,72,509,368,138,106, 0,1206,1792,2023,19697,20055,20276,21119,21363,22698,22914,23204,25259,26527,31168,40046,40995,50045,50796, +3R 1098664 1149566 CG32464-RB 1 - 1098664 1149566 0 19 1140,170,160,122,202,163,152,173,550,155,107,489,288,104,72,509,368,138,180, 0,1206,1792,2023,19697,20055,20276,21119,21363,22698,22914,23204,25259,26527,31168,40046,40995,50045,50722, +3R 1098664 1149566 CG32464-RU 3 - 1098664 1149566 0 18 1140,170,160,122,202,163,152,173,550,155,107,489,288,104,509,368,138,180, 0,1206,1792,2023,19697,20055,20276,21119,21363,22698,22914,23204,25259,26527,40046,40995,50045,50722, +3R 242152 243389.0 CG31528-RA 34 + 242152 243389.0 0 1 1237, 0, +3R 242058 243377.0 CG31528.a 34 + 242058 243377.0 0 1 1319, 0, +3R 545518 557597 CG9761-RA 1 - 545518 557597 0 9 308,187,251,410,377,177,215,506,330, 0,427,668,1184,2977,3407,3718,3999,11749, +3R 1063222 1077468 CG12163-RA 1 - 1063222 1077468 0 6 656,182,744,128,417,323, 0,712,953,1991,6337,13923, +3R 1063222 1077468 CG12163-RB 2 - 1063222 1077468 0 5 656,182,744,128,323, 0,712,953,1991,13923, +3R 1063222 1077468 CG12163.a 2 - 1063222 1077468 0 5 656,182,744,128,329, 0,712,953,1991,13917, +3R 985333 986627.0 CG12590-RA 34 + 985333 986627.0 0 1 1294, 0, +3R 1043472 1045168 CG12161-RA 1 - 1043472 1045168 0 3 955,180,102, 0,1020,1594, +3R 655632 656232.0 CG14658-RA 34 - 655632 656232.0 0 1 600, 0, +3R 655632 656321.0 CG14658.a 34 - 655632 656321.0 0 1 689, 0, +3R 1053009 1057940 CG10229.a 3 - 1053009 1057940 0 6 903,560,122,604,222,313, 0,989,2419,2734,3705,4618, +3R 1053009 1057940 CG10229.b 3 - 1053009 1057940 0 6 903,560,122,604,321,162, 0,989,2419,2734,3705,4769, +3R 1053009 1057940 CG10229-RA 1 - 1053009 1057940 0 6 903,560,122,604,222,162, 0,989,2419,2734,3705,4769, +3R 153526 159727 CG9776-RA 1 - 153526 159727 0 7 213,1898,149,678,188,168,784, 0,332,2295,3742,4485,5187,5417, +3R 153772 156769 CG9776-RB 1 - 153772 156769 0 3 1984,149,46, 0,2049,2951, +3R 467695 469014 CG1057-RB 2 + 467695 469014 0 4 35,145,90,542, 0,310,595,777, +3R 467695 469014 CG1057-RA 1 + 467695 469014 0 3 455,90,542, 0,595,777, +3R 72743 74040 CG14639-RA 1 + 72743 74040 0 2 63,1175, 0,122, +3R 117995 120558 CG9780-RA 1 - 117995 120558 0 2 1094,1084, 0,1479, +3R 467695 470358 CG18271-RB 1 + 467695 470358 0 2 35,1093, 0,1570, +3R 538608 539918.0 CG9769-RA.3d 31 - 538608 539918.0 0 1 1310, 0, +3R 538608 540025.0 CG9769.a 34 - 538608 540025.0 0 1 1417, 0, +3R 161142 165287 CG9772-RB 2 - 161142 165287 0 5 309,160,400,874,199, 0,365,588,1048,3946, +3R 161142 163408 CG9772-RA 2 - 161142 163408 0 5 309,160,400,874,139, 0,365,588,1048,2127, +3R 161163 163374 CG9772-RD 1 - 161163 163374 0 4 288,160,400,1184, 0,344,567,1027, +3R 161142 163408 CG9772-RC 1 - 161142 163408 0 3 525,1334,139, 0,588,2127, +3R 267136 276555 CG31522-RD 3 - 267136 276555 0 10 1641,156,137,106,57,84,108,83,254,124, 0,2487,2697,2907,3091,3917,5010,5325,6286,9295, +3R 267136 279036 CG31522-RB 1 - 267136 279036 0 10 1641,156,137,106,57,84,108,83,254,123, 0,2487,2697,2907,3091,3917,5010,5325,6286,11777, +3R 267136 276555 CG31522.a 3 - 267136 276555 0 10 1641,156,137,106,57,81,108,83,254,124, 0,2487,2697,2907,3091,4751,5010,5325,6286,9295, +3R 267136 276540 CG31522-RA 1 - 267136 276540 0 10 1641,156,137,106,57,81,108,83,254,347, 0,2487,2697,2907,3091,4751,5010,5325,6286,9057, +3R 272958 279036 CG31522-RC 2 - 272958 279036 0 2 718,123, 0,5955, +3R 107885 127263 CG32490.a 3 + 107885 127263 0 8 151,161,181,12,158,133,1098,1752, 0,510,2062,5908,12965,13404,15324,17626, +3R 107626 127263 CG32490.b 3 + 107626 127263 0 8 99,161,181,12,158,133,1098,1752, 0,769,2321,6167,13224,13663,15583,17885, +3R 107426 127263 CG32490.c 3 + 107426 127263 0 8 62,161,181,12,158,133,1098,1752, 0,969,2521,6367,13424,13863,15783,18085, +3R 107426 127263 CG32490.d 3 + 107426 127263 0 8 167,161,181,12,158,133,1098,1752, 0,969,2521,6367,13424,13863,15783,18085, +3R 105905 127263 CG32490.e 3 + 105905 127263 0 8 173,161,181,12,158,133,1098,1752, 0,2490,4042,7888,14945,15384,17304,19606, +3R 108171 127263 CG32490.f 3 + 108171 127263 0 7 33,161,181,167,133,1098,1752, 0,224,1776,12670,13118,15038,17340, +3R 107973 127263 CG32490-RP 3 + 107973 127263 0 7 63,161,181,158,133,1098,1752, 0,422,1974,12877,13316,15236,17538, +3R 107624 127263 CG32490-RN 3 + 107624 127263 0 7 101,161,181,158,133,1098,1752, 0,771,2323,13226,13665,15585,17887, +3R 107569 127263 CG32490.g 3 + 107569 127263 0 7 68,161,181,167,133,1098,1752, 0,826,2378,13272,13720,15640,17942, +3R 107551 127263 CG32490-RO 3 + 107551 127263 0 7 101,161,181,158,133,1098,1752, 0,844,2396,13299,13738,15658,17960, +3R 107551 127263 CG32490-RM 3 + 107551 127263 0 7 174,161,181,158,133,1098,1752, 0,844,2396,13299,13738,15658,17960, +3R 107426 127263 CG32490.h 3 + 107426 127263 0 7 167,161,181,167,133,1098,1752, 0,969,2521,13415,13863,15783,18085, +3R 107425 127263 CG32490-RC 1 + 107425 127263 0 7 168,161,181,158,133,1098,1752, 0,970,2522,13425,13864,15784,18086, +3R 106272 127263 CG32490-RH 3 + 106272 127263 0 7 272,161,181,167,133,1098,1752, 0,2123,3675,14569,15017,16937,19239, +3R 106110 127263 CG32490-RI 3 + 106110 127263 0 7 81,161,181,167,133,1098,1752, 0,2285,3837,14731,15179,17099,19401, +3R 105905 127263 CG32490-RG 3 + 105905 127263 0 7 173,161,181,167,133,1098,1752, 0,2490,4042,14936,15384,17304,19606, +3R 108258 127263 CG32490-RA 3 + 108258 127263 0 6 298,181,167,133,1098,1752, 0,1689,12583,13031,14951,17253, +3R 120616 127263 CG32490-RJ 1 + 120616 127263 0 5 50,167,133,1098,1752, 0,225,673,2593,4895, +3R 117669 127263 CG32490-RL 3 + 117669 127263 0 5 125,167,133,1098,1752, 0,3172,3620,5540,7842, +3R 117459 127263 CG32490-RK 3 + 117459 127263 0 5 532,167,133,1098,1752, 0,3382,3830,5750,8052, +3R 107426 128309 CG32490.i 2 + 107426 128309 0 6 167,161,181,167,133,62, 0,969,2521,13415,13863,20821, +3R 110073 128309 CG32490-RE 1 + 110073 128309 0 4 55,167,133,62, 0,10768,11216,18174, +3R 263101 267050 CG14650-RA 1 + 263101 267050 0 6 2380,154,125,103,293,582, 0,2437,2647,2841,3013,3367, +3R 212966 215535 CG10520-RB 1 + 212966 215535 0 3 72,912,1355, 0,236,1214, +3R 678534 695709 CG1133-RA 1 + 678534 695709 0 3 1242,170,1535, 0,15330,15640, +3R 163481 165640 CG1103-RA 1 + 163481 165640 0 3 164,303,875, 0,241,1284, +3R 622112 627445 CG14656-RA 3 - 622112 627445 0 3 1307,987,511, 0,3301,4822, +3R 474944 480360 CG1059-RA 1 + 474944 480360 0 5 545,150,1095,1354,1187, 0,1362,1576,2760,4229, +3R 358949 359693 CG31526-RB 2 + 358949 359693 0 3 204,320,104, 0,265,640, +3R 358949 359666 CG31526-RA 1 + 358949 359666 0 2 204,452, 0,265, +3R 44183 45852.0 CG31516.a 31 - 44183 45852.0 0 1 1669, 0, +3R 44178 45852.0 CG31516-RA 34 - 44178 45852.0 0 1 1674, 0, +3R 782716 787070 CG2016-RB 1 - 782716 787070 0 7 229,153,134,122,119,80,37, 0,295,506,2642,2909,3899,4317, +3R 782716 787070 CG2016.a 3 - 782716 787070 0 6 229,153,134,122,119,37, 0,295,506,2642,2909,4317, +3R 782716 787070 CG2016.b 2 - 782716 787070 0 6 229,153,134,122,119,455, 0,295,506,2642,2909,3899, +3R 37504 53244 CG1107-RA 3 + 37504 53244 0 13 30,8,124,68,200,231,140,933,410,374,962,162,772, 0,125,5661,6464,9335,9973,10275,10475,12816,13283,13715,14747,14968, +3R 46716 53244 CG1107-RB 1 + 46716 53244 0 9 323,231,140,933,410,374,962,162,772, 0,761,1063,1263,3604,4071,4503,5535,5756, +3R 47365 53244 CG1107.a 3 + 47365 53244 0 8 343,140,933,410,374,962,162,772, 0,414,614,2955,3422,3854,4886,5107, +3R 92675 94166 CG1092.a 1 + 92675 94166 0 2 252,1184, 0,307, +3R 92675 94166 CG1092-RA 1 + 92675 94166 0 2 252,1184, 0,307, +3R 92693 94005.0 CG1092-RB 34 + 92693 94005.0 0 1 1312, 0, +3R 953811 955661.0 CG12007.a 34 + 953811 955661.0 0 1 1850, 0, +3R 953809 955665.0 CG12007-RA 34 + 953809 955665.0 0 1 1856, 0, +3R 224271 227749 CG9853-RB 2 - 224271 227749 0 4 836,235,449,306, 0,896,1192,3172, +3R 224271 225734 CG9853-RA 1 - 224271 225734 0 3 836,235,271, 0,896,1192, +3R 261943 263051.0 CG9804-RA 31 - 261943 263051.0 0 1 1108, 0, +3R 160819 161237.0 CG14645-RA 34 + 160819 161237.0 0 1 418, 0, +3R 160819 161223.0 CG14645.a 31 + 160819 161223.0 0 1 404, 0, +3R 185509 192577 CG1090.b 3 + 185509 192577 0 6 500,231,945,976,189,907, 0,3490,3774,4778,5914,6161,
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/MB7_3R.gff3 Thu Apr 23 17:57:49 2015 -0400 @@ -0,0 +1,3971 @@ +##gff-version 3 +3R MB7 gene 361 10200 0 + . ID=CG12581;Name=CG12581 +3R MB7 mRNA 361 10200 3 + . ID=CG12581-RB;Parent=CG12581;Name=CG12581-RB +3R MB7 exon 361 509 0 + . Parent=CG12581-RB +3R MB7 exon 578 1913 0 + . Parent=CG12581-RB +3R MB7 exon 7784 8649 0 + . Parent=CG12581-RB +3R MB7 exon 9439 10200 0 + . Parent=CG12581-RB +3R MB7 five_prime_UTR 361 509 0 + . Parent=CG12581-RB +3R MB7 five_prime_UTR 578 1114 0 + . Parent=CG12581-RB +3R MB7 start_codon 1115 1117 0 + 0 Parent=CG12581-RB +3R MB7 CDS 1115 1913 0 + 0 Parent=CG12581-RB +3R MB7 CDS 7784 8649 0 + 2 Parent=CG12581-RB +3R MB7 CDS 9439 9771 0 + 0 Parent=CG12581-RB +3R MB7 stop_codon 9769 9771 0 + 0 Parent=CG12581-RB +3R MB7 three_prime_UTR 9772 10200 0 + . Parent=CG12581-RB +3R MB7 mRNA 380 10200 1 + . ID=CG12581-RA;Parent=CG12581;Name=CG12581-RA +3R MB7 exon 380 1913 0 + . Parent=CG12581-RA +3R MB7 exon 7784 8649 0 + . Parent=CG12581-RA +3R MB7 exon 9439 10200 0 + . Parent=CG12581-RA +3R MB7 five_prime_UTR 380 1114 0 + . Parent=CG12581-RA +3R MB7 start_codon 1115 1117 0 + 0 Parent=CG12581-RA +3R MB7 CDS 1115 1913 0 + 0 Parent=CG12581-RA +3R MB7 CDS 7784 8649 0 + 2 Parent=CG12581-RA +3R MB7 CDS 9439 9771 0 + 0 Parent=CG12581-RA +3R MB7 stop_codon 9769 9771 0 + 0 Parent=CG12581-RA +3R MB7 three_prime_UTR 9772 10200 0 + . Parent=CG12581-RA +3R MB7 gene 15388 16170 0 - . ID=CG18090;Name=CG18090 +3R MB7 mRNA 15414 15982 31 - . ID=CG18090.a;Parent=CG18090;Name=CG18090.a +3R MB7 exon 15414 15982 0 - . Parent=CG18090.a +3R MB7 three_prime_UTR 15414 15529 0 - . Parent=CG18090.a +3R MB7 stop_codon 15530 15532 0 - 0 Parent=CG18090.a +3R MB7 CDS 15530 15955 0 - 0 Parent=CG18090.a +3R MB7 start_codon 15953 15955 0 - 0 Parent=CG18090.a +3R MB7 five_prime_UTR 15956 15982 0 - . Parent=CG18090.a +3R MB7 mRNA 15388 16170 34 - . ID=CG18090-RA;Parent=CG18090;Name=CG18090-RA +3R MB7 exon 15388 16170 0 - . Parent=CG18090-RA +3R MB7 three_prime_UTR 15388 15529 0 - . Parent=CG18090-RA +3R MB7 stop_codon 15530 15532 0 - 0 Parent=CG18090-RA +3R MB7 CDS 15530 15955 0 - 0 Parent=CG18090-RA +3R MB7 start_codon 15953 15955 0 - 0 Parent=CG18090-RA +3R MB7 five_prime_UTR 15956 16170 0 - . Parent=CG18090-RA +3R MB7 gene 17136 21871 0 + . ID=DMG5-MB6.chr3R.1.002.a;Name=DMG5-MB6.chr3R.1.002.a +3R MB7 mRNA 17136 21871 2 + . ID=DMG5-MB6.chr3R.1.002.a.a;Parent=DMG5-MB6.chr3R.1.002.a;Name=DMG5-MB6.chr3R.1.002.a.a +3R MB7 exon 17136 17251 0 + . Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 exon 19953 20047 0 + . Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 exon 20114 20599 0 + . Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 exon 20671 21210 0 + . Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 exon 21367 21534 0 + . Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 exon 21591 21871 0 + . Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 start_codon 17136 17138 0 + 0 Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 CDS 17136 17251 0 + 0 Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 CDS 19953 20047 0 + 1 Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 CDS 20114 20599 0 + 2 Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 CDS 20671 20759 0 + 2 Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 stop_codon 20757 20759 0 + 0 Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 three_prime_UTR 20760 21210 0 + . Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 three_prime_UTR 21367 21534 0 + . Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 three_prime_UTR 21591 21871 0 + . Parent=DMG5-MB6.chr3R.1.002.a.a +3R MB7 gene 22931 30295 0 + . ID=CG12582;Name=CG12582 +3R MB7 mRNA 23013 30295 3 + . ID=CG12582.a;Parent=CG12582;Name=CG12582.a +3R MB7 exon 23013 23284 0 + . Parent=CG12582.a +3R MB7 exon 23459 23593 0 + . Parent=CG12582.a +3R MB7 exon 23943 24494 0 + . Parent=CG12582.a +3R MB7 exon 24552 24648 0 + . Parent=CG12582.a +3R MB7 exon 24727 25015 0 + . Parent=CG12582.a +3R MB7 exon 27565 28044 0 + . Parent=CG12582.a +3R MB7 exon 28098 28519 0 + . Parent=CG12582.a +3R MB7 exon 29504 29884 0 + . Parent=CG12582.a +3R MB7 exon 29935 30295 0 + . Parent=CG12582.a +3R MB7 five_prime_UTR 23013 23284 0 + . Parent=CG12582.a +3R MB7 five_prime_UTR 23459 23593 0 + . Parent=CG12582.a +3R MB7 five_prime_UTR 23943 24087 0 + . Parent=CG12582.a +3R MB7 start_codon 24088 24090 0 + 0 Parent=CG12582.a +3R MB7 CDS 24088 24494 0 + 0 Parent=CG12582.a +3R MB7 CDS 24552 24648 0 + 1 Parent=CG12582.a +3R MB7 CDS 24727 25015 0 + 0 Parent=CG12582.a +3R MB7 CDS 27565 28044 0 + 2 Parent=CG12582.a +3R MB7 CDS 28098 28519 0 + 2 Parent=CG12582.a +3R MB7 CDS 29504 29884 0 + 0 Parent=CG12582.a +3R MB7 CDS 29935 30195 0 + 0 Parent=CG12582.a +3R MB7 stop_codon 30193 30195 0 + 0 Parent=CG12582.a +3R MB7 three_prime_UTR 30196 30295 0 + . Parent=CG12582.a +3R MB7 mRNA 22997 30295 1 + . ID=CG12582-RA;Parent=CG12582;Name=CG12582-RA +3R MB7 exon 22997 23284 0 + . Parent=CG12582-RA +3R MB7 exon 23459 23593 0 + . Parent=CG12582-RA +3R MB7 exon 23981 24494 0 + . Parent=CG12582-RA +3R MB7 exon 24552 24648 0 + . Parent=CG12582-RA +3R MB7 exon 24727 25015 0 + . Parent=CG12582-RA +3R MB7 exon 27565 28044 0 + . Parent=CG12582-RA +3R MB7 exon 28098 28519 0 + . Parent=CG12582-RA +3R MB7 exon 29504 29884 0 + . Parent=CG12582-RA +3R MB7 exon 29935 30295 0 + . Parent=CG12582-RA +3R MB7 five_prime_UTR 22997 23136 0 + . Parent=CG12582-RA +3R MB7 start_codon 23137 23139 0 + 0 Parent=CG12582-RA +3R MB7 CDS 23137 23284 0 + 0 Parent=CG12582-RA +3R MB7 CDS 23459 23593 0 + 2 Parent=CG12582-RA +3R MB7 CDS 23981 24494 0 + 2 Parent=CG12582-RA +3R MB7 CDS 24552 24648 0 + 1 Parent=CG12582-RA +3R MB7 CDS 24727 25015 0 + 0 Parent=CG12582-RA +3R MB7 CDS 27565 28044 0 + 2 Parent=CG12582-RA +3R MB7 CDS 28098 28519 0 + 2 Parent=CG12582-RA +3R MB7 CDS 29504 29884 0 + 0 Parent=CG12582-RA +3R MB7 CDS 29935 30195 0 + 0 Parent=CG12582-RA +3R MB7 stop_codon 30193 30195 0 + 0 Parent=CG12582-RA +3R MB7 three_prime_UTR 30196 30295 0 + . Parent=CG12582-RA +3R MB7 mRNA 22931 30295 3 + . ID=CG12582.b;Parent=CG12582;Name=CG12582.b +3R MB7 exon 22931 23023 0 + . Parent=CG12582.b +3R MB7 exon 23137 23593 0 + . Parent=CG12582.b +3R MB7 exon 23981 24494 0 + . Parent=CG12582.b +3R MB7 exon 24552 24648 0 + . Parent=CG12582.b +3R MB7 exon 24727 25015 0 + . Parent=CG12582.b +3R MB7 exon 27565 28044 0 + . Parent=CG12582.b +3R MB7 exon 28098 28519 0 + . Parent=CG12582.b +3R MB7 exon 29504 29884 0 + . Parent=CG12582.b +3R MB7 exon 29935 30295 0 + . Parent=CG12582.b +3R MB7 five_prime_UTR 22931 23023 0 + . Parent=CG12582.b +3R MB7 five_prime_UTR 23137 23593 0 + . Parent=CG12582.b +3R MB7 five_prime_UTR 23981 24087 0 + . Parent=CG12582.b +3R MB7 start_codon 24088 24090 0 + 0 Parent=CG12582.b +3R MB7 CDS 24088 24494 0 + 0 Parent=CG12582.b +3R MB7 CDS 24552 24648 0 + 1 Parent=CG12582.b +3R MB7 CDS 24727 25015 0 + 0 Parent=CG12582.b +3R MB7 CDS 27565 28044 0 + 2 Parent=CG12582.b +3R MB7 CDS 28098 28519 0 + 2 Parent=CG12582.b +3R MB7 CDS 29504 29884 0 + 0 Parent=CG12582.b +3R MB7 CDS 29935 30195 0 + 0 Parent=CG12582.b +3R MB7 stop_codon 30193 30195 0 + 0 Parent=CG12582.b +3R MB7 three_prime_UTR 30196 30295 0 + . Parent=CG12582.b +3R MB7 mRNA 23030 30295 1 + . ID=CG12582-RB;Parent=CG12582;Name=CG12582-RB +3R MB7 exon 23030 23593 0 + . Parent=CG12582-RB +3R MB7 exon 23981 24494 0 + . Parent=CG12582-RB +3R MB7 exon 24552 24648 0 + . Parent=CG12582-RB +3R MB7 exon 24727 25015 0 + . Parent=CG12582-RB +3R MB7 exon 27565 28044 0 + . Parent=CG12582-RB +3R MB7 exon 28098 28519 0 + . Parent=CG12582-RB +3R MB7 exon 29504 29884 0 + . Parent=CG12582-RB +3R MB7 exon 29935 30295 0 + . Parent=CG12582-RB +3R MB7 five_prime_UTR 23030 23593 0 + . Parent=CG12582-RB +3R MB7 five_prime_UTR 23981 24087 0 + . Parent=CG12582-RB +3R MB7 start_codon 24088 24090 0 + 0 Parent=CG12582-RB +3R MB7 CDS 24088 24494 0 + 0 Parent=CG12582-RB +3R MB7 CDS 24552 24648 0 + 1 Parent=CG12582-RB +3R MB7 CDS 24727 25015 0 + 0 Parent=CG12582-RB +3R MB7 CDS 27565 28044 0 + 2 Parent=CG12582-RB +3R MB7 CDS 28098 28519 0 + 2 Parent=CG12582-RB +3R MB7 CDS 29504 29884 0 + 0 Parent=CG12582-RB +3R MB7 CDS 29935 30195 0 + 0 Parent=CG12582-RB +3R MB7 stop_codon 30193 30195 0 + 0 Parent=CG12582-RB +3R MB7 three_prime_UTR 30196 30295 0 + . Parent=CG12582-RB +3R MB7 gene 30207 41034 0 - . ID=CG14636;Name=CG14636 +3R MB7 mRNA 30207 41034 2 - . ID=CG14636-RB;Parent=CG14636;Name=CG14636-RB +3R MB7 exon 30207 31507 0 - . Parent=CG14636-RB +3R MB7 exon 40845 41034 0 - . Parent=CG14636-RB +3R MB7 three_prime_UTR 30207 30317 0 - . Parent=CG14636-RB +3R MB7 stop_codon 30318 30320 0 - 0 Parent=CG14636-RB +3R MB7 CDS 30318 31487 0 - 0 Parent=CG14636-RB +3R MB7 start_codon 31485 31487 0 - 0 Parent=CG14636-RB +3R MB7 five_prime_UTR 31488 31507 0 - . Parent=CG14636-RB +3R MB7 five_prime_UTR 40845 41034 0 - . Parent=CG14636-RB +3R MB7 mRNA 30207 41034 1 - . ID=CG14636-RA;Parent=CG14636;Name=CG14636-RA +3R MB7 exon 30207 31507 0 - . Parent=CG14636-RA +3R MB7 exon 40868 41034 0 - . Parent=CG14636-RA +3R MB7 three_prime_UTR 30207 30317 0 - . Parent=CG14636-RA +3R MB7 stop_codon 30318 30320 0 - 0 Parent=CG14636-RA +3R MB7 CDS 30318 31487 0 - 0 Parent=CG14636-RA +3R MB7 start_codon 31485 31487 0 - 0 Parent=CG14636-RA +3R MB7 five_prime_UTR 31488 31507 0 - . Parent=CG14636-RA +3R MB7 five_prime_UTR 40868 41034 0 - . Parent=CG14636-RA +3R MB7 gene 37505 53244 0 + . ID=CG1107;Name=CG1107 +3R MB7 mRNA 37505 53244 3 + . ID=CG1107-RA;Parent=CG1107;Name=CG1107-RA +3R MB7 exon 37505 37534 0 + . Parent=CG1107-RA +3R MB7 exon 37630 37637 0 + . Parent=CG1107-RA +3R MB7 exon 43166 43289 0 + . Parent=CG1107-RA +3R MB7 exon 43969 44036 0 + . Parent=CG1107-RA +3R MB7 exon 46840 47039 0 + . Parent=CG1107-RA +3R MB7 exon 47478 47708 0 + . Parent=CG1107-RA +3R MB7 exon 47780 47919 0 + . Parent=CG1107-RA +3R MB7 exon 47980 48912 0 + . Parent=CG1107-RA +3R MB7 exon 50321 50730 0 + . Parent=CG1107-RA +3R MB7 exon 50788 51161 0 + . Parent=CG1107-RA +3R MB7 exon 51220 52181 0 + . Parent=CG1107-RA +3R MB7 exon 52252 52413 0 + . Parent=CG1107-RA +3R MB7 exon 52473 53244 0 + . Parent=CG1107-RA +3R MB7 five_prime_UTR 37505 37534 0 + . Parent=CG1107-RA +3R MB7 five_prime_UTR 37630 37637 0 + . Parent=CG1107-RA +3R MB7 five_prime_UTR 43166 43289 0 + . Parent=CG1107-RA +3R MB7 five_prime_UTR 43969 44036 0 + . Parent=CG1107-RA +3R MB7 five_prime_UTR 46840 46864 0 + . Parent=CG1107-RA +3R MB7 start_codon 46865 46867 0 + 0 Parent=CG1107-RA +3R MB7 CDS 46865 47039 0 + 0 Parent=CG1107-RA +3R MB7 CDS 47478 47708 0 + 2 Parent=CG1107-RA +3R MB7 CDS 47780 47919 0 + 2 Parent=CG1107-RA +3R MB7 CDS 47980 48912 0 + 0 Parent=CG1107-RA +3R MB7 CDS 50321 50730 0 + 0 Parent=CG1107-RA +3R MB7 CDS 50788 51161 0 + 1 Parent=CG1107-RA +3R MB7 CDS 51220 52181 0 + 2 Parent=CG1107-RA +3R MB7 CDS 52252 52413 0 + 0 Parent=CG1107-RA +3R MB7 CDS 52473 52583 0 + 0 Parent=CG1107-RA +3R MB7 stop_codon 52581 52583 0 + 0 Parent=CG1107-RA +3R MB7 three_prime_UTR 52584 53244 0 + . Parent=CG1107-RA +3R MB7 mRNA 46717 53244 1 + . ID=CG1107-RB;Parent=CG1107;Name=CG1107-RB +3R MB7 exon 46717 47039 0 + . Parent=CG1107-RB +3R MB7 exon 47478 47708 0 + . Parent=CG1107-RB +3R MB7 exon 47780 47919 0 + . Parent=CG1107-RB +3R MB7 exon 47980 48912 0 + . Parent=CG1107-RB +3R MB7 exon 50321 50730 0 + . Parent=CG1107-RB +3R MB7 exon 50788 51161 0 + . Parent=CG1107-RB +3R MB7 exon 51220 52181 0 + . Parent=CG1107-RB +3R MB7 exon 52252 52413 0 + . Parent=CG1107-RB +3R MB7 exon 52473 53244 0 + . Parent=CG1107-RB +3R MB7 five_prime_UTR 46717 46864 0 + . Parent=CG1107-RB +3R MB7 start_codon 46865 46867 0 + 0 Parent=CG1107-RB +3R MB7 CDS 46865 47039 0 + 0 Parent=CG1107-RB +3R MB7 CDS 47478 47708 0 + 2 Parent=CG1107-RB +3R MB7 CDS 47780 47919 0 + 2 Parent=CG1107-RB +3R MB7 CDS 47980 48912 0 + 0 Parent=CG1107-RB +3R MB7 CDS 50321 50730 0 + 0 Parent=CG1107-RB +3R MB7 CDS 50788 51161 0 + 1 Parent=CG1107-RB +3R MB7 CDS 51220 52181 0 + 2 Parent=CG1107-RB +3R MB7 CDS 52252 52413 0 + 0 Parent=CG1107-RB +3R MB7 CDS 52473 52583 0 + 0 Parent=CG1107-RB +3R MB7 stop_codon 52581 52583 0 + 0 Parent=CG1107-RB +3R MB7 three_prime_UTR 52584 53244 0 + . Parent=CG1107-RB +3R MB7 mRNA 47366 53244 3 + . ID=CG1107.a;Parent=CG1107;Name=CG1107.a +3R MB7 exon 47366 47708 0 + . Parent=CG1107.a +3R MB7 exon 47780 47919 0 + . Parent=CG1107.a +3R MB7 exon 47980 48912 0 + . Parent=CG1107.a +3R MB7 exon 50321 50730 0 + . Parent=CG1107.a +3R MB7 exon 50788 51161 0 + . Parent=CG1107.a +3R MB7 exon 51220 52181 0 + . Parent=CG1107.a +3R MB7 exon 52252 52413 0 + . Parent=CG1107.a +3R MB7 exon 52473 53244 0 + . Parent=CG1107.a +3R MB7 five_prime_UTR 47366 47557 0 + . Parent=CG1107.a +3R MB7 start_codon 47558 47560 0 + 0 Parent=CG1107.a +3R MB7 CDS 47558 47708 0 + 0 Parent=CG1107.a +3R MB7 CDS 47780 47919 0 + 2 Parent=CG1107.a +3R MB7 CDS 47980 48912 0 + 0 Parent=CG1107.a +3R MB7 CDS 50321 50730 0 + 0 Parent=CG1107.a +3R MB7 CDS 50788 51161 0 + 1 Parent=CG1107.a +3R MB7 CDS 51220 52181 0 + 2 Parent=CG1107.a +3R MB7 CDS 52252 52413 0 + 0 Parent=CG1107.a +3R MB7 CDS 52473 52583 0 + 0 Parent=CG1107.a +3R MB7 stop_codon 52581 52583 0 + 0 Parent=CG1107.a +3R MB7 three_prime_UTR 52584 53244 0 + . Parent=CG1107.a +3R MB7 gene 44179 45852 0 - . ID=CG31516;Name=CG31516 +3R MB7 mRNA 44184 45852 31 - . ID=CG31516.a;Parent=CG31516;Name=CG31516.a +3R MB7 exon 44184 45852 0 - . Parent=CG31516.a +3R MB7 three_prime_UTR 44184 44671 0 - . Parent=CG31516.a +3R MB7 stop_codon 44672 44674 0 - 0 Parent=CG31516.a +3R MB7 CDS 44672 45418 0 - 0 Parent=CG31516.a +3R MB7 start_codon 45416 45418 0 - 0 Parent=CG31516.a +3R MB7 five_prime_UTR 45419 45852 0 - . Parent=CG31516.a +3R MB7 mRNA 44179 45852 34 - . ID=CG31516-RA;Parent=CG31516;Name=CG31516-RA +3R MB7 exon 44179 45852 0 - . Parent=CG31516-RA +3R MB7 three_prime_UTR 44179 44671 0 - . Parent=CG31516-RA +3R MB7 stop_codon 44672 44674 0 - 0 Parent=CG31516-RA +3R MB7 CDS 44672 45418 0 - 0 Parent=CG31516-RA +3R MB7 start_codon 45416 45418 0 - 0 Parent=CG31516-RA +3R MB7 five_prime_UTR 45419 45852 0 - . Parent=CG31516-RA +3R MB7 gene 53106 55310 0 - . ID=CG18143;Name=CG18143 +3R MB7 mRNA 53106 55310 1 - . ID=CG18143-RA.5d;Parent=CG18143;Name=CG18143-RA.5d +3R MB7 exon 53106 53814 0 - . Parent=CG18143-RA.5d +3R MB7 exon 53870 54143 0 - . Parent=CG18143-RA.5d +3R MB7 exon 54202 54356 0 - . Parent=CG18143-RA.5d +3R MB7 exon 54450 54710 0 - . Parent=CG18143-RA.5d +3R MB7 exon 54767 55310 0 - . Parent=CG18143-RA.5d +3R MB7 three_prime_UTR 53106 53256 0 - . Parent=CG18143-RA.5d +3R MB7 stop_codon 53257 53259 0 - 0 Parent=CG18143-RA.5d +3R MB7 CDS 53257 53814 0 - 0 Parent=CG18143-RA.5d +3R MB7 CDS 53870 54143 0 - 1 Parent=CG18143-RA.5d +3R MB7 CDS 54202 54356 0 - 0 Parent=CG18143-RA.5d +3R MB7 CDS 54450 54710 0 - 0 Parent=CG18143-RA.5d +3R MB7 CDS 54767 54865 0 - 0 Parent=CG18143-RA.5d +3R MB7 start_codon 54863 54865 0 - 0 Parent=CG18143-RA.5d +3R MB7 five_prime_UTR 54866 55310 0 - . Parent=CG18143-RA.5d +3R MB7 gene 56475 58077 0 - . ID=CG14641;Name=CG14641 +3R MB7 mRNA 56501 58054 31 - . ID=CG14641.a;Parent=CG14641;Name=CG14641.a +3R MB7 exon 56501 58054 0 - . Parent=CG14641.a +3R MB7 three_prime_UTR 56501 56707 0 - . Parent=CG14641.a +3R MB7 stop_codon 56708 56710 0 - 0 Parent=CG14641.a +3R MB7 CDS 56708 57964 0 - 0 Parent=CG14641.a +3R MB7 start_codon 57962 57964 0 - 0 Parent=CG14641.a +3R MB7 five_prime_UTR 57965 58054 0 - . Parent=CG14641.a +3R MB7 mRNA 56475 58077 34 - . ID=CG14641-RA;Parent=CG14641;Name=CG14641-RA +3R MB7 exon 56475 58077 0 - . Parent=CG14641-RA +3R MB7 three_prime_UTR 56475 56707 0 - . Parent=CG14641-RA +3R MB7 stop_codon 56708 56710 0 - 0 Parent=CG14641-RA +3R MB7 CDS 56708 57964 0 - 0 Parent=CG14641-RA +3R MB7 start_codon 57962 57964 0 - 0 Parent=CG14641-RA +3R MB7 five_prime_UTR 57965 58077 0 - . Parent=CG14641-RA +3R MB7 gene 58765 60763 0 + . ID=CG14637;Name=CG14637 +3R MB7 mRNA 58765 60763 31 + . ID=CG14637-RA;Parent=CG14637;Name=CG14637-RA +3R MB7 exon 58765 60763 0 + . Parent=CG14637-RA +3R MB7 five_prime_UTR 58765 58850 0 + . Parent=CG14637-RA +3R MB7 start_codon 58851 58853 0 + 0 Parent=CG14637-RA +3R MB7 CDS 58851 60710 0 + 0 Parent=CG14637-RA +3R MB7 stop_codon 60708 60710 0 + 0 Parent=CG14637-RA +3R MB7 three_prime_UTR 60711 60763 0 + . Parent=CG14637-RA +3R MB7 gene 60868 66781 0 + . ID=CG1106;Name=CG1106 +3R MB7 mRNA 60868 66780 2 + . ID=CG1106-RD;Parent=CG1106;Name=CG1106-RD +3R MB7 exon 60868 61046 0 + . Parent=CG1106-RD +3R MB7 exon 61810 61870 0 + . Parent=CG1106-RD +3R MB7 exon 61961 62003 0 + . Parent=CG1106-RD +3R MB7 exon 62275 62526 0 + . Parent=CG1106-RD +3R MB7 exon 63347 63539 0 + . Parent=CG1106-RD +3R MB7 exon 64025 64099 0 + . Parent=CG1106-RD +3R MB7 exon 64292 64487 0 + . Parent=CG1106-RD +3R MB7 exon 64541 66246 0 + . Parent=CG1106-RD +3R MB7 exon 66311 66436 0 + . Parent=CG1106-RD +3R MB7 exon 66600 66780 0 + . Parent=CG1106-RD +3R MB7 five_prime_UTR 60868 61046 0 + . Parent=CG1106-RD +3R MB7 five_prime_UTR 61810 61870 0 + . Parent=CG1106-RD +3R MB7 five_prime_UTR 61961 62003 0 + . Parent=CG1106-RD +3R MB7 five_prime_UTR 62275 62485 0 + . Parent=CG1106-RD +3R MB7 start_codon 62486 62488 0 + 0 Parent=CG1106-RD +3R MB7 CDS 62486 62526 0 + 0 Parent=CG1106-RD +3R MB7 CDS 63347 63539 0 + 1 Parent=CG1106-RD +3R MB7 CDS 64025 64099 0 + 0 Parent=CG1106-RD +3R MB7 CDS 64292 64487 0 + 0 Parent=CG1106-RD +3R MB7 CDS 64541 66246 0 + 2 Parent=CG1106-RD +3R MB7 CDS 66311 66436 0 + 0 Parent=CG1106-RD +3R MB7 CDS 66600 66659 0 + 0 Parent=CG1106-RD +3R MB7 stop_codon 66657 66659 0 + 0 Parent=CG1106-RD +3R MB7 three_prime_UTR 66660 66780 0 + . Parent=CG1106-RD +3R MB7 mRNA 60868 66780 1 + . ID=CG1106-RH;Parent=CG1106;Name=CG1106-RH +3R MB7 exon 60868 61046 0 + . Parent=CG1106-RH +3R MB7 exon 61810 61870 0 + . Parent=CG1106-RH +3R MB7 exon 62275 62526 0 + . Parent=CG1106-RH +3R MB7 exon 63347 63539 0 + . Parent=CG1106-RH +3R MB7 exon 64025 64099 0 + . Parent=CG1106-RH +3R MB7 exon 64292 64487 0 + . Parent=CG1106-RH +3R MB7 exon 64541 66246 0 + . Parent=CG1106-RH +3R MB7 exon 66311 66436 0 + . Parent=CG1106-RH +3R MB7 exon 66600 66780 0 + . Parent=CG1106-RH +3R MB7 five_prime_UTR 60868 61046 0 + . Parent=CG1106-RH +3R MB7 five_prime_UTR 61810 61826 0 + . Parent=CG1106-RH +3R MB7 start_codon 61827 61829 0 + 0 Parent=CG1106-RH +3R MB7 CDS 61827 61870 0 + 0 Parent=CG1106-RH +3R MB7 CDS 62275 62526 0 + 1 Parent=CG1106-RH +3R MB7 CDS 63347 63539 0 + 1 Parent=CG1106-RH +3R MB7 CDS 64025 64099 0 + 0 Parent=CG1106-RH +3R MB7 CDS 64292 64487 0 + 0 Parent=CG1106-RH +3R MB7 CDS 64541 66246 0 + 2 Parent=CG1106-RH +3R MB7 CDS 66311 66436 0 + 0 Parent=CG1106-RH +3R MB7 CDS 66600 66659 0 + 0 Parent=CG1106-RH +3R MB7 stop_codon 66657 66659 0 + 0 Parent=CG1106-RH +3R MB7 three_prime_UTR 66660 66780 0 + . Parent=CG1106-RH +3R MB7 mRNA 60942 66780 2 + . ID=CG1106.a;Parent=CG1106;Name=CG1106.a +3R MB7 exon 60942 61046 0 + . Parent=CG1106.a +3R MB7 exon 62275 62661 0 + . Parent=CG1106.a +3R MB7 exon 63347 63539 0 + . Parent=CG1106.a +3R MB7 exon 64025 64099 0 + . Parent=CG1106.a +3R MB7 exon 64292 64487 0 + . Parent=CG1106.a +3R MB7 exon 64541 66246 0 + . Parent=CG1106.a +3R MB7 exon 66311 66436 0 + . Parent=CG1106.a +3R MB7 exon 66600 66780 0 + . Parent=CG1106.a +3R MB7 five_prime_UTR 60942 61046 0 + . Parent=CG1106.a +3R MB7 five_prime_UTR 62275 62661 0 + . Parent=CG1106.a +3R MB7 five_prime_UTR 63347 63479 0 + . Parent=CG1106.a +3R MB7 start_codon 63480 63482 0 + 0 Parent=CG1106.a +3R MB7 CDS 63480 63539 0 + 0 Parent=CG1106.a +3R MB7 CDS 64025 64099 0 + 0 Parent=CG1106.a +3R MB7 CDS 64292 64487 0 + 0 Parent=CG1106.a +3R MB7 CDS 64541 66246 0 + 2 Parent=CG1106.a +3R MB7 CDS 66311 66436 0 + 0 Parent=CG1106.a +3R MB7 CDS 66600 66659 0 + 0 Parent=CG1106.a +3R MB7 stop_codon 66657 66659 0 + 0 Parent=CG1106.a +3R MB7 three_prime_UTR 66660 66780 0 + . Parent=CG1106.a +3R MB7 mRNA 60868 66781 3 + . ID=CG1106.b;Parent=CG1106;Name=CG1106.b +3R MB7 exon 60868 61046 0 + . Parent=CG1106.b +3R MB7 exon 61810 61870 0 + . Parent=CG1106.b +3R MB7 exon 62275 62526 0 + . Parent=CG1106.b +3R MB7 exon 63347 63539 0 + . Parent=CG1106.b +3R MB7 exon 64025 64099 0 + . Parent=CG1106.b +3R MB7 exon 64292 64487 0 + . Parent=CG1106.b +3R MB7 exon 64541 66436 0 + . Parent=CG1106.b +3R MB7 exon 66600 66781 0 + . Parent=CG1106.b +3R MB7 five_prime_UTR 60868 61046 0 + . Parent=CG1106.b +3R MB7 five_prime_UTR 61810 61826 0 + . Parent=CG1106.b +3R MB7 start_codon 61827 61829 0 + 0 Parent=CG1106.b +3R MB7 CDS 61827 61870 0 + 0 Parent=CG1106.b +3R MB7 CDS 62275 62526 0 + 1 Parent=CG1106.b +3R MB7 CDS 63347 63539 0 + 1 Parent=CG1106.b +3R MB7 CDS 64025 64099 0 + 0 Parent=CG1106.b +3R MB7 CDS 64292 64487 0 + 0 Parent=CG1106.b +3R MB7 CDS 64541 66285 0 + 2 Parent=CG1106.b +3R MB7 stop_codon 66283 66285 0 + 0 Parent=CG1106.b +3R MB7 three_prime_UTR 66286 66436 0 + . Parent=CG1106.b +3R MB7 three_prime_UTR 66600 66781 0 + . Parent=CG1106.b +3R MB7 mRNA 60868 66780 3 + . ID=CG1106-RF;Parent=CG1106;Name=CG1106-RF +3R MB7 exon 60868 61046 0 + . Parent=CG1106-RF +3R MB7 exon 62304 62526 0 + . Parent=CG1106-RF +3R MB7 exon 63347 63539 0 + . Parent=CG1106-RF +3R MB7 exon 64025 64099 0 + . Parent=CG1106-RF +3R MB7 exon 64292 64487 0 + . Parent=CG1106-RF +3R MB7 exon 64541 66246 0 + . Parent=CG1106-RF +3R MB7 exon 66311 66436 0 + . Parent=CG1106-RF +3R MB7 exon 66600 66780 0 + . Parent=CG1106-RF +3R MB7 five_prime_UTR 60868 61046 0 + . Parent=CG1106-RF +3R MB7 five_prime_UTR 62304 62485 0 + . Parent=CG1106-RF +3R MB7 start_codon 62486 62488 0 + 0 Parent=CG1106-RF +3R MB7 CDS 62486 62526 0 + 0 Parent=CG1106-RF +3R MB7 CDS 63347 63539 0 + 1 Parent=CG1106-RF +3R MB7 CDS 64025 64099 0 + 0 Parent=CG1106-RF +3R MB7 CDS 64292 64487 0 + 0 Parent=CG1106-RF +3R MB7 CDS 64541 66246 0 + 2 Parent=CG1106-RF +3R MB7 CDS 66311 66436 0 + 0 Parent=CG1106-RF +3R MB7 CDS 66600 66659 0 + 0 Parent=CG1106-RF +3R MB7 stop_codon 66657 66659 0 + 0 Parent=CG1106-RF +3R MB7 three_prime_UTR 66660 66780 0 + . Parent=CG1106-RF +3R MB7 mRNA 60868 66780 1 + . ID=CG1106-RB;Parent=CG1106;Name=CG1106-RB +3R MB7 exon 60868 61046 0 + . Parent=CG1106-RB +3R MB7 exon 62275 62526 0 + . Parent=CG1106-RB +3R MB7 exon 63347 63539 0 + . Parent=CG1106-RB +3R MB7 exon 64025 64099 0 + . Parent=CG1106-RB +3R MB7 exon 64292 64487 0 + . Parent=CG1106-RB +3R MB7 exon 64541 66246 0 + . Parent=CG1106-RB +3R MB7 exon 66311 66436 0 + . Parent=CG1106-RB +3R MB7 exon 66600 66780 0 + . Parent=CG1106-RB +3R MB7 five_prime_UTR 60868 61046 0 + . Parent=CG1106-RB +3R MB7 five_prime_UTR 62275 62485 0 + . Parent=CG1106-RB +3R MB7 start_codon 62486 62488 0 + 0 Parent=CG1106-RB +3R MB7 CDS 62486 62526 0 + 0 Parent=CG1106-RB +3R MB7 CDS 63347 63539 0 + 1 Parent=CG1106-RB +3R MB7 CDS 64025 64099 0 + 0 Parent=CG1106-RB +3R MB7 CDS 64292 64487 0 + 0 Parent=CG1106-RB +3R MB7 CDS 64541 66246 0 + 2 Parent=CG1106-RB +3R MB7 CDS 66311 66436 0 + 0 Parent=CG1106-RB +3R MB7 CDS 66600 66659 0 + 0 Parent=CG1106-RB +3R MB7 stop_codon 66657 66659 0 + 0 Parent=CG1106-RB +3R MB7 three_prime_UTR 66660 66780 0 + . Parent=CG1106-RB +3R MB7 mRNA 62515 66780 1 + . ID=CG1106-RA;Parent=CG1106;Name=CG1106-RA +3R MB7 exon 62515 62661 0 + . Parent=CG1106-RA +3R MB7 exon 63347 63539 0 + . Parent=CG1106-RA +3R MB7 exon 64025 64099 0 + . Parent=CG1106-RA +3R MB7 exon 64292 64487 0 + . Parent=CG1106-RA +3R MB7 exon 64541 66246 0 + . Parent=CG1106-RA +3R MB7 exon 66311 66436 0 + . Parent=CG1106-RA +3R MB7 exon 66600 66780 0 + . Parent=CG1106-RA +3R MB7 five_prime_UTR 62515 62661 0 + . Parent=CG1106-RA +3R MB7 five_prime_UTR 63347 63479 0 + . Parent=CG1106-RA +3R MB7 start_codon 63480 63482 0 + 0 Parent=CG1106-RA +3R MB7 CDS 63480 63539 0 + 0 Parent=CG1106-RA +3R MB7 CDS 64025 64099 0 + 0 Parent=CG1106-RA +3R MB7 CDS 64292 64487 0 + 0 Parent=CG1106-RA +3R MB7 CDS 64541 66246 0 + 2 Parent=CG1106-RA +3R MB7 CDS 66311 66436 0 + 0 Parent=CG1106-RA +3R MB7 CDS 66600 66659 0 + 0 Parent=CG1106-RA +3R MB7 stop_codon 66657 66659 0 + 0 Parent=CG1106-RA +3R MB7 three_prime_UTR 66660 66780 0 + . Parent=CG1106-RA +3R MB7 mRNA 60868 66780 3 + . ID=CG1106.c;Parent=CG1106;Name=CG1106.c +3R MB7 exon 60868 61046 0 + . Parent=CG1106.c +3R MB7 exon 63347 63539 0 + . Parent=CG1106.c +3R MB7 exon 64025 64099 0 + . Parent=CG1106.c +3R MB7 exon 64292 64487 0 + . Parent=CG1106.c +3R MB7 exon 64541 66246 0 + . Parent=CG1106.c +3R MB7 exon 66311 66436 0 + . Parent=CG1106.c +3R MB7 exon 66600 66780 0 + . Parent=CG1106.c +3R MB7 five_prime_UTR 60868 61046 0 + . Parent=CG1106.c +3R MB7 five_prime_UTR 63347 63479 0 + . Parent=CG1106.c +3R MB7 start_codon 63480 63482 0 + 0 Parent=CG1106.c +3R MB7 CDS 63480 63539 0 + 0 Parent=CG1106.c +3R MB7 CDS 64025 64099 0 + 0 Parent=CG1106.c +3R MB7 CDS 64292 64487 0 + 0 Parent=CG1106.c +3R MB7 CDS 64541 66246 0 + 2 Parent=CG1106.c +3R MB7 CDS 66311 66436 0 + 0 Parent=CG1106.c +3R MB7 CDS 66600 66659 0 + 0 Parent=CG1106.c +3R MB7 stop_codon 66657 66659 0 + 0 Parent=CG1106.c +3R MB7 three_prime_UTR 66660 66780 0 + . Parent=CG1106.c +3R MB7 mRNA 60868 66781 3 + . ID=CG1106.d;Parent=CG1106;Name=CG1106.d +3R MB7 exon 60868 61046 0 + . Parent=CG1106.d +3R MB7 exon 62304 62526 0 + . Parent=CG1106.d +3R MB7 exon 63347 63539 0 + . Parent=CG1106.d +3R MB7 exon 64025 64099 0 + . Parent=CG1106.d +3R MB7 exon 64292 64487 0 + . Parent=CG1106.d +3R MB7 exon 64541 66436 0 + . Parent=CG1106.d +3R MB7 exon 66600 66781 0 + . Parent=CG1106.d +3R MB7 five_prime_UTR 60868 61046 0 + . Parent=CG1106.d +3R MB7 five_prime_UTR 62304 62485 0 + . Parent=CG1106.d +3R MB7 start_codon 62486 62488 0 + 0 Parent=CG1106.d +3R MB7 CDS 62486 62526 0 + 0 Parent=CG1106.d +3R MB7 CDS 63347 63539 0 + 1 Parent=CG1106.d +3R MB7 CDS 64025 64099 0 + 0 Parent=CG1106.d +3R MB7 CDS 64292 64487 0 + 0 Parent=CG1106.d +3R MB7 CDS 64541 66285 0 + 2 Parent=CG1106.d +3R MB7 stop_codon 66283 66285 0 + 0 Parent=CG1106.d +3R MB7 three_prime_UTR 66286 66436 0 + . Parent=CG1106.d +3R MB7 three_prime_UTR 66600 66781 0 + . Parent=CG1106.d +3R MB7 mRNA 60868 66781 3 + . ID=CG1106.e;Parent=CG1106;Name=CG1106.e +3R MB7 exon 60868 61046 0 + . Parent=CG1106.e +3R MB7 exon 63347 63539 0 + . Parent=CG1106.e +3R MB7 exon 64025 64099 0 + . Parent=CG1106.e +3R MB7 exon 64292 64487 0 + . Parent=CG1106.e +3R MB7 exon 64541 66436 0 + . Parent=CG1106.e +3R MB7 exon 66600 66781 0 + . Parent=CG1106.e +3R MB7 five_prime_UTR 60868 61046 0 + . Parent=CG1106.e +3R MB7 five_prime_UTR 63347 63479 0 + . Parent=CG1106.e +3R MB7 start_codon 63480 63482 0 + 0 Parent=CG1106.e +3R MB7 CDS 63480 63539 0 + 0 Parent=CG1106.e +3R MB7 CDS 64025 64099 0 + 0 Parent=CG1106.e +3R MB7 CDS 64292 64487 0 + 0 Parent=CG1106.e +3R MB7 CDS 64541 66285 0 + 2 Parent=CG1106.e +3R MB7 stop_codon 66283 66285 0 + 0 Parent=CG1106.e +3R MB7 three_prime_UTR 66286 66436 0 + . Parent=CG1106.e +3R MB7 three_prime_UTR 66600 66781 0 + . Parent=CG1106.e +3R MB7 mRNA 64259 66780 3 + . ID=CG1106.f;Parent=CG1106;Name=CG1106.f +3R MB7 exon 64259 64487 0 + . Parent=CG1106.f +3R MB7 exon 64541 66246 0 + . Parent=CG1106.f +3R MB7 exon 66311 66436 0 + . Parent=CG1106.f +3R MB7 exon 66600 66780 0 + . Parent=CG1106.f +3R MB7 five_prime_UTR 64259 64487 0 + . Parent=CG1106.f +3R MB7 five_prime_UTR 64541 64677 0 + . Parent=CG1106.f +3R MB7 start_codon 64678 64680 0 + 0 Parent=CG1106.f +3R MB7 CDS 64678 66246 0 + 0 Parent=CG1106.f +3R MB7 CDS 66311 66436 0 + 0 Parent=CG1106.f +3R MB7 CDS 66600 66659 0 + 0 Parent=CG1106.f +3R MB7 stop_codon 66657 66659 0 + 0 Parent=CG1106.f +3R MB7 three_prime_UTR 66660 66780 0 + . Parent=CG1106.f +3R MB7 mRNA 64259 66781 3 + . ID=CG1106.g;Parent=CG1106;Name=CG1106.g +3R MB7 exon 64259 64487 0 + . Parent=CG1106.g +3R MB7 exon 64541 66436 0 + . Parent=CG1106.g +3R MB7 exon 66600 66781 0 + . Parent=CG1106.g +3R MB7 five_prime_UTR 64259 64487 0 + . Parent=CG1106.g +3R MB7 five_prime_UTR 64541 64677 0 + . Parent=CG1106.g +3R MB7 start_codon 64678 64680 0 + 0 Parent=CG1106.g +3R MB7 CDS 64678 66285 0 + 0 Parent=CG1106.g +3R MB7 stop_codon 66283 66285 0 + 0 Parent=CG1106.g +3R MB7 three_prime_UTR 66286 66436 0 + . Parent=CG1106.g +3R MB7 three_prime_UTR 66600 66781 0 + . Parent=CG1106.g +3R MB7 gene 66767 68508 0 - . ID=CG14642;Name=CG14642 +3R MB7 mRNA 66855 68508 3 - . ID=CG14642-RB;Parent=CG14642;Name=CG14642-RB +3R MB7 exon 66855 67420 0 - . Parent=CG14642-RB +3R MB7 exon 67477 67641 0 - . Parent=CG14642-RB +3R MB7 exon 67700 67809 0 - . Parent=CG14642-RB +3R MB7 exon 67880 67995 0 - . Parent=CG14642-RB +3R MB7 exon 68060 68508 0 - . Parent=CG14642-RB +3R MB7 three_prime_UTR 66855 66990 0 - . Parent=CG14642-RB +3R MB7 stop_codon 66991 66993 0 - 0 Parent=CG14642-RB +3R MB7 CDS 66991 67420 0 - 1 Parent=CG14642-RB +3R MB7 CDS 67477 67641 0 - 1 Parent=CG14642-RB +3R MB7 CDS 67700 67809 0 - 0 Parent=CG14642-RB +3R MB7 CDS 67880 67995 0 - 2 Parent=CG14642-RB +3R MB7 CDS 68060 68417 0 - 0 Parent=CG14642-RB +3R MB7 start_codon 68415 68417 0 - 0 Parent=CG14642-RB +3R MB7 five_prime_UTR 68418 68508 0 - . Parent=CG14642-RB +3R MB7 mRNA 66767 68508 1 - . ID=CG14642-RA;Parent=CG14642;Name=CG14642-RA +3R MB7 exon 66767 66854 0 - . Parent=CG14642-RA +3R MB7 exon 66975 67641 0 - . Parent=CG14642-RA +3R MB7 exon 67700 67809 0 - . Parent=CG14642-RA +3R MB7 exon 67897 67995 0 - . Parent=CG14642-RA +3R MB7 exon 68060 68508 0 - . Parent=CG14642-RA +3R MB7 three_prime_UTR 66767 66854 0 - . Parent=CG14642-RA +3R MB7 three_prime_UTR 66975 67605 0 - . Parent=CG14642-RA +3R MB7 stop_codon 67606 67608 0 - 0 Parent=CG14642-RA +3R MB7 CDS 67606 67641 0 - 0 Parent=CG14642-RA +3R MB7 CDS 67700 67809 0 - 2 Parent=CG14642-RA +3R MB7 CDS 67897 67995 0 - 2 Parent=CG14642-RA +3R MB7 CDS 68060 68417 0 - 0 Parent=CG14642-RA +3R MB7 start_codon 68415 68417 0 - 0 Parent=CG14642-RA +3R MB7 five_prime_UTR 68418 68508 0 - . Parent=CG14642-RA +3R MB7 gene 68507 68868 0 - . ID=CG34305;Name=CG34305 +3R MB7 mRNA 68507 68868 1 - . ID=CG34305-RA;Parent=CG34305;Name=CG34305-RA +3R MB7 exon 68507 68781 0 - . Parent=CG34305-RA +3R MB7 exon 68844 68868 0 - . Parent=CG34305-RA +3R MB7 three_prime_UTR 68507 68556 0 - . Parent=CG34305-RA +3R MB7 stop_codon 68557 68559 0 - 0 Parent=CG34305-RA +3R MB7 CDS 68557 68781 0 - 0 Parent=CG34305-RA +3R MB7 CDS 68844 68858 0 - 0 Parent=CG34305-RA +3R MB7 start_codon 68856 68858 0 - 0 Parent=CG34305-RA +3R MB7 five_prime_UTR 68859 68868 0 - . Parent=CG34305-RA +3R MB7 gene 72744 74040 0 + . ID=CG14639;Name=CG14639 +3R MB7 mRNA 72744 74040 1 + . ID=CG14639-RA;Parent=CG14639;Name=CG14639-RA +3R MB7 exon 72744 72806 0 + . Parent=CG14639-RA +3R MB7 exon 72866 74040 0 + . Parent=CG14639-RA +3R MB7 five_prime_UTR 72744 72782 0 + . Parent=CG14639-RA +3R MB7 start_codon 72783 72785 0 + 0 Parent=CG14639-RA +3R MB7 CDS 72783 72806 0 + 0 Parent=CG14639-RA +3R MB7 CDS 72866 73906 0 + 0 Parent=CG14639-RA +3R MB7 stop_codon 73904 73906 0 + 0 Parent=CG14639-RA +3R MB7 three_prime_UTR 73907 74040 0 + . Parent=CG14639-RA +3R MB7 gene 74439 76518 0 - . ID=CG14643;Name=CG14643 +3R MB7 mRNA 74439 76518 1 - . ID=CG14643-RA;Parent=CG14643;Name=CG14643-RA +3R MB7 exon 74439 74739 0 - . Parent=CG14643-RA +3R MB7 exon 74913 75567 0 - . Parent=CG14643-RA +3R MB7 exon 75629 76236 0 - . Parent=CG14643-RA +3R MB7 exon 76457 76518 0 - . Parent=CG14643-RA +3R MB7 three_prime_UTR 74439 74572 0 - . Parent=CG14643-RA +3R MB7 stop_codon 74573 74575 0 - 0 Parent=CG14643-RA +3R MB7 CDS 74573 74739 0 - 2 Parent=CG14643-RA +3R MB7 CDS 74913 75567 0 - 0 Parent=CG14643-RA +3R MB7 CDS 75629 75643 0 - 0 Parent=CG14643-RA +3R MB7 start_codon 75641 75643 0 - 0 Parent=CG14643-RA +3R MB7 five_prime_UTR 75644 76236 0 - . Parent=CG14643-RA +3R MB7 five_prime_UTR 76457 76518 0 - . Parent=CG14643-RA +3R MB7 gene 77614 78765 0 - . ID=CG14644;Name=CG14644 +3R MB7 mRNA 77614 78765 2 - . ID=CG14644.a;Parent=CG14644;Name=CG14644.a +3R MB7 exon 77614 77964 0 - . Parent=CG14644.a +3R MB7 exon 78020 78436 0 - . Parent=CG14644.a +3R MB7 exon 78537 78765 0 - . Parent=CG14644.a +3R MB7 three_prime_UTR 77614 77699 0 - . Parent=CG14644.a +3R MB7 stop_codon 77700 77702 0 - 0 Parent=CG14644.a +3R MB7 CDS 77700 77964 0 - 1 Parent=CG14644.a +3R MB7 CDS 78020 78432 0 - 0 Parent=CG14644.a +3R MB7 start_codon 78430 78432 0 - 0 Parent=CG14644.a +3R MB7 five_prime_UTR 78433 78436 0 - . Parent=CG14644.a +3R MB7 five_prime_UTR 78537 78765 0 - . Parent=CG14644.a +3R MB7 mRNA 77614 78765 1 - . ID=CG14644-RA;Parent=CG14644;Name=CG14644-RA +3R MB7 exon 77614 77964 0 - . Parent=CG14644-RA +3R MB7 exon 78020 78536 0 - . Parent=CG14644-RA +3R MB7 exon 78598 78765 0 - . Parent=CG14644-RA +3R MB7 three_prime_UTR 77614 77699 0 - . Parent=CG14644-RA +3R MB7 stop_codon 77700 77702 0 - 0 Parent=CG14644-RA +3R MB7 CDS 77700 77964 0 - 1 Parent=CG14644-RA +3R MB7 CDS 78020 78536 0 - 2 Parent=CG14644-RA +3R MB7 CDS 78598 78697 0 - 0 Parent=CG14644-RA +3R MB7 start_codon 78695 78697 0 - 0 Parent=CG14644-RA +3R MB7 five_prime_UTR 78698 78765 0 - . Parent=CG14644-RA +3R MB7 gene 92676 94166 0 + . ID=CG1092;Name=CG1092 +3R MB7 mRNA 92676 94166 1 + . ID=CG1092.a;Parent=CG1092;Name=CG1092.a +3R MB7 exon 92676 92927 0 + . Parent=CG1092.a +3R MB7 exon 92983 94166 0 + . Parent=CG1092.a +3R MB7 five_prime_UTR 92676 92695 0 + . Parent=CG1092.a +3R MB7 start_codon 92696 92698 0 + 0 Parent=CG1092.a +3R MB7 CDS 92696 92927 0 + 0 Parent=CG1092.a +3R MB7 CDS 92983 93935 0 + 2 Parent=CG1092.a +3R MB7 stop_codon 93933 93935 0 + 0 Parent=CG1092.a +3R MB7 three_prime_UTR 93936 94166 0 + . Parent=CG1092.a +3R MB7 mRNA 92676 94166 1 + . ID=CG1092-RA;Parent=CG1092;Name=CG1092-RA +3R MB7 exon 92676 92927 0 + . Parent=CG1092-RA +3R MB7 exon 92983 94166 0 + . Parent=CG1092-RA +3R MB7 five_prime_UTR 92676 92746 0 + . Parent=CG1092-RA +3R MB7 start_codon 92747 92749 0 + 0 Parent=CG1092-RA +3R MB7 CDS 92747 92927 0 + 0 Parent=CG1092-RA +3R MB7 CDS 92983 93935 0 + 2 Parent=CG1092-RA +3R MB7 stop_codon 93933 93935 0 + 0 Parent=CG1092-RA +3R MB7 three_prime_UTR 93936 94166 0 + . Parent=CG1092-RA +3R MB7 mRNA 92694 94005 34 + . ID=CG1092-RB;Parent=CG1092;Name=CG1092-RB +3R MB7 exon 92694 94005 0 + . Parent=CG1092-RB +3R MB7 five_prime_UTR 92694 92987 0 + . Parent=CG1092-RB +3R MB7 start_codon 92988 92990 0 + 0 Parent=CG1092-RB +3R MB7 CDS 92988 93935 0 + 0 Parent=CG1092-RB +3R MB7 stop_codon 93933 93935 0 + 0 Parent=CG1092-RB +3R MB7 three_prime_UTR 93936 94005 0 + . Parent=CG1092-RB +3R MB7 gene 94943 103515 0 - . ID=CG9766;Name=CG9766 +3R MB7 mRNA 94943 102759 2 - . ID=CG9766.a;Parent=CG9766;Name=CG9766.a +3R MB7 exon 94943 95510 0 - . Parent=CG9766.a +3R MB7 exon 95570 95774 0 - . Parent=CG9766.a +3R MB7 exon 95831 96076 0 - . Parent=CG9766.a +3R MB7 exon 102704 102759 0 - . Parent=CG9766.a +3R MB7 three_prime_UTR 94943 95286 0 - . Parent=CG9766.a +3R MB7 stop_codon 95287 95289 0 - 0 Parent=CG9766.a +3R MB7 CDS 95287 95510 0 - 2 Parent=CG9766.a +3R MB7 CDS 95570 95774 0 - 0 Parent=CG9766.a +3R MB7 CDS 95831 95995 0 - 0 Parent=CG9766.a +3R MB7 start_codon 95993 95995 0 - 0 Parent=CG9766.a +3R MB7 five_prime_UTR 95996 96076 0 - . Parent=CG9766.a +3R MB7 five_prime_UTR 102704 102759 0 - . Parent=CG9766.a +3R MB7 mRNA 94943 103515 1 - . ID=CG9766-RB;Parent=CG9766;Name=CG9766-RB +3R MB7 exon 94943 95510 0 - . Parent=CG9766-RB +3R MB7 exon 95570 95774 0 - . Parent=CG9766-RB +3R MB7 exon 95831 96076 0 - . Parent=CG9766-RB +3R MB7 exon 103351 103515 0 - . Parent=CG9766-RB +3R MB7 three_prime_UTR 94943 95286 0 - . Parent=CG9766-RB +3R MB7 stop_codon 95287 95289 0 - 0 Parent=CG9766-RB +3R MB7 CDS 95287 95510 0 - 2 Parent=CG9766-RB +3R MB7 CDS 95570 95774 0 - 0 Parent=CG9766-RB +3R MB7 CDS 95831 96076 0 - 0 Parent=CG9766-RB +3R MB7 CDS 103351 103515 0 - 0 Parent=CG9766-RB +3R MB7 start_codon 103513 103515 0 - 0 Parent=CG9766-RB +3R MB7 gene 105906 128309 0 + . ID=CG32490;Name=CG32490 +3R MB7 mRNA 107886 127263 3 + . ID=CG32490.a;Parent=CG32490;Name=CG32490.a +3R MB7 exon 107886 108036 0 + . Parent=CG32490.a +3R MB7 exon 108396 108556 0 + . Parent=CG32490.a +3R MB7 exon 109948 110128 0 + . Parent=CG32490.a +3R MB7 exon 113794 113805 0 + . Parent=CG32490.a +3R MB7 exon 120851 121008 0 + . Parent=CG32490.a +3R MB7 exon 121290 121422 0 + . Parent=CG32490.a +3R MB7 exon 123210 124307 0 + . Parent=CG32490.a +3R MB7 exon 125512 127263 0 + . Parent=CG32490.a +3R MB7 five_prime_UTR 107886 108036 0 + . Parent=CG32490.a +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490.a +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490.a +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490.a +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490.a +3R MB7 CDS 113794 113805 0 + 2 Parent=CG32490.a +3R MB7 CDS 120851 121008 0 + 2 Parent=CG32490.a +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490.a +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490.a +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490.a +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490.a +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490.a +3R MB7 mRNA 107627 127263 3 + . ID=CG32490.b;Parent=CG32490;Name=CG32490.b +3R MB7 exon 107627 107725 0 + . Parent=CG32490.b +3R MB7 exon 108396 108556 0 + . Parent=CG32490.b +3R MB7 exon 109948 110128 0 + . Parent=CG32490.b +3R MB7 exon 113794 113805 0 + . Parent=CG32490.b +3R MB7 exon 120851 121008 0 + . Parent=CG32490.b +3R MB7 exon 121290 121422 0 + . Parent=CG32490.b +3R MB7 exon 123210 124307 0 + . Parent=CG32490.b +3R MB7 exon 125512 127263 0 + . Parent=CG32490.b +3R MB7 five_prime_UTR 107627 107725 0 + . Parent=CG32490.b +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490.b +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490.b +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490.b +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490.b +3R MB7 CDS 113794 113805 0 + 2 Parent=CG32490.b +3R MB7 CDS 120851 121008 0 + 2 Parent=CG32490.b +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490.b +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490.b +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490.b +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490.b +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490.b +3R MB7 mRNA 107427 127263 3 + . ID=CG32490.c;Parent=CG32490;Name=CG32490.c +3R MB7 exon 107427 107488 0 + . Parent=CG32490.c +3R MB7 exon 108396 108556 0 + . Parent=CG32490.c +3R MB7 exon 109948 110128 0 + . Parent=CG32490.c +3R MB7 exon 113794 113805 0 + . Parent=CG32490.c +3R MB7 exon 120851 121008 0 + . Parent=CG32490.c +3R MB7 exon 121290 121422 0 + . Parent=CG32490.c +3R MB7 exon 123210 124307 0 + . Parent=CG32490.c +3R MB7 exon 125512 127263 0 + . Parent=CG32490.c +3R MB7 five_prime_UTR 107427 107488 0 + . Parent=CG32490.c +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490.c +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490.c +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490.c +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490.c +3R MB7 CDS 113794 113805 0 + 2 Parent=CG32490.c +3R MB7 CDS 120851 121008 0 + 2 Parent=CG32490.c +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490.c +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490.c +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490.c +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490.c +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490.c +3R MB7 mRNA 107427 127263 3 + . ID=CG32490.d;Parent=CG32490;Name=CG32490.d +3R MB7 exon 107427 107593 0 + . Parent=CG32490.d +3R MB7 exon 108396 108556 0 + . Parent=CG32490.d +3R MB7 exon 109948 110128 0 + . Parent=CG32490.d +3R MB7 exon 113794 113805 0 + . Parent=CG32490.d +3R MB7 exon 120851 121008 0 + . Parent=CG32490.d +3R MB7 exon 121290 121422 0 + . Parent=CG32490.d +3R MB7 exon 123210 124307 0 + . Parent=CG32490.d +3R MB7 exon 125512 127263 0 + . Parent=CG32490.d +3R MB7 five_prime_UTR 107427 107593 0 + . Parent=CG32490.d +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490.d +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490.d +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490.d +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490.d +3R MB7 CDS 113794 113805 0 + 2 Parent=CG32490.d +3R MB7 CDS 120851 121008 0 + 2 Parent=CG32490.d +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490.d +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490.d +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490.d +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490.d +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490.d +3R MB7 mRNA 105906 127263 3 + . ID=CG32490.e;Parent=CG32490;Name=CG32490.e +3R MB7 exon 105906 106078 0 + . Parent=CG32490.e +3R MB7 exon 108396 108556 0 + . Parent=CG32490.e +3R MB7 exon 109948 110128 0 + . Parent=CG32490.e +3R MB7 exon 113794 113805 0 + . Parent=CG32490.e +3R MB7 exon 120851 121008 0 + . Parent=CG32490.e +3R MB7 exon 121290 121422 0 + . Parent=CG32490.e +3R MB7 exon 123210 124307 0 + . Parent=CG32490.e +3R MB7 exon 125512 127263 0 + . Parent=CG32490.e +3R MB7 five_prime_UTR 105906 106078 0 + . Parent=CG32490.e +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490.e +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490.e +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490.e +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490.e +3R MB7 CDS 113794 113805 0 + 2 Parent=CG32490.e +3R MB7 CDS 120851 121008 0 + 2 Parent=CG32490.e +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490.e +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490.e +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490.e +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490.e +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490.e +3R MB7 mRNA 108172 127263 3 + . ID=CG32490.f;Parent=CG32490;Name=CG32490.f +3R MB7 exon 108172 108204 0 + . Parent=CG32490.f +3R MB7 exon 108396 108556 0 + . Parent=CG32490.f +3R MB7 exon 109948 110128 0 + . Parent=CG32490.f +3R MB7 exon 120842 121008 0 + . Parent=CG32490.f +3R MB7 exon 121290 121422 0 + . Parent=CG32490.f +3R MB7 exon 123210 124307 0 + . Parent=CG32490.f +3R MB7 exon 125512 127263 0 + . Parent=CG32490.f +3R MB7 five_prime_UTR 108172 108204 0 + . Parent=CG32490.f +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490.f +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490.f +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490.f +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490.f +3R MB7 CDS 120842 121008 0 + 2 Parent=CG32490.f +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490.f +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490.f +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490.f +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490.f +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490.f +3R MB7 mRNA 107974 127263 3 + . ID=CG32490-RP;Parent=CG32490;Name=CG32490-RP +3R MB7 exon 107974 108036 0 + . Parent=CG32490-RP +3R MB7 exon 108396 108556 0 + . Parent=CG32490-RP +3R MB7 exon 109948 110128 0 + . Parent=CG32490-RP +3R MB7 exon 120851 121008 0 + . Parent=CG32490-RP +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RP +3R MB7 exon 123210 124307 0 + . Parent=CG32490-RP +3R MB7 exon 125512 127263 0 + . Parent=CG32490-RP +3R MB7 five_prime_UTR 107974 108036 0 + . Parent=CG32490-RP +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490-RP +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490-RP +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490-RP +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490-RP +3R MB7 CDS 120851 121008 0 + 2 Parent=CG32490-RP +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RP +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490-RP +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490-RP +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490-RP +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490-RP +3R MB7 mRNA 107625 127263 3 + . ID=CG32490-RN;Parent=CG32490;Name=CG32490-RN +3R MB7 exon 107625 107725 0 + . Parent=CG32490-RN +3R MB7 exon 108396 108556 0 + . Parent=CG32490-RN +3R MB7 exon 109948 110128 0 + . Parent=CG32490-RN +3R MB7 exon 120851 121008 0 + . Parent=CG32490-RN +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RN +3R MB7 exon 123210 124307 0 + . Parent=CG32490-RN +3R MB7 exon 125512 127263 0 + . Parent=CG32490-RN +3R MB7 five_prime_UTR 107625 107725 0 + . Parent=CG32490-RN +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490-RN +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490-RN +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490-RN +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490-RN +3R MB7 CDS 120851 121008 0 + 2 Parent=CG32490-RN +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RN +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490-RN +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490-RN +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490-RN +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490-RN +3R MB7 mRNA 107570 127263 3 + . ID=CG32490.g;Parent=CG32490;Name=CG32490.g +3R MB7 exon 107570 107637 0 + . Parent=CG32490.g +3R MB7 exon 108396 108556 0 + . Parent=CG32490.g +3R MB7 exon 109948 110128 0 + . Parent=CG32490.g +3R MB7 exon 120842 121008 0 + . Parent=CG32490.g +3R MB7 exon 121290 121422 0 + . Parent=CG32490.g +3R MB7 exon 123210 124307 0 + . Parent=CG32490.g +3R MB7 exon 125512 127263 0 + . Parent=CG32490.g +3R MB7 five_prime_UTR 107570 107637 0 + . Parent=CG32490.g +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490.g +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490.g +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490.g +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490.g +3R MB7 CDS 120842 121008 0 + 2 Parent=CG32490.g +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490.g +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490.g +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490.g +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490.g +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490.g +3R MB7 mRNA 107552 127263 3 + . ID=CG32490-RO;Parent=CG32490;Name=CG32490-RO +3R MB7 exon 107552 107652 0 + . Parent=CG32490-RO +3R MB7 exon 108396 108556 0 + . Parent=CG32490-RO +3R MB7 exon 109948 110128 0 + . Parent=CG32490-RO +3R MB7 exon 120851 121008 0 + . Parent=CG32490-RO +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RO +3R MB7 exon 123210 124307 0 + . Parent=CG32490-RO +3R MB7 exon 125512 127263 0 + . Parent=CG32490-RO +3R MB7 five_prime_UTR 107552 107652 0 + . Parent=CG32490-RO +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490-RO +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490-RO +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490-RO +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490-RO +3R MB7 CDS 120851 121008 0 + 2 Parent=CG32490-RO +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RO +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490-RO +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490-RO +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490-RO +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490-RO +3R MB7 mRNA 107552 127263 3 + . ID=CG32490-RM;Parent=CG32490;Name=CG32490-RM +3R MB7 exon 107552 107725 0 + . Parent=CG32490-RM +3R MB7 exon 108396 108556 0 + . Parent=CG32490-RM +3R MB7 exon 109948 110128 0 + . Parent=CG32490-RM +3R MB7 exon 120851 121008 0 + . Parent=CG32490-RM +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RM +3R MB7 exon 123210 124307 0 + . Parent=CG32490-RM +3R MB7 exon 125512 127263 0 + . Parent=CG32490-RM +3R MB7 five_prime_UTR 107552 107725 0 + . Parent=CG32490-RM +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490-RM +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490-RM +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490-RM +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490-RM +3R MB7 CDS 120851 121008 0 + 2 Parent=CG32490-RM +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RM +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490-RM +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490-RM +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490-RM +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490-RM +3R MB7 mRNA 107427 127263 3 + . ID=CG32490.h;Parent=CG32490;Name=CG32490.h +3R MB7 exon 107427 107593 0 + . Parent=CG32490.h +3R MB7 exon 108396 108556 0 + . Parent=CG32490.h +3R MB7 exon 109948 110128 0 + . Parent=CG32490.h +3R MB7 exon 120842 121008 0 + . Parent=CG32490.h +3R MB7 exon 121290 121422 0 + . Parent=CG32490.h +3R MB7 exon 123210 124307 0 + . Parent=CG32490.h +3R MB7 exon 125512 127263 0 + . Parent=CG32490.h +3R MB7 five_prime_UTR 107427 107593 0 + . Parent=CG32490.h +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490.h +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490.h +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490.h +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490.h +3R MB7 CDS 120842 121008 0 + 2 Parent=CG32490.h +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490.h +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490.h +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490.h +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490.h +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490.h +3R MB7 mRNA 107426 127263 1 + . ID=CG32490-RC;Parent=CG32490;Name=CG32490-RC +3R MB7 exon 107426 107593 0 + . Parent=CG32490-RC +3R MB7 exon 108396 108556 0 + . Parent=CG32490-RC +3R MB7 exon 109948 110128 0 + . Parent=CG32490-RC +3R MB7 exon 120851 121008 0 + . Parent=CG32490-RC +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RC +3R MB7 exon 123210 124307 0 + . Parent=CG32490-RC +3R MB7 exon 125512 127263 0 + . Parent=CG32490-RC +3R MB7 five_prime_UTR 107426 107593 0 + . Parent=CG32490-RC +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490-RC +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490-RC +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490-RC +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490-RC +3R MB7 CDS 120851 121008 0 + 2 Parent=CG32490-RC +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RC +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490-RC +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490-RC +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490-RC +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490-RC +3R MB7 mRNA 106273 127263 3 + . ID=CG32490-RH;Parent=CG32490;Name=CG32490-RH +3R MB7 exon 106273 106544 0 + . Parent=CG32490-RH +3R MB7 exon 108396 108556 0 + . Parent=CG32490-RH +3R MB7 exon 109948 110128 0 + . Parent=CG32490-RH +3R MB7 exon 120842 121008 0 + . Parent=CG32490-RH +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RH +3R MB7 exon 123210 124307 0 + . Parent=CG32490-RH +3R MB7 exon 125512 127263 0 + . Parent=CG32490-RH +3R MB7 five_prime_UTR 106273 106544 0 + . Parent=CG32490-RH +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490-RH +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490-RH +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490-RH +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490-RH +3R MB7 CDS 120842 121008 0 + 2 Parent=CG32490-RH +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RH +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490-RH +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490-RH +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490-RH +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490-RH +3R MB7 mRNA 106111 127263 3 + . ID=CG32490-RI;Parent=CG32490;Name=CG32490-RI +3R MB7 exon 106111 106191 0 + . Parent=CG32490-RI +3R MB7 exon 108396 108556 0 + . Parent=CG32490-RI +3R MB7 exon 109948 110128 0 + . Parent=CG32490-RI +3R MB7 exon 120842 121008 0 + . Parent=CG32490-RI +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RI +3R MB7 exon 123210 124307 0 + . Parent=CG32490-RI +3R MB7 exon 125512 127263 0 + . Parent=CG32490-RI +3R MB7 five_prime_UTR 106111 106191 0 + . Parent=CG32490-RI +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490-RI +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490-RI +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490-RI +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490-RI +3R MB7 CDS 120842 121008 0 + 2 Parent=CG32490-RI +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RI +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490-RI +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490-RI +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490-RI +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490-RI +3R MB7 mRNA 105906 127263 3 + . ID=CG32490-RG;Parent=CG32490;Name=CG32490-RG +3R MB7 exon 105906 106078 0 + . Parent=CG32490-RG +3R MB7 exon 108396 108556 0 + . Parent=CG32490-RG +3R MB7 exon 109948 110128 0 + . Parent=CG32490-RG +3R MB7 exon 120842 121008 0 + . Parent=CG32490-RG +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RG +3R MB7 exon 123210 124307 0 + . Parent=CG32490-RG +3R MB7 exon 125512 127263 0 + . Parent=CG32490-RG +3R MB7 five_prime_UTR 105906 106078 0 + . Parent=CG32490-RG +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490-RG +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490-RG +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490-RG +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490-RG +3R MB7 CDS 120842 121008 0 + 2 Parent=CG32490-RG +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RG +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490-RG +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490-RG +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490-RG +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490-RG +3R MB7 mRNA 108259 127263 3 + . ID=CG32490-RA;Parent=CG32490;Name=CG32490-RA +3R MB7 exon 108259 108556 0 + . Parent=CG32490-RA +3R MB7 exon 109948 110128 0 + . Parent=CG32490-RA +3R MB7 exon 120842 121008 0 + . Parent=CG32490-RA +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RA +3R MB7 exon 123210 124307 0 + . Parent=CG32490-RA +3R MB7 exon 125512 127263 0 + . Parent=CG32490-RA +3R MB7 five_prime_UTR 108259 108556 0 + . Parent=CG32490-RA +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490-RA +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490-RA +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490-RA +3R MB7 CDS 120842 121008 0 + 2 Parent=CG32490-RA +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RA +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490-RA +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490-RA +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490-RA +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490-RA +3R MB7 mRNA 120617 127263 1 + . ID=CG32490-RJ;Parent=CG32490;Name=CG32490-RJ +3R MB7 exon 120617 120666 0 + . Parent=CG32490-RJ +3R MB7 exon 120842 121008 0 + . Parent=CG32490-RJ +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RJ +3R MB7 exon 123210 124307 0 + . Parent=CG32490-RJ +3R MB7 exon 125512 127263 0 + . Parent=CG32490-RJ +3R MB7 five_prime_UTR 120617 120666 0 + . Parent=CG32490-RJ +3R MB7 five_prime_UTR 120842 120963 0 + . Parent=CG32490-RJ +3R MB7 start_codon 120964 120966 0 + 0 Parent=CG32490-RJ +3R MB7 CDS 120964 121008 0 + 0 Parent=CG32490-RJ +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RJ +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490-RJ +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490-RJ +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490-RJ +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490-RJ +3R MB7 mRNA 117670 127263 3 + . ID=CG32490-RL;Parent=CG32490;Name=CG32490-RL +3R MB7 exon 117670 117794 0 + . Parent=CG32490-RL +3R MB7 exon 120842 121008 0 + . Parent=CG32490-RL +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RL +3R MB7 exon 123210 124307 0 + . Parent=CG32490-RL +3R MB7 exon 125512 127263 0 + . Parent=CG32490-RL +3R MB7 five_prime_UTR 117670 117781 0 + . Parent=CG32490-RL +3R MB7 start_codon 117782 117784 0 + 0 Parent=CG32490-RL +3R MB7 CDS 117782 117794 0 + 0 Parent=CG32490-RL +3R MB7 CDS 120842 121008 0 + 2 Parent=CG32490-RL +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RL +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490-RL +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490-RL +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490-RL +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490-RL +3R MB7 mRNA 117460 127263 3 + . ID=CG32490-RK;Parent=CG32490;Name=CG32490-RK +3R MB7 exon 117460 117991 0 + . Parent=CG32490-RK +3R MB7 exon 120842 121008 0 + . Parent=CG32490-RK +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RK +3R MB7 exon 123210 124307 0 + . Parent=CG32490-RK +3R MB7 exon 125512 127263 0 + . Parent=CG32490-RK +3R MB7 five_prime_UTR 117460 117991 0 + . Parent=CG32490-RK +3R MB7 five_prime_UTR 120842 120963 0 + . Parent=CG32490-RK +3R MB7 start_codon 120964 120966 0 + 0 Parent=CG32490-RK +3R MB7 CDS 120964 121008 0 + 0 Parent=CG32490-RK +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RK +3R MB7 CDS 123210 123283 0 + 2 Parent=CG32490-RK +3R MB7 stop_codon 123281 123283 0 + 0 Parent=CG32490-RK +3R MB7 three_prime_UTR 123284 124307 0 + . Parent=CG32490-RK +3R MB7 three_prime_UTR 125512 127263 0 + . Parent=CG32490-RK +3R MB7 mRNA 107427 128309 2 + . ID=CG32490.i;Parent=CG32490;Name=CG32490.i +3R MB7 exon 107427 107593 0 + . Parent=CG32490.i +3R MB7 exon 108396 108556 0 + . Parent=CG32490.i +3R MB7 exon 109948 110128 0 + . Parent=CG32490.i +3R MB7 exon 120842 121008 0 + . Parent=CG32490.i +3R MB7 exon 121290 121422 0 + . Parent=CG32490.i +3R MB7 exon 128248 128309 0 + . Parent=CG32490.i +3R MB7 five_prime_UTR 107427 107593 0 + . Parent=CG32490.i +3R MB7 five_prime_UTR 108396 108556 0 + . Parent=CG32490.i +3R MB7 five_prime_UTR 109948 110073 0 + . Parent=CG32490.i +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490.i +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490.i +3R MB7 CDS 120842 121008 0 + 2 Parent=CG32490.i +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490.i +3R MB7 CDS 128248 128309 0 + 2 Parent=CG32490.i +3R MB7 stop_codon 128307 128309 0 + 0 Parent=CG32490.i +3R MB7 mRNA 110074 128309 1 + . ID=CG32490-RE;Parent=CG32490;Name=CG32490-RE +3R MB7 exon 110074 110128 0 + . Parent=CG32490-RE +3R MB7 exon 120842 121008 0 + . Parent=CG32490-RE +3R MB7 exon 121290 121422 0 + . Parent=CG32490-RE +3R MB7 exon 128248 128309 0 + . Parent=CG32490-RE +3R MB7 start_codon 110074 110076 0 + 0 Parent=CG32490-RE +3R MB7 CDS 110074 110128 0 + 0 Parent=CG32490-RE +3R MB7 CDS 120842 121008 0 + 2 Parent=CG32490-RE +3R MB7 CDS 121290 121422 0 + 0 Parent=CG32490-RE +3R MB7 CDS 128248 128309 0 + 2 Parent=CG32490-RE +3R MB7 stop_codon 128307 128309 0 + 0 Parent=CG32490-RE +3R MB7 gene 117996 120558 0 - . ID=CG9780;Name=CG9780 +3R MB7 mRNA 117996 120558 1 - . ID=CG9780-RA;Parent=CG9780;Name=CG9780-RA +3R MB7 exon 117996 119089 0 - . Parent=CG9780-RA +3R MB7 exon 119475 120558 0 - . Parent=CG9780-RA +3R MB7 three_prime_UTR 117996 118205 0 - . Parent=CG9780-RA +3R MB7 stop_codon 118206 118208 0 - 0 Parent=CG9780-RA +3R MB7 CDS 118206 119089 0 - 2 Parent=CG9780-RA +3R MB7 CDS 119475 120369 0 - 0 Parent=CG9780-RA +3R MB7 start_codon 120367 120369 0 - 0 Parent=CG9780-RA +3R MB7 five_prime_UTR 120370 120558 0 - . Parent=CG9780-RA +3R MB7 gene 133630 135559 0 + . ID=CG1102;Name=CG1102 +3R MB7 mRNA 133630 135559 1 + . ID=CG1102-RA;Parent=CG1102;Name=CG1102-RA +3R MB7 exon 133630 133778 0 + . Parent=CG1102-RA +3R MB7 exon 133986 134149 0 + . Parent=CG1102-RA +3R MB7 exon 134342 134555 0 + . Parent=CG1102-RA +3R MB7 exon 134617 135559 0 + . Parent=CG1102-RA +3R MB7 five_prime_UTR 133630 133708 0 + . Parent=CG1102-RA +3R MB7 start_codon 133709 133711 0 + 0 Parent=CG1102-RA +3R MB7 CDS 133709 133778 0 + 0 Parent=CG1102-RA +3R MB7 CDS 133986 134149 0 + 2 Parent=CG1102-RA +3R MB7 CDS 134342 134555 0 + 0 Parent=CG1102-RA +3R MB7 CDS 134617 135341 0 + 2 Parent=CG1102-RA +3R MB7 stop_codon 135339 135341 0 + 0 Parent=CG1102-RA +3R MB7 three_prime_UTR 135342 135559 0 + . Parent=CG1102-RA +3R MB7 gene 135364 136669 0 - . ID=CG9779;Name=CG9779 +3R MB7 mRNA 135364 136669 1 - . ID=CG9779-RA;Parent=CG9779;Name=CG9779-RA +3R MB7 exon 135364 136080 0 - . Parent=CG9779-RA +3R MB7 exon 136136 136376 0 - . Parent=CG9779-RA +3R MB7 exon 136509 136669 0 - . Parent=CG9779-RA +3R MB7 three_prime_UTR 135364 135694 0 - . Parent=CG9779-RA +3R MB7 stop_codon 135695 135697 0 - 0 Parent=CG9779-RA +3R MB7 CDS 135695 136080 0 - 2 Parent=CG9779-RA +3R MB7 CDS 136136 136376 0 - 0 Parent=CG9779-RA +3R MB7 CDS 136509 136553 0 - 0 Parent=CG9779-RA +3R MB7 start_codon 136551 136553 0 - 0 Parent=CG9779-RA +3R MB7 five_prime_UTR 136554 136669 0 - . Parent=CG9779-RA +3R MB7 gene 137249 140094 0 + . ID=CG9791;Name=CG9791 +3R MB7 mRNA 137258 140094 3 + . ID=CG9791.a;Parent=CG9791;Name=CG9791.a +3R MB7 exon 137258 137696 0 + . Parent=CG9791.a +3R MB7 exon 137752 138036 0 + . Parent=CG9791.a +3R MB7 exon 138105 138255 0 + . Parent=CG9791.a +3R MB7 exon 138319 138628 0 + . Parent=CG9791.a +3R MB7 exon 138683 138817 0 + . Parent=CG9791.a +3R MB7 exon 138880 139509 0 + . Parent=CG9791.a +3R MB7 exon 139564 140094 0 + . Parent=CG9791.a +3R MB7 five_prime_UTR 137258 137696 0 + . Parent=CG9791.a +3R MB7 five_prime_UTR 137752 138015 0 + . Parent=CG9791.a +3R MB7 start_codon 138016 138018 0 + 0 Parent=CG9791.a +3R MB7 CDS 138016 138036 0 + 0 Parent=CG9791.a +3R MB7 CDS 138105 138255 0 + 0 Parent=CG9791.a +3R MB7 CDS 138319 138628 0 + 2 Parent=CG9791.a +3R MB7 CDS 138683 138817 0 + 1 Parent=CG9791.a +3R MB7 CDS 138880 139509 0 + 1 Parent=CG9791.a +3R MB7 CDS 139564 139966 0 + 1 Parent=CG9791.a +3R MB7 stop_codon 139964 139966 0 + 0 Parent=CG9791.a +3R MB7 three_prime_UTR 139967 140094 0 + . Parent=CG9791.a +3R MB7 mRNA 137249 140094 3 + . ID=CG9791.b;Parent=CG9791;Name=CG9791.b +3R MB7 exon 137249 137315 0 + . Parent=CG9791.b +3R MB7 exon 137378 137696 0 + . Parent=CG9791.b +3R MB7 exon 137752 138255 0 + . Parent=CG9791.b +3R MB7 exon 138319 138628 0 + . Parent=CG9791.b +3R MB7 exon 138683 138817 0 + . Parent=CG9791.b +3R MB7 exon 138880 139509 0 + . Parent=CG9791.b +3R MB7 exon 139564 140094 0 + . Parent=CG9791.b +3R MB7 five_prime_UTR 137249 137315 0 + . Parent=CG9791.b +3R MB7 five_prime_UTR 137378 137386 0 + . Parent=CG9791.b +3R MB7 start_codon 137387 137389 0 + 0 Parent=CG9791.b +3R MB7 CDS 137387 137696 0 + 0 Parent=CG9791.b +3R MB7 CDS 137752 138255 0 + 2 Parent=CG9791.b +3R MB7 CDS 138319 138628 0 + 2 Parent=CG9791.b +3R MB7 CDS 138683 138817 0 + 1 Parent=CG9791.b +3R MB7 CDS 138880 139509 0 + 1 Parent=CG9791.b +3R MB7 CDS 139564 139966 0 + 1 Parent=CG9791.b +3R MB7 stop_codon 139964 139966 0 + 0 Parent=CG9791.b +3R MB7 three_prime_UTR 139967 140094 0 + . Parent=CG9791.b +3R MB7 mRNA 137258 140094 1 + . ID=CG9791-RC;Parent=CG9791;Name=CG9791-RC +3R MB7 exon 137258 137696 0 + . Parent=CG9791-RC +3R MB7 exon 137752 138255 0 + . Parent=CG9791-RC +3R MB7 exon 138319 138628 0 + . Parent=CG9791-RC +3R MB7 exon 138683 138817 0 + . Parent=CG9791-RC +3R MB7 exon 138880 139509 0 + . Parent=CG9791-RC +3R MB7 exon 139564 140094 0 + . Parent=CG9791-RC +3R MB7 five_prime_UTR 137258 137386 0 + . Parent=CG9791-RC +3R MB7 start_codon 137387 137389 0 + 0 Parent=CG9791-RC +3R MB7 CDS 137387 137696 0 + 0 Parent=CG9791-RC +3R MB7 CDS 137752 138255 0 + 2 Parent=CG9791-RC +3R MB7 CDS 138319 138628 0 + 2 Parent=CG9791-RC +3R MB7 CDS 138683 138817 0 + 1 Parent=CG9791-RC +3R MB7 CDS 138880 139509 0 + 1 Parent=CG9791-RC +3R MB7 CDS 139564 139966 0 + 1 Parent=CG9791-RC +3R MB7 stop_codon 139964 139966 0 + 0 Parent=CG9791-RC +3R MB7 three_prime_UTR 139967 140094 0 + . Parent=CG9791-RC +3R MB7 gene 141310 144791 0 - . ID=CG9778;Name=CG9778 +3R MB7 mRNA 141310 144791 1 - . ID=CG9778-RA;Parent=CG9778;Name=CG9778-RA +3R MB7 exon 141310 142828 0 - . Parent=CG9778-RA +3R MB7 exon 143376 143611 0 - . Parent=CG9778-RA +3R MB7 exon 143678 144010 0 - . Parent=CG9778-RA +3R MB7 exon 144070 144231 0 - . Parent=CG9778-RA +3R MB7 exon 144304 144791 0 - . Parent=CG9778-RA +3R MB7 three_prime_UTR 141310 141844 0 - . Parent=CG9778-RA +3R MB7 stop_codon 141845 141847 0 - 0 Parent=CG9778-RA +3R MB7 CDS 141845 142828 0 - 0 Parent=CG9778-RA +3R MB7 CDS 143376 143611 0 - 2 Parent=CG9778-RA +3R MB7 CDS 143678 144010 0 - 2 Parent=CG9778-RA +3R MB7 CDS 144070 144231 0 - 2 Parent=CG9778-RA +3R MB7 CDS 144304 144349 0 - 0 Parent=CG9778-RA +3R MB7 start_codon 144347 144349 0 - 0 Parent=CG9778-RA +3R MB7 five_prime_UTR 144350 144791 0 - . Parent=CG9778-RA +3R MB7 gene 145412 152096 0 + . ID=CG9795;Name=CG9795 +3R MB7 mRNA 145414 151818 2 + . ID=CG9795.a;Parent=CG9795;Name=CG9795.a +3R MB7 exon 145414 145612 0 + . Parent=CG9795.a +3R MB7 exon 147567 147769 0 + . Parent=CG9795.a +3R MB7 exon 148070 148217 0 + . Parent=CG9795.a +3R MB7 exon 148953 149344 0 + . Parent=CG9795.a +3R MB7 exon 149409 149611 0 + . Parent=CG9795.a +3R MB7 exon 149675 149886 0 + . Parent=CG9795.a +3R MB7 exon 150059 150232 0 + . Parent=CG9795.a +3R MB7 exon 150310 150394 0 + . Parent=CG9795.a +3R MB7 exon 150452 150533 0 + . Parent=CG9795.a +3R MB7 exon 150595 151211 0 + . Parent=CG9795.a +3R MB7 exon 151419 151818 0 + . Parent=CG9795.a +3R MB7 five_prime_UTR 145414 145612 0 + . Parent=CG9795.a +3R MB7 five_prime_UTR 147567 147769 0 + . Parent=CG9795.a +3R MB7 five_prime_UTR 148070 148217 0 + . Parent=CG9795.a +3R MB7 five_prime_UTR 148953 149209 0 + . Parent=CG9795.a +3R MB7 start_codon 149210 149212 0 + 0 Parent=CG9795.a +3R MB7 CDS 149210 149344 0 + 0 Parent=CG9795.a +3R MB7 CDS 149409 149611 0 + 0 Parent=CG9795.a +3R MB7 CDS 149675 149886 0 + 1 Parent=CG9795.a +3R MB7 CDS 150059 150232 0 + 2 Parent=CG9795.a +3R MB7 CDS 150310 150394 0 + 2 Parent=CG9795.a +3R MB7 CDS 150452 150533 0 + 1 Parent=CG9795.a +3R MB7 CDS 150595 151211 0 + 0 Parent=CG9795.a +3R MB7 CDS 151419 151557 0 + 1 Parent=CG9795.a +3R MB7 stop_codon 151555 151557 0 + 0 Parent=CG9795.a +3R MB7 three_prime_UTR 151558 151818 0 + . Parent=CG9795.a +3R MB7 mRNA 145412 151817 1 + . ID=CG9795-RA;Parent=CG9795;Name=CG9795-RA +3R MB7 exon 145412 145612 0 + . Parent=CG9795-RA +3R MB7 exon 147567 147769 0 + . Parent=CG9795-RA +3R MB7 exon 148070 148217 0 + . Parent=CG9795-RA +3R MB7 exon 148953 149344 0 + . Parent=CG9795-RA +3R MB7 exon 149409 149611 0 + . Parent=CG9795-RA +3R MB7 exon 149675 149886 0 + . Parent=CG9795-RA +3R MB7 exon 150059 150232 0 + . Parent=CG9795-RA +3R MB7 exon 150310 150394 0 + . Parent=CG9795-RA +3R MB7 exon 150452 150533 0 + . Parent=CG9795-RA +3R MB7 exon 150595 151183 0 + . Parent=CG9795-RA +3R MB7 exon 151419 151817 0 + . Parent=CG9795-RA +3R MB7 five_prime_UTR 145412 145612 0 + . Parent=CG9795-RA +3R MB7 five_prime_UTR 147567 147769 0 + . Parent=CG9795-RA +3R MB7 five_prime_UTR 148070 148217 0 + . Parent=CG9795-RA +3R MB7 five_prime_UTR 148953 149209 0 + . Parent=CG9795-RA +3R MB7 start_codon 149210 149212 0 + 0 Parent=CG9795-RA +3R MB7 CDS 149210 149344 0 + 0 Parent=CG9795-RA +3R MB7 CDS 149409 149611 0 + 0 Parent=CG9795-RA +3R MB7 CDS 149675 149886 0 + 1 Parent=CG9795-RA +3R MB7 CDS 150059 150232 0 + 2 Parent=CG9795-RA +3R MB7 CDS 150310 150394 0 + 2 Parent=CG9795-RA +3R MB7 CDS 150452 150533 0 + 1 Parent=CG9795-RA +3R MB7 CDS 150595 151183 0 + 0 Parent=CG9795-RA +3R MB7 CDS 151419 151444 0 + 2 Parent=CG9795-RA +3R MB7 stop_codon 151442 151444 0 + 0 Parent=CG9795-RA +3R MB7 three_prime_UTR 151445 151817 0 + . Parent=CG9795-RA +3R MB7 mRNA 145412 152096 1 + . ID=CG9795-RD;Parent=CG9795;Name=CG9795-RD +3R MB7 exon 145412 145578 0 + . Parent=CG9795-RD +3R MB7 exon 147567 147769 0 + . Parent=CG9795-RD +3R MB7 exon 148953 149344 0 + . Parent=CG9795-RD +3R MB7 exon 149409 149611 0 + . Parent=CG9795-RD +3R MB7 exon 149675 149886 0 + . Parent=CG9795-RD +3R MB7 exon 150059 150232 0 + . Parent=CG9795-RD +3R MB7 exon 150310 150394 0 + . Parent=CG9795-RD +3R MB7 exon 150452 150533 0 + . Parent=CG9795-RD +3R MB7 exon 150595 151211 0 + . Parent=CG9795-RD +3R MB7 exon 151419 152096 0 + . Parent=CG9795-RD +3R MB7 five_prime_UTR 145412 145578 0 + . Parent=CG9795-RD +3R MB7 five_prime_UTR 147567 147573 0 + . Parent=CG9795-RD +3R MB7 start_codon 147574 147576 0 + 0 Parent=CG9795-RD +3R MB7 CDS 147574 147769 0 + 0 Parent=CG9795-RD +3R MB7 CDS 148953 149344 0 + 2 Parent=CG9795-RD +3R MB7 CDS 149409 149611 0 + 0 Parent=CG9795-RD +3R MB7 CDS 149675 149886 0 + 1 Parent=CG9795-RD +3R MB7 CDS 150059 150232 0 + 2 Parent=CG9795-RD +3R MB7 CDS 150310 150394 0 + 2 Parent=CG9795-RD +3R MB7 CDS 150452 150533 0 + 1 Parent=CG9795-RD +3R MB7 CDS 150595 151211 0 + 0 Parent=CG9795-RD +3R MB7 CDS 151419 151557 0 + 1 Parent=CG9795-RD +3R MB7 stop_codon 151555 151557 0 + 0 Parent=CG9795-RD +3R MB7 three_prime_UTR 151558 152096 0 + . Parent=CG9795-RD +3R MB7 mRNA 145412 151818 2 + . ID=CG9795.b;Parent=CG9795;Name=CG9795.b +3R MB7 exon 145412 145612 0 + . Parent=CG9795.b +3R MB7 exon 147567 147769 0 + . Parent=CG9795.b +3R MB7 exon 148953 149344 0 + . Parent=CG9795.b +3R MB7 exon 149409 149611 0 + . Parent=CG9795.b +3R MB7 exon 149675 149886 0 + . Parent=CG9795.b +3R MB7 exon 150059 150232 0 + . Parent=CG9795.b +3R MB7 exon 150310 150394 0 + . Parent=CG9795.b +3R MB7 exon 150452 150533 0 + . Parent=CG9795.b +3R MB7 exon 150595 151211 0 + . Parent=CG9795.b +3R MB7 exon 151419 151818 0 + . Parent=CG9795.b +3R MB7 five_prime_UTR 145412 145508 0 + . Parent=CG9795.b +3R MB7 start_codon 145509 145511 0 + 0 Parent=CG9795.b +3R MB7 CDS 145509 145612 0 + 0 Parent=CG9795.b +3R MB7 CDS 147567 147769 0 + 1 Parent=CG9795.b +3R MB7 CDS 148953 149344 0 + 2 Parent=CG9795.b +3R MB7 CDS 149409 149611 0 + 0 Parent=CG9795.b +3R MB7 CDS 149675 149886 0 + 1 Parent=CG9795.b +3R MB7 CDS 150059 150232 0 + 2 Parent=CG9795.b +3R MB7 CDS 150310 150394 0 + 2 Parent=CG9795.b +3R MB7 CDS 150452 150533 0 + 1 Parent=CG9795.b +3R MB7 CDS 150595 151211 0 + 0 Parent=CG9795.b +3R MB7 CDS 151419 151557 0 + 1 Parent=CG9795.b +3R MB7 stop_codon 151555 151557 0 + 0 Parent=CG9795.b +3R MB7 three_prime_UTR 151558 151818 0 + . Parent=CG9795.b +3R MB7 mRNA 145412 151817 3 + . ID=CG9795-RC;Parent=CG9795;Name=CG9795-RC +3R MB7 exon 145412 145612 0 + . Parent=CG9795-RC +3R MB7 exon 147567 147769 0 + . Parent=CG9795-RC +3R MB7 exon 148953 149344 0 + . Parent=CG9795-RC +3R MB7 exon 149409 149611 0 + . Parent=CG9795-RC +3R MB7 exon 149675 149886 0 + . Parent=CG9795-RC +3R MB7 exon 150059 150232 0 + . Parent=CG9795-RC +3R MB7 exon 150310 150394 0 + . Parent=CG9795-RC +3R MB7 exon 150452 150533 0 + . Parent=CG9795-RC +3R MB7 exon 150595 151183 0 + . Parent=CG9795-RC +3R MB7 exon 151419 151817 0 + . Parent=CG9795-RC +3R MB7 five_prime_UTR 145412 145508 0 + . Parent=CG9795-RC +3R MB7 start_codon 145509 145511 0 + 0 Parent=CG9795-RC +3R MB7 CDS 145509 145612 0 + 0 Parent=CG9795-RC +3R MB7 CDS 147567 147769 0 + 1 Parent=CG9795-RC +3R MB7 CDS 148953 149344 0 + 2 Parent=CG9795-RC +3R MB7 CDS 149409 149611 0 + 0 Parent=CG9795-RC +3R MB7 CDS 149675 149886 0 + 1 Parent=CG9795-RC +3R MB7 CDS 150059 150232 0 + 2 Parent=CG9795-RC +3R MB7 CDS 150310 150394 0 + 2 Parent=CG9795-RC +3R MB7 CDS 150452 150533 0 + 1 Parent=CG9795-RC +3R MB7 CDS 150595 151183 0 + 0 Parent=CG9795-RC +3R MB7 CDS 151419 151444 0 + 2 Parent=CG9795-RC +3R MB7 stop_codon 151442 151444 0 + 0 Parent=CG9795-RC +3R MB7 three_prime_UTR 151445 151817 0 + . Parent=CG9795-RC +3R MB7 mRNA 145412 151817 3 + . ID=CG9795-RB;Parent=CG9795;Name=CG9795-RB +3R MB7 exon 145412 145578 0 + . Parent=CG9795-RB +3R MB7 exon 147567 147769 0 + . Parent=CG9795-RB +3R MB7 exon 148953 149344 0 + . Parent=CG9795-RB +3R MB7 exon 149409 149611 0 + . Parent=CG9795-RB +3R MB7 exon 149675 149886 0 + . Parent=CG9795-RB +3R MB7 exon 150059 150232 0 + . Parent=CG9795-RB +3R MB7 exon 150310 150394 0 + . Parent=CG9795-RB +3R MB7 exon 150452 150533 0 + . Parent=CG9795-RB +3R MB7 exon 150595 151183 0 + . Parent=CG9795-RB +3R MB7 exon 151419 151817 0 + . Parent=CG9795-RB +3R MB7 five_prime_UTR 145412 145578 0 + . Parent=CG9795-RB +3R MB7 five_prime_UTR 147567 147573 0 + . Parent=CG9795-RB +3R MB7 start_codon 147574 147576 0 + 0 Parent=CG9795-RB +3R MB7 CDS 147574 147769 0 + 0 Parent=CG9795-RB +3R MB7 CDS 148953 149344 0 + 2 Parent=CG9795-RB +3R MB7 CDS 149409 149611 0 + 0 Parent=CG9795-RB +3R MB7 CDS 149675 149886 0 + 1 Parent=CG9795-RB +3R MB7 CDS 150059 150232 0 + 2 Parent=CG9795-RB +3R MB7 CDS 150310 150394 0 + 2 Parent=CG9795-RB +3R MB7 CDS 150452 150533 0 + 1 Parent=CG9795-RB +3R MB7 CDS 150595 151183 0 + 0 Parent=CG9795-RB +3R MB7 CDS 151419 151444 0 + 2 Parent=CG9795-RB +3R MB7 stop_codon 151442 151444 0 + 0 Parent=CG9795-RB +3R MB7 three_prime_UTR 151445 151817 0 + . Parent=CG9795-RB +3R MB7 gene 153527 159727 0 - . ID=CG9776;Name=CG9776 +3R MB7 mRNA 153527 159727 1 - . ID=CG9776-RA;Parent=CG9776;Name=CG9776-RA +3R MB7 exon 153527 153739 0 - . Parent=CG9776-RA +3R MB7 exon 153859 155756 0 - . Parent=CG9776-RA +3R MB7 exon 155822 155970 0 - . Parent=CG9776-RA +3R MB7 exon 157269 157946 0 - . Parent=CG9776-RA +3R MB7 exon 158012 158199 0 - . Parent=CG9776-RA +3R MB7 exon 158714 158881 0 - . Parent=CG9776-RA +3R MB7 exon 158944 159727 0 - . Parent=CG9776-RA +3R MB7 three_prime_UTR 153527 153728 0 - . Parent=CG9776-RA +3R MB7 stop_codon 153729 153731 0 - 0 Parent=CG9776-RA +3R MB7 CDS 153729 153739 0 - 2 Parent=CG9776-RA +3R MB7 CDS 153859 155756 0 - 1 Parent=CG9776-RA +3R MB7 CDS 155822 155970 0 - 0 Parent=CG9776-RA +3R MB7 CDS 157269 157946 0 - 0 Parent=CG9776-RA +3R MB7 CDS 158012 158199 0 - 2 Parent=CG9776-RA +3R MB7 CDS 158714 158881 0 - 2 Parent=CG9776-RA +3R MB7 CDS 158944 159634 0 - 0 Parent=CG9776-RA +3R MB7 start_codon 159632 159634 0 - 0 Parent=CG9776-RA +3R MB7 five_prime_UTR 159635 159727 0 - . Parent=CG9776-RA +3R MB7 mRNA 153773 156769 1 - . ID=CG9776-RB;Parent=CG9776;Name=CG9776-RB +3R MB7 exon 153773 155756 0 - . Parent=CG9776-RB +3R MB7 exon 155822 155970 0 - . Parent=CG9776-RB +3R MB7 exon 156724 156769 0 - . Parent=CG9776-RB +3R MB7 three_prime_UTR 153773 153850 0 - . Parent=CG9776-RB +3R MB7 stop_codon 153851 153853 0 - 0 Parent=CG9776-RB +3R MB7 CDS 153851 155756 0 - 1 Parent=CG9776-RB +3R MB7 CDS 155822 155970 0 - 0 Parent=CG9776-RB +3R MB7 start_codon 156724 156726 0 - 0 Parent=CG9776-RB +3R MB7 CDS 156724 156726 0 - 0 Parent=CG9776-RB +3R MB7 five_prime_UTR 156727 156769 0 - . Parent=CG9776-RB +3R MB7 gene 160820 161237 0 + . ID=CG14645;Name=CG14645 +3R MB7 mRNA 160820 161237 34 + . ID=CG14645-RA;Parent=CG14645;Name=CG14645-RA +3R MB7 exon 160820 161237 0 + . Parent=CG14645-RA +3R MB7 five_prime_UTR 160820 160838 0 + . Parent=CG14645-RA +3R MB7 start_codon 160839 160841 0 + 0 Parent=CG14645-RA +3R MB7 CDS 160839 161132 0 + 0 Parent=CG14645-RA +3R MB7 stop_codon 161130 161132 0 + 0 Parent=CG14645-RA +3R MB7 three_prime_UTR 161133 161237 0 + . Parent=CG14645-RA +3R MB7 mRNA 160820 161223 31 + . ID=CG14645.a;Parent=CG14645;Name=CG14645.a +3R MB7 exon 160820 161223 0 + . Parent=CG14645.a +3R MB7 five_prime_UTR 160820 160838 0 + . Parent=CG14645.a +3R MB7 start_codon 160839 160841 0 + 0 Parent=CG14645.a +3R MB7 CDS 160839 161132 0 + 0 Parent=CG14645.a +3R MB7 stop_codon 161130 161132 0 + 0 Parent=CG14645.a +3R MB7 three_prime_UTR 161133 161223 0 + . Parent=CG14645.a +3R MB7 gene 161143 165287 0 - . ID=CG9772;Name=CG9772 +3R MB7 mRNA 161143 165287 2 - . ID=CG9772-RB;Parent=CG9772;Name=CG9772-RB +3R MB7 exon 161143 161451 0 - . Parent=CG9772-RB +3R MB7 exon 161508 161667 0 - . Parent=CG9772-RB +3R MB7 exon 161731 162130 0 - . Parent=CG9772-RB +3R MB7 exon 162191 163064 0 - . Parent=CG9772-RB +3R MB7 exon 165089 165287 0 - . Parent=CG9772-RB +3R MB7 three_prime_UTR 161143 161264 0 - . Parent=CG9772-RB +3R MB7 stop_codon 161265 161267 0 - 0 Parent=CG9772-RB +3R MB7 CDS 161265 161451 0 - 1 Parent=CG9772-RB +3R MB7 CDS 161508 161667 0 - 2 Parent=CG9772-RB +3R MB7 CDS 161731 162130 0 - 0 Parent=CG9772-RB +3R MB7 CDS 162191 163064 0 - 1 Parent=CG9772-RB +3R MB7 CDS 165089 165213 0 - 0 Parent=CG9772-RB +3R MB7 start_codon 165211 165213 0 - 0 Parent=CG9772-RB +3R MB7 five_prime_UTR 165214 165287 0 - . Parent=CG9772-RB +3R MB7 mRNA 161143 163408 2 - . ID=CG9772-RA;Parent=CG9772;Name=CG9772-RA +3R MB7 exon 161143 161451 0 - . Parent=CG9772-RA +3R MB7 exon 161508 161667 0 - . Parent=CG9772-RA +3R MB7 exon 161731 162130 0 - . Parent=CG9772-RA +3R MB7 exon 162191 163064 0 - . Parent=CG9772-RA +3R MB7 exon 163270 163408 0 - . Parent=CG9772-RA +3R MB7 three_prime_UTR 161143 161264 0 - . Parent=CG9772-RA +3R MB7 stop_codon 161265 161267 0 - 0 Parent=CG9772-RA +3R MB7 CDS 161265 161451 0 - 1 Parent=CG9772-RA +3R MB7 CDS 161508 161667 0 - 2 Parent=CG9772-RA +3R MB7 CDS 161731 162130 0 - 0 Parent=CG9772-RA +3R MB7 CDS 162191 163064 0 - 1 Parent=CG9772-RA +3R MB7 CDS 163270 163328 0 - 0 Parent=CG9772-RA +3R MB7 start_codon 163326 163328 0 - 0 Parent=CG9772-RA +3R MB7 five_prime_UTR 163329 163408 0 - . Parent=CG9772-RA +3R MB7 mRNA 161164 163374 1 - . ID=CG9772-RD;Parent=CG9772;Name=CG9772-RD +3R MB7 exon 161164 161451 0 - . Parent=CG9772-RD +3R MB7 exon 161508 161667 0 - . Parent=CG9772-RD +3R MB7 exon 161731 162130 0 - . Parent=CG9772-RD +3R MB7 exon 162191 163374 0 - . Parent=CG9772-RD +3R MB7 three_prime_UTR 161164 161264 0 - . Parent=CG9772-RD +3R MB7 stop_codon 161265 161267 0 - 0 Parent=CG9772-RD +3R MB7 CDS 161265 161451 0 - 1 Parent=CG9772-RD +3R MB7 CDS 161508 161667 0 - 2 Parent=CG9772-RD +3R MB7 CDS 161731 162130 0 - 0 Parent=CG9772-RD +3R MB7 CDS 162191 162943 0 - 0 Parent=CG9772-RD +3R MB7 start_codon 162941 162943 0 - 0 Parent=CG9772-RD +3R MB7 five_prime_UTR 162944 163374 0 - . Parent=CG9772-RD +3R MB7 mRNA 161143 163408 1 - . ID=CG9772-RC;Parent=CG9772;Name=CG9772-RC +3R MB7 exon 161143 161667 0 - . Parent=CG9772-RC +3R MB7 exon 161731 163064 0 - . Parent=CG9772-RC +3R MB7 exon 163270 163408 0 - . Parent=CG9772-RC +3R MB7 three_prime_UTR 161143 161667 0 - . Parent=CG9772-RC +3R MB7 three_prime_UTR 161731 162175 0 - . Parent=CG9772-RC +3R MB7 stop_codon 162176 162178 0 - 0 Parent=CG9772-RC +3R MB7 CDS 162176 163064 0 - 1 Parent=CG9772-RC +3R MB7 CDS 163270 163328 0 - 0 Parent=CG9772-RC +3R MB7 start_codon 163326 163328 0 - 0 Parent=CG9772-RC +3R MB7 five_prime_UTR 163329 163408 0 - . Parent=CG9772-RC +3R MB7 gene 163482 165640 0 + . ID=CG1103;Name=CG1103 +3R MB7 mRNA 163482 165640 1 + . ID=CG1103-RA;Parent=CG1103;Name=CG1103-RA +3R MB7 exon 163482 163645 0 + . Parent=CG1103-RA +3R MB7 exon 163723 164025 0 + . Parent=CG1103-RA +3R MB7 exon 164766 165640 0 + . Parent=CG1103-RA +3R MB7 five_prime_UTR 163482 163645 0 + . Parent=CG1103-RA +3R MB7 five_prime_UTR 163723 163793 0 + . Parent=CG1103-RA +3R MB7 start_codon 163794 163796 0 + 0 Parent=CG1103-RA +3R MB7 CDS 163794 164025 0 + 0 Parent=CG1103-RA +3R MB7 CDS 164766 165226 0 + 2 Parent=CG1103-RA +3R MB7 stop_codon 165224 165226 0 + 0 Parent=CG1103-RA +3R MB7 three_prime_UTR 165227 165640 0 + . Parent=CG1103-RA +3R MB7 gene 170728 172372 0 - . ID=CG9768;Name=CG9768 +3R MB7 mRNA 170728 172372 1 - . ID=CG9768-RA;Parent=CG9768;Name=CG9768-RA +3R MB7 exon 170728 171505 0 - . Parent=CG9768-RA +3R MB7 exon 171571 172372 0 - . Parent=CG9768-RA +3R MB7 three_prime_UTR 170728 171266 0 - . Parent=CG9768-RA +3R MB7 stop_codon 171267 171269 0 - 0 Parent=CG9768-RA +3R MB7 CDS 171267 171505 0 - 2 Parent=CG9768-RA +3R MB7 CDS 171571 172225 0 - 0 Parent=CG9768-RA +3R MB7 start_codon 172223 172225 0 - 0 Parent=CG9768-RA +3R MB7 five_prime_UTR 172226 172372 0 - . Parent=CG9768-RA +3R MB7 gene 185510 192577 0 + . ID=CG1090;Name=CG1090 +3R MB7 mRNA 185510 192577 3 + . ID=CG1090.b;Parent=CG1090;Name=CG1090.b +3R MB7 exon 185510 186009 0 + . Parent=CG1090.b +3R MB7 exon 189000 189230 0 + . Parent=CG1090.b +3R MB7 exon 189284 190228 0 + . Parent=CG1090.b +3R MB7 exon 190288 191263 0 + . Parent=CG1090.b +3R MB7 exon 191424 191612 0 + . Parent=CG1090.b +3R MB7 exon 191671 192577 0 + . Parent=CG1090.b +3R MB7 five_prime_UTR 185510 186009 0 + . Parent=CG1090.b +3R MB7 five_prime_UTR 189000 189230 0 + . Parent=CG1090.b +3R MB7 five_prime_UTR 189284 189976 0 + . Parent=CG1090.b +3R MB7 start_codon 189977 189979 0 + 0 Parent=CG1090.b +3R MB7 CDS 189977 190228 0 + 0 Parent=CG1090.b +3R MB7 CDS 190288 191263 0 + 0 Parent=CG1090.b +3R MB7 CDS 191424 191612 0 + 2 Parent=CG1090.b +3R MB7 CDS 191671 191681 0 + 2 Parent=CG1090.b +3R MB7 stop_codon 191679 191681 0 + 0 Parent=CG1090.b +3R MB7 three_prime_UTR 191682 192577 0 + . Parent=CG1090.b +3R MB7 gene 204386 206932 0 + . ID=CG11739;Name=CG11739 +3R MB7 mRNA 204644 206932 2 + . ID=CG11739-RD;Parent=CG11739;Name=CG11739-RD +3R MB7 exon 204644 204731 0 + . Parent=CG11739-RD +3R MB7 exon 205172 205340 0 + . Parent=CG11739-RD +3R MB7 exon 205397 205546 0 + . Parent=CG11739-RD +3R MB7 exon 205650 205767 0 + . Parent=CG11739-RD +3R MB7 exon 205831 205992 0 + . Parent=CG11739-RD +3R MB7 exon 206226 206353 0 + . Parent=CG11739-RD +3R MB7 exon 206425 206932 0 + . Parent=CG11739-RD +3R MB7 five_prime_UTR 204644 204731 0 + . Parent=CG11739-RD +3R MB7 five_prime_UTR 205172 205177 0 + . Parent=CG11739-RD +3R MB7 start_codon 205178 205180 0 + 0 Parent=CG11739-RD +3R MB7 CDS 205178 205340 0 + 0 Parent=CG11739-RD +3R MB7 CDS 205397 205546 0 + 2 Parent=CG11739-RD +3R MB7 CDS 205650 205767 0 + 2 Parent=CG11739-RD +3R MB7 CDS 205831 205992 0 + 1 Parent=CG11739-RD +3R MB7 CDS 206226 206353 0 + 1 Parent=CG11739-RD +3R MB7 CDS 206425 206669 0 + 2 Parent=CG11739-RD +3R MB7 stop_codon 206667 206669 0 + 0 Parent=CG11739-RD +3R MB7 three_prime_UTR 206670 206932 0 + . Parent=CG11739-RD +3R MB7 mRNA 204401 206932 2 + . ID=CG11739-RA;Parent=CG11739;Name=CG11739-RA +3R MB7 exon 204401 204731 0 + . Parent=CG11739-RA +3R MB7 exon 205172 205340 0 + . Parent=CG11739-RA +3R MB7 exon 205397 205546 0 + . Parent=CG11739-RA +3R MB7 exon 205650 205767 0 + . Parent=CG11739-RA +3R MB7 exon 205831 205992 0 + . Parent=CG11739-RA +3R MB7 exon 206226 206353 0 + . Parent=CG11739-RA +3R MB7 exon 206425 206932 0 + . Parent=CG11739-RA +3R MB7 five_prime_UTR 204401 204731 0 + . Parent=CG11739-RA +3R MB7 five_prime_UTR 205172 205177 0 + . Parent=CG11739-RA +3R MB7 start_codon 205178 205180 0 + 0 Parent=CG11739-RA +3R MB7 CDS 205178 205340 0 + 0 Parent=CG11739-RA +3R MB7 CDS 205397 205546 0 + 2 Parent=CG11739-RA +3R MB7 CDS 205650 205767 0 + 2 Parent=CG11739-RA +3R MB7 CDS 205831 205992 0 + 1 Parent=CG11739-RA +3R MB7 CDS 206226 206353 0 + 1 Parent=CG11739-RA +3R MB7 CDS 206425 206669 0 + 2 Parent=CG11739-RA +3R MB7 stop_codon 206667 206669 0 + 0 Parent=CG11739-RA +3R MB7 three_prime_UTR 206670 206932 0 + . Parent=CG11739-RA +3R MB7 mRNA 204386 206932 1 + . ID=CG11739-RC;Parent=CG11739;Name=CG11739-RC +3R MB7 exon 204386 204451 0 + . Parent=CG11739-RC +3R MB7 exon 205172 205340 0 + . Parent=CG11739-RC +3R MB7 exon 205397 205546 0 + . Parent=CG11739-RC +3R MB7 exon 205650 205767 0 + . Parent=CG11739-RC +3R MB7 exon 205831 205992 0 + . Parent=CG11739-RC +3R MB7 exon 206226 206353 0 + . Parent=CG11739-RC +3R MB7 exon 206425 206932 0 + . Parent=CG11739-RC +3R MB7 five_prime_UTR 204386 204451 0 + . Parent=CG11739-RC +3R MB7 five_prime_UTR 205172 205177 0 + . Parent=CG11739-RC +3R MB7 start_codon 205178 205180 0 + 0 Parent=CG11739-RC +3R MB7 CDS 205178 205340 0 + 0 Parent=CG11739-RC +3R MB7 CDS 205397 205546 0 + 2 Parent=CG11739-RC +3R MB7 CDS 205650 205767 0 + 2 Parent=CG11739-RC +3R MB7 CDS 205831 205992 0 + 1 Parent=CG11739-RC +3R MB7 CDS 206226 206353 0 + 1 Parent=CG11739-RC +3R MB7 CDS 206425 206669 0 + 2 Parent=CG11739-RC +3R MB7 stop_codon 206667 206669 0 + 0 Parent=CG11739-RC +3R MB7 three_prime_UTR 206670 206932 0 + . Parent=CG11739-RC +3R MB7 mRNA 205029 206932 1 + . ID=CG11739-RB;Parent=CG11739;Name=CG11739-RB +3R MB7 exon 205029 205340 0 + . Parent=CG11739-RB +3R MB7 exon 205397 205546 0 + . Parent=CG11739-RB +3R MB7 exon 205650 205767 0 + . Parent=CG11739-RB +3R MB7 exon 205831 205992 0 + . Parent=CG11739-RB +3R MB7 exon 206226 206353 0 + . Parent=CG11739-RB +3R MB7 exon 206425 206932 0 + . Parent=CG11739-RB +3R MB7 five_prime_UTR 205029 205177 0 + . Parent=CG11739-RB +3R MB7 start_codon 205178 205180 0 + 0 Parent=CG11739-RB +3R MB7 CDS 205178 205340 0 + 0 Parent=CG11739-RB +3R MB7 CDS 205397 205546 0 + 2 Parent=CG11739-RB +3R MB7 CDS 205650 205767 0 + 2 Parent=CG11739-RB +3R MB7 CDS 205831 205992 0 + 1 Parent=CG11739-RB +3R MB7 CDS 206226 206353 0 + 1 Parent=CG11739-RB +3R MB7 CDS 206425 206669 0 + 2 Parent=CG11739-RB +3R MB7 stop_codon 206667 206669 0 + 0 Parent=CG11739-RB +3R MB7 three_prime_UTR 206670 206932 0 + . Parent=CG11739-RB +3R MB7 gene 207032 212741 0 + . ID=CG1084;Name=CG1084 +3R MB7 mRNA 207032 212741 1 + . ID=CG1084-RA;Parent=CG1084;Name=CG1084-RA +3R MB7 exon 207032 207251 0 + . Parent=CG1084-RA +3R MB7 exon 207601 208539 0 + . Parent=CG1084-RA +3R MB7 exon 208592 210277 0 + . Parent=CG1084-RA +3R MB7 exon 210613 210779 0 + . Parent=CG1084-RA +3R MB7 exon 210843 211715 0 + . Parent=CG1084-RA +3R MB7 exon 211772 211940 0 + . Parent=CG1084-RA +3R MB7 exon 212002 212135 0 + . Parent=CG1084-RA +3R MB7 exon 212191 212741 0 + . Parent=CG1084-RA +3R MB7 five_prime_UTR 207032 207251 0 + . Parent=CG1084-RA +3R MB7 five_prime_UTR 207601 207689 0 + . Parent=CG1084-RA +3R MB7 start_codon 207690 207692 0 + 0 Parent=CG1084-RA +3R MB7 CDS 207690 208539 0 + 0 Parent=CG1084-RA +3R MB7 CDS 208592 210277 0 + 2 Parent=CG1084-RA +3R MB7 CDS 210613 210779 0 + 2 Parent=CG1084-RA +3R MB7 CDS 210843 211715 0 + 0 Parent=CG1084-RA +3R MB7 CDS 211772 211940 0 + 0 Parent=CG1084-RA +3R MB7 CDS 212002 212135 0 + 2 Parent=CG1084-RA +3R MB7 CDS 212191 212484 0 + 0 Parent=CG1084-RA +3R MB7 stop_codon 212482 212484 0 + 0 Parent=CG1084-RA +3R MB7 three_prime_UTR 212485 212741 0 + . Parent=CG1084-RA +3R MB7 gene 212967 215535 0 + . ID=CG10520;Name=CG10520 +3R MB7 mRNA 212967 215535 1 + . ID=CG10520-RB;Parent=CG10520;Name=CG10520-RB +3R MB7 exon 212967 213038 0 + . Parent=CG10520-RB +3R MB7 exon 213203 214114 0 + . Parent=CG10520-RB +3R MB7 exon 214181 215535 0 + . Parent=CG10520-RB +3R MB7 five_prime_UTR 212967 213038 0 + . Parent=CG10520-RB +3R MB7 five_prime_UTR 213203 213651 0 + . Parent=CG10520-RB +3R MB7 start_codon 213652 213654 0 + 0 Parent=CG10520-RB +3R MB7 CDS 213652 214114 0 + 0 Parent=CG10520-RB +3R MB7 CDS 214181 215106 0 + 2 Parent=CG10520-RB +3R MB7 stop_codon 215104 215106 0 + 0 Parent=CG10520-RB +3R MB7 three_prime_UTR 215107 215535 0 + . Parent=CG10520-RB +3R MB7 gene 216097 217839 0 + . ID=CG14646;Name=CG14646 +3R MB7 mRNA 216097 217839 1 + . ID=CG14646-RA;Parent=CG14646;Name=CG14646-RA +3R MB7 exon 216097 216780 0 + . Parent=CG14646-RA +3R MB7 exon 216833 217839 0 + . Parent=CG14646-RA +3R MB7 five_prime_UTR 216097 216147 0 + . Parent=CG14646-RA +3R MB7 start_codon 216148 216150 0 + 0 Parent=CG14646-RA +3R MB7 CDS 216148 216780 0 + 0 Parent=CG14646-RA +3R MB7 CDS 216833 217429 0 + 0 Parent=CG14646-RA +3R MB7 stop_codon 217427 217429 0 + 0 Parent=CG14646-RA +3R MB7 three_prime_UTR 217430 217839 0 + . Parent=CG14646-RA +3R MB7 gene 221815 223609 0 - . ID=CG9855;Name=CG9855 +3R MB7 mRNA 221815 223609 1 - . ID=CG9855-RA;Parent=CG9855;Name=CG9855-RA +3R MB7 exon 221815 222524 0 - . Parent=CG9855-RA +3R MB7 exon 222582 222778 0 - . Parent=CG9855-RA +3R MB7 exon 222834 223362 0 - . Parent=CG9855-RA +3R MB7 exon 223430 223609 0 - . Parent=CG9855-RA +3R MB7 three_prime_UTR 221815 222097 0 - . Parent=CG9855-RA +3R MB7 stop_codon 222098 222100 0 - 0 Parent=CG9855-RA +3R MB7 CDS 222098 222524 0 - 1 Parent=CG9855-RA +3R MB7 CDS 222582 222778 0 - 0 Parent=CG9855-RA +3R MB7 CDS 222834 223358 0 - 0 Parent=CG9855-RA +3R MB7 start_codon 223356 223358 0 - 0 Parent=CG9855-RA +3R MB7 five_prime_UTR 223359 223362 0 - . Parent=CG9855-RA +3R MB7 five_prime_UTR 223430 223609 0 - . Parent=CG9855-RA +3R MB7 gene 224272 227749 0 - . ID=CG9853;Name=CG9853 +3R MB7 mRNA 224272 227749 2 - . ID=CG9853-RB;Parent=CG9853;Name=CG9853-RB +3R MB7 exon 224272 225107 0 - . Parent=CG9853-RB +3R MB7 exon 225168 225402 0 - . Parent=CG9853-RB +3R MB7 exon 225464 225912 0 - . Parent=CG9853-RB +3R MB7 exon 227444 227749 0 - . Parent=CG9853-RB +3R MB7 three_prime_UTR 224272 224474 0 - . Parent=CG9853-RB +3R MB7 stop_codon 224475 224477 0 - 0 Parent=CG9853-RB +3R MB7 CDS 224475 225107 0 - 0 Parent=CG9853-RB +3R MB7 CDS 225168 225402 0 - 1 Parent=CG9853-RB +3R MB7 CDS 225464 225615 0 - 0 Parent=CG9853-RB +3R MB7 start_codon 225613 225615 0 - 0 Parent=CG9853-RB +3R MB7 five_prime_UTR 225616 225912 0 - . Parent=CG9853-RB +3R MB7 five_prime_UTR 227444 227749 0 - . Parent=CG9853-RB +3R MB7 mRNA 224272 225734 1 - . ID=CG9853-RA;Parent=CG9853;Name=CG9853-RA +3R MB7 exon 224272 225107 0 - . Parent=CG9853-RA +3R MB7 exon 225168 225402 0 - . Parent=CG9853-RA +3R MB7 exon 225464 225734 0 - . Parent=CG9853-RA +3R MB7 three_prime_UTR 224272 224474 0 - . Parent=CG9853-RA +3R MB7 stop_codon 224475 224477 0 - 0 Parent=CG9853-RA +3R MB7 CDS 224475 225107 0 - 0 Parent=CG9853-RA +3R MB7 CDS 225168 225402 0 - 1 Parent=CG9853-RA +3R MB7 CDS 225464 225615 0 - 0 Parent=CG9853-RA +3R MB7 start_codon 225613 225615 0 - 0 Parent=CG9853-RA +3R MB7 five_prime_UTR 225616 225734 0 - . Parent=CG9853-RA +3R MB7 gene 226212 227739 0 + . ID=CG14647;Name=CG14647 +3R MB7 mRNA 226212 227739 1 + . ID=CG14647.a;Parent=CG14647;Name=CG14647.a +3R MB7 exon 226212 226860 0 + . Parent=CG14647.a +3R MB7 exon 227076 227207 0 + . Parent=CG14647.a +3R MB7 exon 227323 227739 0 + . Parent=CG14647.a +3R MB7 five_prime_UTR 226212 226221 0 + . Parent=CG14647.a +3R MB7 start_codon 226222 226224 0 + 0 Parent=CG14647.a +3R MB7 CDS 226222 226860 0 + 0 Parent=CG14647.a +3R MB7 CDS 227076 227207 0 + 0 Parent=CG14647.a +3R MB7 CDS 227323 227637 0 + 0 Parent=CG14647.a +3R MB7 stop_codon 227635 227637 0 + 0 Parent=CG14647.a +3R MB7 three_prime_UTR 227638 227739 0 + . Parent=CG14647.a +3R MB7 mRNA 226212 227739 1 + . ID=CG14647-RB;Parent=CG14647;Name=CG14647-RB +3R MB7 exon 226212 226860 0 + . Parent=CG14647-RB +3R MB7 exon 227076 227207 0 + . Parent=CG14647-RB +3R MB7 exon 227323 227739 0 + . Parent=CG14647-RB +3R MB7 five_prime_UTR 226212 226299 0 + . Parent=CG14647-RB +3R MB7 start_codon 226300 226302 0 + 0 Parent=CG14647-RB +3R MB7 CDS 226300 226860 0 + 0 Parent=CG14647-RB +3R MB7 CDS 227076 227207 0 + 0 Parent=CG14647-RB +3R MB7 CDS 227323 227637 0 + 0 Parent=CG14647-RB +3R MB7 stop_codon 227635 227637 0 + 0 Parent=CG14647-RB +3R MB7 three_prime_UTR 227638 227739 0 + . Parent=CG14647-RB +3R MB7 gene 228771 232914 0 + . ID=CG14648;Name=CG14648 +3R MB7 mRNA 228771 232914 1 + . ID=CG14648-RA;Parent=CG14648;Name=CG14648-RA +3R MB7 exon 228771 229002 0 + . Parent=CG14648-RA +3R MB7 exon 230191 230361 0 + . Parent=CG14648-RA +3R MB7 exon 230423 231141 0 + . Parent=CG14648-RA +3R MB7 exon 231202 231270 0 + . Parent=CG14648-RA +3R MB7 exon 231323 231533 0 + . Parent=CG14648-RA +3R MB7 exon 231589 232914 0 + . Parent=CG14648-RA +3R MB7 five_prime_UTR 228771 228923 0 + . Parent=CG14648-RA +3R MB7 start_codon 228924 228926 0 + 0 Parent=CG14648-RA +3R MB7 CDS 228924 229002 0 + 0 Parent=CG14648-RA +3R MB7 CDS 230191 230361 0 + 2 Parent=CG14648-RA +3R MB7 CDS 230423 231141 0 + 2 Parent=CG14648-RA +3R MB7 CDS 231202 231270 0 + 0 Parent=CG14648-RA +3R MB7 CDS 231323 231533 0 + 0 Parent=CG14648-RA +3R MB7 CDS 231589 231977 0 + 2 Parent=CG14648-RA +3R MB7 stop_codon 231975 231977 0 + 0 Parent=CG14648-RA +3R MB7 three_prime_UTR 231978 232914 0 + . Parent=CG14648-RA +3R MB7 gene 233159 241835 0 - . ID=CG32944;Name=CG32944 +3R MB7 mRNA 233159 241835 2 - . ID=CG32944-RE;Parent=CG32944;Name=CG32944-RE +3R MB7 exon 233159 233725 0 - . Parent=CG32944-RE +3R MB7 exon 233781 233962 0 - . Parent=CG32944-RE +3R MB7 exon 238603 238728 0 - . Parent=CG32944-RE +3R MB7 exon 238963 239089 0 - . Parent=CG32944-RE +3R MB7 exon 239158 239228 0 - . Parent=CG32944-RE +3R MB7 exon 240255 240420 0 - . Parent=CG32944-RE +3R MB7 exon 240482 240537 0 - . Parent=CG32944-RE +3R MB7 exon 241405 241835 0 - . Parent=CG32944-RE +3R MB7 stop_codon 233159 233161 0 - 0 Parent=CG32944-RE +3R MB7 CDS 233159 233725 0 - 0 Parent=CG32944-RE +3R MB7 CDS 233781 233962 0 - 2 Parent=CG32944-RE +3R MB7 CDS 238603 238728 0 - 2 Parent=CG32944-RE +3R MB7 CDS 238963 239089 0 - 0 Parent=CG32944-RE +3R MB7 CDS 239158 239228 0 - 2 Parent=CG32944-RE +3R MB7 CDS 240255 240420 0 - 0 Parent=CG32944-RE +3R MB7 CDS 240482 240537 0 - 2 Parent=CG32944-RE +3R MB7 CDS 241405 241459 0 - 0 Parent=CG32944-RE +3R MB7 start_codon 241457 241459 0 - 0 Parent=CG32944-RE +3R MB7 five_prime_UTR 241460 241835 0 - . Parent=CG32944-RE +3R MB7 gene 242059 243389 0 + . ID=CG31528;Name=CG31528 +3R MB7 mRNA 242153 243389 34 + . ID=CG31528-RA;Parent=CG31528;Name=CG31528-RA +3R MB7 exon 242153 243389 0 + . Parent=CG31528-RA +3R MB7 five_prime_UTR 242153 242263 0 + . Parent=CG31528-RA +3R MB7 start_codon 242264 242266 0 + 0 Parent=CG31528-RA +3R MB7 CDS 242264 243298 0 + 0 Parent=CG31528-RA +3R MB7 stop_codon 243296 243298 0 + 0 Parent=CG31528-RA +3R MB7 three_prime_UTR 243299 243389 0 + . Parent=CG31528-RA +3R MB7 mRNA 242059 243377 34 + . ID=CG31528.a;Parent=CG31528;Name=CG31528.a +3R MB7 exon 242059 243377 0 + . Parent=CG31528.a +3R MB7 five_prime_UTR 242059 242263 0 + . Parent=CG31528.a +3R MB7 start_codon 242264 242266 0 + 0 Parent=CG31528.a +3R MB7 CDS 242264 243298 0 + 0 Parent=CG31528.a +3R MB7 stop_codon 243296 243298 0 + 0 Parent=CG31528.a +3R MB7 three_prime_UTR 243299 243377 0 + . Parent=CG31528.a +3R MB7 gene 248220 255054 0 - . ID=CG9809;Name=CG9809 +3R MB7 mRNA 248610 255054 1 - . ID=CG9809-RD;Parent=CG9809;Name=CG9809-RD +3R MB7 exon 248610 249386 0 - . Parent=CG9809-RD +3R MB7 exon 249450 249595 0 - . Parent=CG9809-RD +3R MB7 exon 249655 251486 0 - . Parent=CG9809-RD +3R MB7 exon 251553 252347 0 - . Parent=CG9809-RD +3R MB7 exon 252445 252550 0 - . Parent=CG9809-RD +3R MB7 exon 252604 252722 0 - . Parent=CG9809-RD +3R MB7 exon 254697 255054 0 - . Parent=CG9809-RD +3R MB7 three_prime_UTR 248610 249186 0 - . Parent=CG9809-RD +3R MB7 stop_codon 249187 249189 0 - 0 Parent=CG9809-RD +3R MB7 CDS 249187 249386 0 - 2 Parent=CG9809-RD +3R MB7 CDS 249450 249595 0 - 1 Parent=CG9809-RD +3R MB7 CDS 249655 251486 0 - 0 Parent=CG9809-RD +3R MB7 CDS 251553 252347 0 - 0 Parent=CG9809-RD +3R MB7 CDS 252445 252550 0 - 1 Parent=CG9809-RD +3R MB7 CDS 252604 252701 0 - 0 Parent=CG9809-RD +3R MB7 start_codon 252699 252701 0 - 0 Parent=CG9809-RD +3R MB7 five_prime_UTR 252702 252722 0 - . Parent=CG9809-RD +3R MB7 five_prime_UTR 254697 255054 0 - . Parent=CG9809-RD +3R MB7 mRNA 248220 255054 1 - . ID=CG9809-RB;Parent=CG9809;Name=CG9809-RB +3R MB7 exon 248220 249386 0 - . Parent=CG9809-RB +3R MB7 exon 249450 249595 0 - . Parent=CG9809-RB +3R MB7 exon 249655 251486 0 - . Parent=CG9809-RB +3R MB7 exon 251553 252374 0 - . Parent=CG9809-RB +3R MB7 exon 252445 252550 0 - . Parent=CG9809-RB +3R MB7 exon 252604 252722 0 - . Parent=CG9809-RB +3R MB7 exon 254697 255054 0 - . Parent=CG9809-RB +3R MB7 three_prime_UTR 248220 249186 0 - . Parent=CG9809-RB +3R MB7 stop_codon 249187 249189 0 - 0 Parent=CG9809-RB +3R MB7 CDS 249187 249386 0 - 2 Parent=CG9809-RB +3R MB7 CDS 249450 249595 0 - 1 Parent=CG9809-RB +3R MB7 CDS 249655 251486 0 - 0 Parent=CG9809-RB +3R MB7 CDS 251553 252374 0 - 0 Parent=CG9809-RB +3R MB7 CDS 252445 252550 0 - 1 Parent=CG9809-RB +3R MB7 CDS 252604 252701 0 - 0 Parent=CG9809-RB +3R MB7 start_codon 252699 252701 0 - 0 Parent=CG9809-RB +3R MB7 five_prime_UTR 252702 252722 0 - . Parent=CG9809-RB +3R MB7 five_prime_UTR 254697 255054 0 - . Parent=CG9809-RB +3R MB7 mRNA 248220 255054 1 - . ID=CG9809.a;Parent=CG9809;Name=CG9809.a +3R MB7 exon 248220 249595 0 - . Parent=CG9809.a +3R MB7 exon 249655 251486 0 - . Parent=CG9809.a +3R MB7 exon 251553 252374 0 - . Parent=CG9809.a +3R MB7 exon 252445 252550 0 - . Parent=CG9809.a +3R MB7 exon 252604 252722 0 - . Parent=CG9809.a +3R MB7 exon 254697 255054 0 - . Parent=CG9809.a +3R MB7 three_prime_UTR 248220 249186 0 - . Parent=CG9809.a +3R MB7 stop_codon 249187 249189 0 - 0 Parent=CG9809.a +3R MB7 CDS 249187 249595 0 - 1 Parent=CG9809.a +3R MB7 CDS 249655 251486 0 - 0 Parent=CG9809.a +3R MB7 CDS 251553 252374 0 - 0 Parent=CG9809.a +3R MB7 CDS 252445 252550 0 - 1 Parent=CG9809.a +3R MB7 CDS 252604 252701 0 - 0 Parent=CG9809.a +3R MB7 start_codon 252699 252701 0 - 0 Parent=CG9809.a +3R MB7 five_prime_UTR 252702 252722 0 - . Parent=CG9809.a +3R MB7 five_prime_UTR 254697 255054 0 - . Parent=CG9809.a +3R MB7 gene 252752 253927 0 + . ID=CG31525;Name=CG31525 +3R MB7 mRNA 252752 253927 34 + . ID=CG31525-RA;Parent=CG31525;Name=CG31525-RA +3R MB7 exon 252752 253927 0 + . Parent=CG31525-RA +3R MB7 five_prime_UTR 252752 252890 0 + . Parent=CG31525-RA +3R MB7 start_codon 252891 252893 0 + 0 Parent=CG31525-RA +3R MB7 CDS 252891 253841 0 + 0 Parent=CG31525-RA +3R MB7 stop_codon 253839 253841 0 + 0 Parent=CG31525-RA +3R MB7 three_prime_UTR 253842 253927 0 + . Parent=CG31525-RA +3R MB7 gene 255524 260263 0 - . ID=CG9805;Name=CG9805 +3R MB7 mRNA 255524 260263 2 - . ID=CG9805.a;Parent=CG9805;Name=CG9805.a +3R MB7 exon 255524 255890 0 - . Parent=CG9805.a +3R MB7 exon 255950 258188 0 - . Parent=CG9805.a +3R MB7 exon 258239 259323 0 - . Parent=CG9805.a +3R MB7 exon 259421 259742 0 - . Parent=CG9805.a +3R MB7 exon 260242 260263 0 - . Parent=CG9805.a +3R MB7 three_prime_UTR 255524 255840 0 - . Parent=CG9805.a +3R MB7 stop_codon 255841 255843 0 - 0 Parent=CG9805.a +3R MB7 CDS 255841 255890 0 - 2 Parent=CG9805.a +3R MB7 CDS 255950 258188 0 - 0 Parent=CG9805.a +3R MB7 CDS 258239 259323 0 - 2 Parent=CG9805.a +3R MB7 CDS 259421 259469 0 - 0 Parent=CG9805.a +3R MB7 start_codon 259467 259469 0 - 0 Parent=CG9805.a +3R MB7 five_prime_UTR 259470 259742 0 - . Parent=CG9805.a +3R MB7 five_prime_UTR 260242 260263 0 - . Parent=CG9805.a +3R MB7 mRNA 255639 259652 1 - . ID=CG9805-RA;Parent=CG9805;Name=CG9805-RA +3R MB7 exon 255639 255890 0 - . Parent=CG9805-RA +3R MB7 exon 255950 258188 0 - . Parent=CG9805-RA +3R MB7 exon 258239 259323 0 - . Parent=CG9805-RA +3R MB7 exon 259421 259652 0 - . Parent=CG9805-RA +3R MB7 three_prime_UTR 255639 255840 0 - . Parent=CG9805-RA +3R MB7 stop_codon 255841 255843 0 - 0 Parent=CG9805-RA +3R MB7 CDS 255841 255890 0 - 2 Parent=CG9805-RA +3R MB7 CDS 255950 258188 0 - 0 Parent=CG9805-RA +3R MB7 CDS 258239 259323 0 - 2 Parent=CG9805-RA +3R MB7 CDS 259421 259469 0 - 0 Parent=CG9805-RA +3R MB7 start_codon 259467 259469 0 - 0 Parent=CG9805-RA +3R MB7 five_prime_UTR 259470 259652 0 - . Parent=CG9805-RA +3R MB7 gene 259715 261897 0 + . ID=CG1074;Name=CG1074 +3R MB7 mRNA 259715 261897 3 + . ID=CG1074.a;Parent=CG1074;Name=CG1074.a +3R MB7 exon 259715 259881 0 + . Parent=CG1074.a +3R MB7 exon 260377 261172 0 + . Parent=CG1074.a +3R MB7 exon 261229 261897 0 + . Parent=CG1074.a +3R MB7 five_prime_UTR 259715 259782 0 + . Parent=CG1074.a +3R MB7 start_codon 259783 259785 0 + 0 Parent=CG1074.a +3R MB7 CDS 259783 259881 0 + 0 Parent=CG1074.a +3R MB7 CDS 260377 261172 0 + 0 Parent=CG1074.a +3R MB7 CDS 261229 261773 0 + 2 Parent=CG1074.a +3R MB7 stop_codon 261771 261773 0 + 0 Parent=CG1074.a +3R MB7 three_prime_UTR 261774 261897 0 + . Parent=CG1074.a +3R MB7 mRNA 259715 261897 1 + . ID=CG1074-RA;Parent=CG1074;Name=CG1074-RA +3R MB7 exon 259715 259908 0 + . Parent=CG1074-RA +3R MB7 exon 260377 261172 0 + . Parent=CG1074-RA +3R MB7 exon 261229 261897 0 + . Parent=CG1074-RA +3R MB7 five_prime_UTR 259715 259782 0 + . Parent=CG1074-RA +3R MB7 start_codon 259783 259785 0 + 0 Parent=CG1074-RA +3R MB7 CDS 259783 259908 0 + 0 Parent=CG1074-RA +3R MB7 CDS 260377 261172 0 + 0 Parent=CG1074-RA +3R MB7 CDS 261229 261773 0 + 2 Parent=CG1074-RA +3R MB7 stop_codon 261771 261773 0 + 0 Parent=CG1074-RA +3R MB7 three_prime_UTR 261774 261897 0 + . Parent=CG1074-RA +3R MB7 gene 261944 263051 0 - . ID=CG9804;Name=CG9804 +3R MB7 mRNA 261944 263051 31 - . ID=CG9804-RA;Parent=CG9804;Name=CG9804-RA +3R MB7 exon 261944 263051 0 - . Parent=CG9804-RA +3R MB7 three_prime_UTR 261944 262124 0 - . Parent=CG9804-RA +3R MB7 stop_codon 262125 262127 0 - 0 Parent=CG9804-RA +3R MB7 CDS 262125 262829 0 - 0 Parent=CG9804-RA +3R MB7 start_codon 262827 262829 0 - 0 Parent=CG9804-RA +3R MB7 five_prime_UTR 262830 263051 0 - . Parent=CG9804-RA +3R MB7 gene 263102 267050 0 + . ID=CG14650;Name=CG14650 +3R MB7 mRNA 263102 267050 1 + . ID=CG14650-RA;Parent=CG14650;Name=CG14650-RA +3R MB7 exon 263102 265481 0 + . Parent=CG14650-RA +3R MB7 exon 265539 265692 0 + . Parent=CG14650-RA +3R MB7 exon 265749 265873 0 + . Parent=CG14650-RA +3R MB7 exon 265943 266045 0 + . Parent=CG14650-RA +3R MB7 exon 266115 266407 0 + . Parent=CG14650-RA +3R MB7 exon 266469 267050 0 + . Parent=CG14650-RA +3R MB7 five_prime_UTR 263102 263349 0 + . Parent=CG14650-RA +3R MB7 start_codon 263350 263352 0 + 0 Parent=CG14650-RA +3R MB7 CDS 263350 265481 0 + 0 Parent=CG14650-RA +3R MB7 CDS 265539 265692 0 + 1 Parent=CG14650-RA +3R MB7 CDS 265749 265873 0 + 0 Parent=CG14650-RA +3R MB7 CDS 265943 266045 0 + 1 Parent=CG14650-RA +3R MB7 CDS 266115 266407 0 + 0 Parent=CG14650-RA +3R MB7 CDS 266469 266574 0 + 1 Parent=CG14650-RA +3R MB7 stop_codon 266572 266574 0 + 0 Parent=CG14650-RA +3R MB7 three_prime_UTR 266575 267050 0 + . Parent=CG14650-RA +3R MB7 gene 267137 279036 0 - . ID=CG31522;Name=CG31522 +3R MB7 mRNA 267137 276555 3 - . ID=CG31522-RD;Parent=CG31522;Name=CG31522-RD +3R MB7 exon 267137 268777 0 - . Parent=CG31522-RD +3R MB7 exon 269624 269779 0 - . Parent=CG31522-RD +3R MB7 exon 269834 269970 0 - . Parent=CG31522-RD +3R MB7 exon 270044 270149 0 - . Parent=CG31522-RD +3R MB7 exon 270228 270284 0 - . Parent=CG31522-RD +3R MB7 exon 271054 271137 0 - . Parent=CG31522-RD +3R MB7 exon 272147 272254 0 - . Parent=CG31522-RD +3R MB7 exon 272462 272544 0 - . Parent=CG31522-RD +3R MB7 exon 273423 273676 0 - . Parent=CG31522-RD +3R MB7 exon 276432 276555 0 - . Parent=CG31522-RD +3R MB7 three_prime_UTR 267137 268468 0 - . Parent=CG31522-RD +3R MB7 stop_codon 268469 268471 0 - 0 Parent=CG31522-RD +3R MB7 CDS 268469 268777 0 - 0 Parent=CG31522-RD +3R MB7 CDS 269624 269779 0 - 0 Parent=CG31522-RD +3R MB7 CDS 269834 269970 0 - 2 Parent=CG31522-RD +3R MB7 CDS 270044 270149 0 - 0 Parent=CG31522-RD +3R MB7 CDS 270228 270284 0 - 0 Parent=CG31522-RD +3R MB7 CDS 271054 271137 0 - 0 Parent=CG31522-RD +3R MB7 CDS 272147 272254 0 - 0 Parent=CG31522-RD +3R MB7 CDS 272462 272544 0 - 2 Parent=CG31522-RD +3R MB7 CDS 273423 273480 0 - 0 Parent=CG31522-RD +3R MB7 start_codon 273478 273480 0 - 0 Parent=CG31522-RD +3R MB7 five_prime_UTR 273481 273676 0 - . Parent=CG31522-RD +3R MB7 five_prime_UTR 276432 276555 0 - . Parent=CG31522-RD +3R MB7 mRNA 267137 279036 1 - . ID=CG31522-RB;Parent=CG31522;Name=CG31522-RB +3R MB7 exon 267137 268777 0 - . Parent=CG31522-RB +3R MB7 exon 269624 269779 0 - . Parent=CG31522-RB +3R MB7 exon 269834 269970 0 - . Parent=CG31522-RB +3R MB7 exon 270044 270149 0 - . Parent=CG31522-RB +3R MB7 exon 270228 270284 0 - . Parent=CG31522-RB +3R MB7 exon 271054 271137 0 - . Parent=CG31522-RB +3R MB7 exon 272147 272254 0 - . Parent=CG31522-RB +3R MB7 exon 272462 272544 0 - . Parent=CG31522-RB +3R MB7 exon 273423 273676 0 - . Parent=CG31522-RB +3R MB7 exon 278914 279036 0 - . Parent=CG31522-RB +3R MB7 three_prime_UTR 267137 268468 0 - . Parent=CG31522-RB +3R MB7 stop_codon 268469 268471 0 - 0 Parent=CG31522-RB +3R MB7 CDS 268469 268777 0 - 0 Parent=CG31522-RB +3R MB7 CDS 269624 269779 0 - 0 Parent=CG31522-RB +3R MB7 CDS 269834 269970 0 - 2 Parent=CG31522-RB +3R MB7 CDS 270044 270149 0 - 0 Parent=CG31522-RB +3R MB7 CDS 270228 270284 0 - 0 Parent=CG31522-RB +3R MB7 CDS 271054 271137 0 - 0 Parent=CG31522-RB +3R MB7 CDS 272147 272254 0 - 0 Parent=CG31522-RB +3R MB7 CDS 272462 272544 0 - 2 Parent=CG31522-RB +3R MB7 CDS 273423 273480 0 - 0 Parent=CG31522-RB +3R MB7 start_codon 273478 273480 0 - 0 Parent=CG31522-RB +3R MB7 five_prime_UTR 273481 273676 0 - . Parent=CG31522-RB +3R MB7 five_prime_UTR 278914 279036 0 - . Parent=CG31522-RB +3R MB7 mRNA 267137 276555 3 - . ID=CG31522.a;Parent=CG31522;Name=CG31522.a +3R MB7 exon 267137 268777 0 - . Parent=CG31522.a +3R MB7 exon 269624 269779 0 - . Parent=CG31522.a +3R MB7 exon 269834 269970 0 - . Parent=CG31522.a +3R MB7 exon 270044 270149 0 - . Parent=CG31522.a +3R MB7 exon 270228 270284 0 - . Parent=CG31522.a +3R MB7 exon 271888 271968 0 - . Parent=CG31522.a +3R MB7 exon 272147 272254 0 - . Parent=CG31522.a +3R MB7 exon 272462 272544 0 - . Parent=CG31522.a +3R MB7 exon 273423 273676 0 - . Parent=CG31522.a +3R MB7 exon 276432 276555 0 - . Parent=CG31522.a +3R MB7 three_prime_UTR 267137 268468 0 - . Parent=CG31522.a +3R MB7 stop_codon 268469 268471 0 - 0 Parent=CG31522.a +3R MB7 CDS 268469 268777 0 - 0 Parent=CG31522.a +3R MB7 CDS 269624 269779 0 - 0 Parent=CG31522.a +3R MB7 CDS 269834 269970 0 - 2 Parent=CG31522.a +3R MB7 CDS 270044 270149 0 - 0 Parent=CG31522.a +3R MB7 CDS 270228 270284 0 - 0 Parent=CG31522.a +3R MB7 CDS 271888 271968 0 - 0 Parent=CG31522.a +3R MB7 CDS 272147 272254 0 - 0 Parent=CG31522.a +3R MB7 CDS 272462 272544 0 - 2 Parent=CG31522.a +3R MB7 CDS 273423 273480 0 - 0 Parent=CG31522.a +3R MB7 start_codon 273478 273480 0 - 0 Parent=CG31522.a +3R MB7 five_prime_UTR 273481 273676 0 - . Parent=CG31522.a +3R MB7 five_prime_UTR 276432 276555 0 - . Parent=CG31522.a +3R MB7 mRNA 267137 276540 1 - . ID=CG31522-RA;Parent=CG31522;Name=CG31522-RA +3R MB7 exon 267137 268777 0 - . Parent=CG31522-RA +3R MB7 exon 269624 269779 0 - . Parent=CG31522-RA +3R MB7 exon 269834 269970 0 - . Parent=CG31522-RA +3R MB7 exon 270044 270149 0 - . Parent=CG31522-RA +3R MB7 exon 270228 270284 0 - . Parent=CG31522-RA +3R MB7 exon 271888 271968 0 - . Parent=CG31522-RA +3R MB7 exon 272147 272254 0 - . Parent=CG31522-RA +3R MB7 exon 272462 272544 0 - . Parent=CG31522-RA +3R MB7 exon 273423 273676 0 - . Parent=CG31522-RA +3R MB7 exon 276194 276540 0 - . Parent=CG31522-RA +3R MB7 three_prime_UTR 267137 268468 0 - . Parent=CG31522-RA +3R MB7 stop_codon 268469 268471 0 - 0 Parent=CG31522-RA +3R MB7 CDS 268469 268777 0 - 0 Parent=CG31522-RA +3R MB7 CDS 269624 269779 0 - 0 Parent=CG31522-RA +3R MB7 CDS 269834 269970 0 - 2 Parent=CG31522-RA +3R MB7 CDS 270044 270149 0 - 0 Parent=CG31522-RA +3R MB7 CDS 270228 270284 0 - 0 Parent=CG31522-RA +3R MB7 CDS 271888 271968 0 - 0 Parent=CG31522-RA +3R MB7 CDS 272147 272254 0 - 0 Parent=CG31522-RA +3R MB7 CDS 272462 272544 0 - 2 Parent=CG31522-RA +3R MB7 CDS 273423 273480 0 - 0 Parent=CG31522-RA +3R MB7 start_codon 273478 273480 0 - 0 Parent=CG31522-RA +3R MB7 five_prime_UTR 273481 273676 0 - . Parent=CG31522-RA +3R MB7 five_prime_UTR 276194 276540 0 - . Parent=CG31522-RA +3R MB7 mRNA 272959 279036 2 - . ID=CG31522-RC;Parent=CG31522;Name=CG31522-RC +3R MB7 exon 272959 273676 0 - . Parent=CG31522-RC +3R MB7 exon 278914 279036 0 - . Parent=CG31522-RC +3R MB7 three_prime_UTR 272959 273249 0 - . Parent=CG31522-RC +3R MB7 stop_codon 273250 273252 0 - 0 Parent=CG31522-RC +3R MB7 CDS 273250 273480 0 - 0 Parent=CG31522-RC +3R MB7 start_codon 273478 273480 0 - 0 Parent=CG31522-RC +3R MB7 five_prime_UTR 273481 273676 0 - . Parent=CG31522-RC +3R MB7 five_prime_UTR 278914 279036 0 - . Parent=CG31522-RC +3R MB7 gene 291139 304828 0 - . ID=CG31523;Name=CG31523 +3R MB7 mRNA 291139 304828 2 - . ID=CG31523-RC;Parent=CG31523;Name=CG31523-RC +3R MB7 exon 291139 292565 0 - . Parent=CG31523-RC +3R MB7 exon 293016 293294 0 - . Parent=CG31523-RC +3R MB7 exon 293354 293490 0 - . Parent=CG31523-RC +3R MB7 exon 293566 293728 0 - . Parent=CG31523-RC +3R MB7 exon 293788 293868 0 - . Parent=CG31523-RC +3R MB7 exon 293936 294126 0 - . Parent=CG31523-RC +3R MB7 exon 294186 294321 0 - . Parent=CG31523-RC +3R MB7 exon 304355 304828 0 - . Parent=CG31523-RC +3R MB7 three_prime_UTR 291139 292412 0 - . Parent=CG31523-RC +3R MB7 stop_codon 292413 292415 0 - 0 Parent=CG31523-RC +3R MB7 CDS 292413 292565 0 - 0 Parent=CG31523-RC +3R MB7 CDS 293016 293294 0 - 0 Parent=CG31523-RC +3R MB7 CDS 293354 293490 0 - 2 Parent=CG31523-RC +3R MB7 CDS 293566 293728 0 - 0 Parent=CG31523-RC +3R MB7 CDS 293788 293868 0 - 0 Parent=CG31523-RC +3R MB7 CDS 293936 294126 0 - 2 Parent=CG31523-RC +3R MB7 CDS 294186 294246 0 - 0 Parent=CG31523-RC +3R MB7 start_codon 294244 294246 0 - 0 Parent=CG31523-RC +3R MB7 five_prime_UTR 294247 294321 0 - . Parent=CG31523-RC +3R MB7 five_prime_UTR 304355 304828 0 - . Parent=CG31523-RC +3R MB7 mRNA 291139 304729 2 - . ID=CG31523-RB;Parent=CG31523;Name=CG31523-RB +3R MB7 exon 291139 292565 0 - . Parent=CG31523-RB +3R MB7 exon 293016 293294 0 - . Parent=CG31523-RB +3R MB7 exon 293354 293490 0 - . Parent=CG31523-RB +3R MB7 exon 293566 293728 0 - . Parent=CG31523-RB +3R MB7 exon 293788 293868 0 - . Parent=CG31523-RB +3R MB7 exon 293936 294126 0 - . Parent=CG31523-RB +3R MB7 exon 294186 294321 0 - . Parent=CG31523-RB +3R MB7 exon 304675 304729 0 - . Parent=CG31523-RB +3R MB7 three_prime_UTR 291139 292412 0 - . Parent=CG31523-RB +3R MB7 stop_codon 292413 292415 0 - 0 Parent=CG31523-RB +3R MB7 CDS 292413 292565 0 - 0 Parent=CG31523-RB +3R MB7 CDS 293016 293294 0 - 0 Parent=CG31523-RB +3R MB7 CDS 293354 293490 0 - 2 Parent=CG31523-RB +3R MB7 CDS 293566 293728 0 - 0 Parent=CG31523-RB +3R MB7 CDS 293788 293868 0 - 0 Parent=CG31523-RB +3R MB7 CDS 293936 294126 0 - 2 Parent=CG31523-RB +3R MB7 CDS 294186 294246 0 - 0 Parent=CG31523-RB +3R MB7 start_codon 294244 294246 0 - 0 Parent=CG31523-RB +3R MB7 five_prime_UTR 294247 294321 0 - . Parent=CG31523-RB +3R MB7 five_prime_UTR 304675 304729 0 - . Parent=CG31523-RB +3R MB7 mRNA 291139 297321 1 - . ID=CG31523-RA;Parent=CG31523;Name=CG31523-RA +3R MB7 exon 291139 292565 0 - . Parent=CG31523-RA +3R MB7 exon 293016 293294 0 - . Parent=CG31523-RA +3R MB7 exon 293354 293490 0 - . Parent=CG31523-RA +3R MB7 exon 293566 293728 0 - . Parent=CG31523-RA +3R MB7 exon 293788 293868 0 - . Parent=CG31523-RA +3R MB7 exon 293936 294126 0 - . Parent=CG31523-RA +3R MB7 exon 294186 294321 0 - . Parent=CG31523-RA +3R MB7 exon 296836 297321 0 - . Parent=CG31523-RA +3R MB7 three_prime_UTR 291139 292412 0 - . Parent=CG31523-RA +3R MB7 stop_codon 292413 292415 0 - 0 Parent=CG31523-RA +3R MB7 CDS 292413 292565 0 - 0 Parent=CG31523-RA +3R MB7 CDS 293016 293294 0 - 0 Parent=CG31523-RA +3R MB7 CDS 293354 293490 0 - 2 Parent=CG31523-RA +3R MB7 CDS 293566 293728 0 - 0 Parent=CG31523-RA +3R MB7 CDS 293788 293868 0 - 0 Parent=CG31523-RA +3R MB7 CDS 293936 294126 0 - 2 Parent=CG31523-RA +3R MB7 CDS 294186 294246 0 - 0 Parent=CG31523-RA +3R MB7 start_codon 294244 294246 0 - 0 Parent=CG31523-RA +3R MB7 five_prime_UTR 294247 294321 0 - . Parent=CG31523-RA +3R MB7 five_prime_UTR 296836 297321 0 - . Parent=CG31523-RA +3R MB7 mRNA 291139 294355 2 - . ID=CG31523-RD;Parent=CG31523;Name=CG31523-RD +3R MB7 exon 291139 292565 0 - . Parent=CG31523-RD +3R MB7 exon 293016 293294 0 - . Parent=CG31523-RD +3R MB7 exon 293354 293490 0 - . Parent=CG31523-RD +3R MB7 exon 293566 293728 0 - . Parent=CG31523-RD +3R MB7 exon 293788 293868 0 - . Parent=CG31523-RD +3R MB7 exon 293936 294126 0 - . Parent=CG31523-RD +3R MB7 exon 294186 294355 0 - . Parent=CG31523-RD +3R MB7 three_prime_UTR 291139 292412 0 - . Parent=CG31523-RD +3R MB7 stop_codon 292413 292415 0 - 0 Parent=CG31523-RD +3R MB7 CDS 292413 292565 0 - 0 Parent=CG31523-RD +3R MB7 CDS 293016 293294 0 - 0 Parent=CG31523-RD +3R MB7 CDS 293354 293490 0 - 2 Parent=CG31523-RD +3R MB7 CDS 293566 293728 0 - 0 Parent=CG31523-RD +3R MB7 CDS 293788 293868 0 - 0 Parent=CG31523-RD +3R MB7 CDS 293936 294126 0 - 2 Parent=CG31523-RD +3R MB7 CDS 294186 294246 0 - 0 Parent=CG31523-RD +3R MB7 start_codon 294244 294246 0 - 0 Parent=CG31523-RD +3R MB7 five_prime_UTR 294247 294355 0 - . Parent=CG31523-RD +3R MB7 gene 306442 309943 0 + . ID=CG14651;Name=CG14651 +3R MB7 mRNA 306534 309943 34 + . ID=CG14651-RB;Parent=CG14651;Name=CG14651-RB +3R MB7 exon 306534 309943 0 + . Parent=CG14651-RB +3R MB7 five_prime_UTR 306534 306540 0 + . Parent=CG14651-RB +3R MB7 start_codon 306541 306543 0 + 0 Parent=CG14651-RB +3R MB7 CDS 306541 309780 0 + 0 Parent=CG14651-RB +3R MB7 stop_codon 309778 309780 0 + 0 Parent=CG14651-RB +3R MB7 three_prime_UTR 309781 309943 0 + . Parent=CG14651-RB +3R MB7 mRNA 306442 309937 34 + . ID=CG14651.a;Parent=CG14651;Name=CG14651.a +3R MB7 exon 306442 309937 0 + . Parent=CG14651.a +3R MB7 five_prime_UTR 306442 306540 0 + . Parent=CG14651.a +3R MB7 start_codon 306541 306543 0 + 0 Parent=CG14651.a +3R MB7 CDS 306541 309780 0 + 0 Parent=CG14651.a +3R MB7 stop_codon 309778 309780 0 + 0 Parent=CG14651.a +3R MB7 three_prime_UTR 309781 309937 0 + . Parent=CG14651.a +3R MB7 gene 310763 313185 0 + . ID=CG1078;Name=CG1078 +3R MB7 mRNA 310763 313185 1 + . ID=CG1078-RA;Parent=CG1078;Name=CG1078-RA +3R MB7 exon 310763 312253 0 + . Parent=CG1078-RA +3R MB7 exon 312318 312410 0 + . Parent=CG1078-RA +3R MB7 exon 312543 312613 0 + . Parent=CG1078-RA +3R MB7 exon 312670 313185 0 + . Parent=CG1078-RA +3R MB7 five_prime_UTR 310763 310827 0 + . Parent=CG1078-RA +3R MB7 start_codon 310828 310830 0 + 0 Parent=CG1078-RA +3R MB7 CDS 310828 312253 0 + 0 Parent=CG1078-RA +3R MB7 CDS 312318 312410 0 + 2 Parent=CG1078-RA +3R MB7 CDS 312543 312613 0 + 2 Parent=CG1078-RA +3R MB7 CDS 312670 313185 0 + 0 Parent=CG1078-RA +3R MB7 stop_codon 313183 313185 0 + 0 Parent=CG1078-RA +3R MB7 gene 319126 383789 0 - . ID=CG34357;Name=CG34357 +3R MB7 mRNA 319126 383789 3 - . ID=CG34357.a;Parent=CG34357;Name=CG34357.a +3R MB7 exon 319126 320269 0 - . Parent=CG34357.a +3R MB7 exon 320331 320342 0 - . Parent=CG34357.a +3R MB7 exon 320657 320834 0 - . Parent=CG34357.a +3R MB7 exon 320896 321160 0 - . Parent=CG34357.a +3R MB7 exon 321412 321604 0 - . Parent=CG34357.a +3R MB7 exon 321678 321854 0 - . Parent=CG34357.a +3R MB7 exon 322198 323189 0 - . Parent=CG34357.a +3R MB7 exon 323280 323370 0 - . Parent=CG34357.a +3R MB7 exon 328161 328953 0 - . Parent=CG34357.a +3R MB7 exon 329337 329447 0 - . Parent=CG34357.a +3R MB7 exon 348710 348809 0 - . Parent=CG34357.a +3R MB7 exon 359871 360247 0 - . Parent=CG34357.a +3R MB7 exon 363527 364411 0 - . Parent=CG34357.a +3R MB7 exon 382418 382728 0 - . Parent=CG34357.a +3R MB7 exon 383664 383789 0 - . Parent=CG34357.a +3R MB7 stop_codon 319126 319128 0 - 0 Parent=CG34357.a +3R MB7 CDS 319126 320269 0 - 1 Parent=CG34357.a +3R MB7 CDS 320331 320342 0 - 1 Parent=CG34357.a +3R MB7 CDS 320657 320834 0 - 2 Parent=CG34357.a +3R MB7 CDS 320896 321160 0 - 0 Parent=CG34357.a +3R MB7 CDS 321412 321604 0 - 1 Parent=CG34357.a +3R MB7 CDS 321678 321854 0 - 1 Parent=CG34357.a +3R MB7 CDS 322198 323189 0 - 0 Parent=CG34357.a +3R MB7 CDS 323280 323370 0 - 1 Parent=CG34357.a +3R MB7 CDS 328161 328953 0 - 2 Parent=CG34357.a +3R MB7 CDS 329337 329447 0 - 2 Parent=CG34357.a +3R MB7 CDS 348710 348809 0 - 0 Parent=CG34357.a +3R MB7 CDS 359871 360247 0 - 2 Parent=CG34357.a +3R MB7 CDS 363527 364151 0 - 0 Parent=CG34357.a +3R MB7 start_codon 364149 364151 0 - 0 Parent=CG34357.a +3R MB7 five_prime_UTR 364152 364411 0 - . Parent=CG34357.a +3R MB7 five_prime_UTR 382418 382728 0 - . Parent=CG34357.a +3R MB7 five_prime_UTR 383664 383789 0 - . Parent=CG34357.a +3R MB7 mRNA 319126 360075 3 - . ID=CG34357.b;Parent=CG34357;Name=CG34357.b +3R MB7 exon 319126 320269 0 - . Parent=CG34357.b +3R MB7 exon 320331 320342 0 - . Parent=CG34357.b +3R MB7 exon 320657 320834 0 - . Parent=CG34357.b +3R MB7 exon 320896 321160 0 - . Parent=CG34357.b +3R MB7 exon 321412 321604 0 - . Parent=CG34357.b +3R MB7 exon 321678 321854 0 - . Parent=CG34357.b +3R MB7 exon 322198 323189 0 - . Parent=CG34357.b +3R MB7 exon 323280 323370 0 - . Parent=CG34357.b +3R MB7 exon 328161 328953 0 - . Parent=CG34357.b +3R MB7 exon 329337 329447 0 - . Parent=CG34357.b +3R MB7 exon 348710 348809 0 - . Parent=CG34357.b +3R MB7 exon 359871 360075 0 - . Parent=CG34357.b +3R MB7 stop_codon 319126 319128 0 - 0 Parent=CG34357.b +3R MB7 CDS 319126 320269 0 - 1 Parent=CG34357.b +3R MB7 CDS 320331 320342 0 - 1 Parent=CG34357.b +3R MB7 CDS 320657 320834 0 - 2 Parent=CG34357.b +3R MB7 CDS 320896 321160 0 - 0 Parent=CG34357.b +3R MB7 CDS 321412 321604 0 - 1 Parent=CG34357.b +3R MB7 CDS 321678 321854 0 - 1 Parent=CG34357.b +3R MB7 CDS 322198 323189 0 - 0 Parent=CG34357.b +3R MB7 CDS 323280 323370 0 - 1 Parent=CG34357.b +3R MB7 CDS 328161 328953 0 - 2 Parent=CG34357.b +3R MB7 CDS 329337 329447 0 - 2 Parent=CG34357.b +3R MB7 CDS 348710 348809 0 - 0 Parent=CG34357.b +3R MB7 CDS 359871 359876 0 - 0 Parent=CG34357.b +3R MB7 start_codon 359874 359876 0 - 0 Parent=CG34357.b +3R MB7 five_prime_UTR 359877 360075 0 - . Parent=CG34357.b +3R MB7 mRNA 340352 383789 1 - . ID=CG34357-RB;Parent=CG34357;Name=CG34357-RB +3R MB7 exon 340352 340841 0 - . Parent=CG34357-RB +3R MB7 exon 348710 348809 0 - . Parent=CG34357-RB +3R MB7 exon 359871 360247 0 - . Parent=CG34357-RB +3R MB7 exon 363527 364411 0 - . Parent=CG34357-RB +3R MB7 exon 382418 382728 0 - . Parent=CG34357-RB +3R MB7 exon 383664 383789 0 - . Parent=CG34357-RB +3R MB7 three_prime_UTR 340352 340674 0 - . Parent=CG34357-RB +3R MB7 stop_codon 340675 340677 0 - 0 Parent=CG34357-RB +3R MB7 CDS 340675 340841 0 - 2 Parent=CG34357-RB +3R MB7 CDS 348710 348809 0 - 0 Parent=CG34357-RB +3R MB7 CDS 359871 360247 0 - 2 Parent=CG34357-RB +3R MB7 CDS 363527 364151 0 - 0 Parent=CG34357-RB +3R MB7 start_codon 364149 364151 0 - 0 Parent=CG34357-RB +3R MB7 five_prime_UTR 364152 364411 0 - . Parent=CG34357-RB +3R MB7 five_prime_UTR 382418 382728 0 - . Parent=CG34357-RB +3R MB7 five_prime_UTR 383664 383789 0 - . Parent=CG34357-RB +3R MB7 gene 330333 331985 0 - . ID=CG34425;Name=CG34425 +3R MB7 mRNA 330333 331985 34 - . ID=CG34425-RA;Parent=CG34425;Name=CG34425-RA +3R MB7 exon 330333 331985 0 - . Parent=CG34425-RA +3R MB7 three_prime_UTR 330333 330386 0 - . Parent=CG34425-RA +3R MB7 stop_codon 330387 330389 0 - 0 Parent=CG34425-RA +3R MB7 CDS 330387 331985 0 - 0 Parent=CG34425-RA +3R MB7 start_codon 331983 331985 0 - 0 Parent=CG34425-RA +3R MB7 gene 358950 359693 0 + . ID=CG31526;Name=CG31526 +3R MB7 mRNA 358950 359693 2 + . ID=CG31526-RB;Parent=CG31526;Name=CG31526-RB +3R MB7 exon 358950 359153 0 + . Parent=CG31526-RB +3R MB7 exon 359215 359534 0 + . Parent=CG31526-RB +3R MB7 exon 359590 359693 0 + . Parent=CG31526-RB +3R MB7 five_prime_UTR 358950 359153 0 + . Parent=CG31526-RB +3R MB7 five_prime_UTR 359215 359275 0 + . Parent=CG31526-RB +3R MB7 start_codon 359276 359278 0 + 0 Parent=CG31526-RB +3R MB7 CDS 359276 359488 0 + 0 Parent=CG31526-RB +3R MB7 stop_codon 359486 359488 0 + 0 Parent=CG31526-RB +3R MB7 three_prime_UTR 359489 359534 0 + . Parent=CG31526-RB +3R MB7 three_prime_UTR 359590 359693 0 + . Parent=CG31526-RB +3R MB7 mRNA 358950 359666 1 + . ID=CG31526-RA;Parent=CG31526;Name=CG31526-RA +3R MB7 exon 358950 359153 0 + . Parent=CG31526-RA +3R MB7 exon 359215 359666 0 + . Parent=CG31526-RA +3R MB7 five_prime_UTR 358950 359153 0 + . Parent=CG31526-RA +3R MB7 five_prime_UTR 359215 359275 0 + . Parent=CG31526-RA +3R MB7 start_codon 359276 359278 0 + 0 Parent=CG31526-RA +3R MB7 CDS 359276 359488 0 + 0 Parent=CG31526-RA +3R MB7 stop_codon 359486 359488 0 + 0 Parent=CG31526-RA +3R MB7 three_prime_UTR 359489 359666 0 + . Parent=CG31526-RA +3R MB7 gene 403661 404368 0 - . ID=CG32945;Name=CG32945 +3R MB7 mRNA 403661 404366 31 - . ID=CG32945-RA.3d;Parent=CG32945;Name=CG32945-RA.3d +3R MB7 exon 403661 404366 0 - . Parent=CG32945-RA.3d +3R MB7 three_prime_UTR 403661 403814 0 - . Parent=CG32945-RA.3d +3R MB7 stop_codon 403815 403817 0 - 0 Parent=CG32945-RA.3d +3R MB7 CDS 403815 404315 0 - 0 Parent=CG32945-RA.3d +3R MB7 start_codon 404313 404315 0 - 0 Parent=CG32945-RA.3d +3R MB7 five_prime_UTR 404316 404366 0 - . Parent=CG32945-RA.3d +3R MB7 mRNA 403661 404368 34 - . ID=CG32945.a;Parent=CG32945;Name=CG32945.a +3R MB7 exon 403661 404368 0 - . Parent=CG32945.a +3R MB7 three_prime_UTR 403661 403814 0 - . Parent=CG32945.a +3R MB7 stop_codon 403815 403817 0 - 0 Parent=CG32945.a +3R MB7 CDS 403815 404315 0 - 0 Parent=CG32945.a +3R MB7 start_codon 404313 404315 0 - 0 Parent=CG32945.a +3R MB7 five_prime_UTR 404316 404368 0 - . Parent=CG32945.a +3R MB7 gene 438597 459031 0 + . ID=CG1056;Name=CG1056 +3R MB7 mRNA 438597 459026 3 + . ID=CG1056-RB;Parent=CG1056;Name=CG1056-RB +3R MB7 exon 438597 439072 0 + . Parent=CG1056-RB +3R MB7 exon 448231 449346 0 + . Parent=CG1056-RB +3R MB7 exon 452695 452919 0 + . Parent=CG1056-RB +3R MB7 exon 452981 453179 0 + . Parent=CG1056-RB +3R MB7 exon 453628 454071 0 + . Parent=CG1056-RB +3R MB7 exon 455851 456243 0 + . Parent=CG1056-RB +3R MB7 exon 457530 457826 0 + . Parent=CG1056-RB +3R MB7 exon 458460 459026 0 + . Parent=CG1056-RB +3R MB7 five_prime_UTR 438597 439072 0 + . Parent=CG1056-RB +3R MB7 five_prime_UTR 448231 448301 0 + . Parent=CG1056-RB +3R MB7 start_codon 448302 448304 0 + 0 Parent=CG1056-RB +3R MB7 CDS 448302 449346 0 + 0 Parent=CG1056-RB +3R MB7 CDS 452695 452919 0 + 2 Parent=CG1056-RB +3R MB7 CDS 452981 453179 0 + 2 Parent=CG1056-RB +3R MB7 CDS 453628 454071 0 + 1 Parent=CG1056-RB +3R MB7 CDS 455851 456243 0 + 1 Parent=CG1056-RB +3R MB7 CDS 457530 457826 0 + 1 Parent=CG1056-RB +3R MB7 CDS 458460 458649 0 + 1 Parent=CG1056-RB +3R MB7 stop_codon 458647 458649 0 + 0 Parent=CG1056-RB +3R MB7 three_prime_UTR 458650 459026 0 + . Parent=CG1056-RB +3R MB7 mRNA 438597 459031 2 + . ID=CG1056-RA;Parent=CG1056;Name=CG1056-RA +3R MB7 exon 438597 439072 0 + . Parent=CG1056-RA +3R MB7 exon 448231 449346 0 + . Parent=CG1056-RA +3R MB7 exon 452695 452919 0 + . Parent=CG1056-RA +3R MB7 exon 452981 453179 0 + . Parent=CG1056-RA +3R MB7 exon 453628 454071 0 + . Parent=CG1056-RA +3R MB7 exon 455851 456243 0 + . Parent=CG1056-RA +3R MB7 exon 457530 459031 0 + . Parent=CG1056-RA +3R MB7 five_prime_UTR 438597 439072 0 + . Parent=CG1056-RA +3R MB7 five_prime_UTR 448231 448301 0 + . Parent=CG1056-RA +3R MB7 start_codon 448302 448304 0 + 0 Parent=CG1056-RA +3R MB7 CDS 448302 449346 0 + 0 Parent=CG1056-RA +3R MB7 CDS 452695 452919 0 + 2 Parent=CG1056-RA +3R MB7 CDS 452981 453179 0 + 2 Parent=CG1056-RA +3R MB7 CDS 453628 454071 0 + 1 Parent=CG1056-RA +3R MB7 CDS 455851 456243 0 + 1 Parent=CG1056-RA +3R MB7 CDS 457530 457830 0 + 1 Parent=CG1056-RA +3R MB7 stop_codon 457828 457830 0 + 0 Parent=CG1056-RA +3R MB7 three_prime_UTR 457831 459031 0 + . Parent=CG1056-RA +3R MB7 mRNA 438597 454784 1 + . ID=CG1056-RD;Parent=CG1056;Name=CG1056-RD +3R MB7 exon 438597 439072 0 + . Parent=CG1056-RD +3R MB7 exon 448231 449346 0 + . Parent=CG1056-RD +3R MB7 exon 452695 452919 0 + . Parent=CG1056-RD +3R MB7 exon 452981 453179 0 + . Parent=CG1056-RD +3R MB7 exon 453628 454784 0 + . Parent=CG1056-RD +3R MB7 five_prime_UTR 438597 439072 0 + . Parent=CG1056-RD +3R MB7 five_prime_UTR 448231 448301 0 + . Parent=CG1056-RD +3R MB7 start_codon 448302 448304 0 + 0 Parent=CG1056-RD +3R MB7 CDS 448302 449346 0 + 0 Parent=CG1056-RD +3R MB7 CDS 452695 452919 0 + 2 Parent=CG1056-RD +3R MB7 CDS 452981 453179 0 + 2 Parent=CG1056-RD +3R MB7 CDS 453628 454075 0 + 1 Parent=CG1056-RD +3R MB7 stop_codon 454073 454075 0 + 0 Parent=CG1056-RD +3R MB7 three_prime_UTR 454076 454784 0 + . Parent=CG1056-RD +3R MB7 gene 463731 467317 0 - . ID=CG9775;Name=CG9775 +3R MB7 mRNA 463731 466757 2 - . ID=CG9775-RC;Parent=CG9775;Name=CG9775-RC +3R MB7 exon 463731 464131 0 - . Parent=CG9775-RC +3R MB7 exon 464266 464561 0 - . Parent=CG9775-RC +3R MB7 exon 464740 465279 0 - . Parent=CG9775-RC +3R MB7 exon 465356 465474 0 - . Parent=CG9775-RC +3R MB7 exon 465735 466058 0 - . Parent=CG9775-RC +3R MB7 exon 466738 466757 0 - . Parent=CG9775-RC +3R MB7 three_prime_UTR 463731 464030 0 - . Parent=CG9775-RC +3R MB7 stop_codon 464031 464033 0 - 0 Parent=CG9775-RC +3R MB7 CDS 464031 464131 0 - 2 Parent=CG9775-RC +3R MB7 CDS 464266 464561 0 - 1 Parent=CG9775-RC +3R MB7 CDS 464740 465279 0 - 1 Parent=CG9775-RC +3R MB7 CDS 465356 465474 0 - 0 Parent=CG9775-RC +3R MB7 CDS 465735 465944 0 - 0 Parent=CG9775-RC +3R MB7 start_codon 465942 465944 0 - 0 Parent=CG9775-RC +3R MB7 five_prime_UTR 465945 466058 0 - . Parent=CG9775-RC +3R MB7 five_prime_UTR 466738 466757 0 - . Parent=CG9775-RC +3R MB7 mRNA 463731 467317 1 - . ID=CG9775-RA;Parent=CG9775;Name=CG9775-RA +3R MB7 exon 463731 464131 0 - . Parent=CG9775-RA +3R MB7 exon 464266 464561 0 - . Parent=CG9775-RA +3R MB7 exon 464740 465279 0 - . Parent=CG9775-RA +3R MB7 exon 465356 465474 0 - . Parent=CG9775-RA +3R MB7 exon 465735 466058 0 - . Parent=CG9775-RA +3R MB7 exon 467051 467317 0 - . Parent=CG9775-RA +3R MB7 three_prime_UTR 463731 464030 0 - . Parent=CG9775-RA +3R MB7 stop_codon 464031 464033 0 - 0 Parent=CG9775-RA +3R MB7 CDS 464031 464131 0 - 2 Parent=CG9775-RA +3R MB7 CDS 464266 464561 0 - 1 Parent=CG9775-RA +3R MB7 CDS 464740 465279 0 - 1 Parent=CG9775-RA +3R MB7 CDS 465356 465474 0 - 0 Parent=CG9775-RA +3R MB7 CDS 465735 465944 0 - 0 Parent=CG9775-RA +3R MB7 start_codon 465942 465944 0 - 0 Parent=CG9775-RA +3R MB7 five_prime_UTR 465945 466058 0 - . Parent=CG9775-RA +3R MB7 five_prime_UTR 467051 467317 0 - . Parent=CG9775-RA +3R MB7 mRNA 463732 467317 2 - . ID=CG9775.a;Parent=CG9775;Name=CG9775.a +3R MB7 exon 463732 464561 0 - . Parent=CG9775.a +3R MB7 exon 464740 465279 0 - . Parent=CG9775.a +3R MB7 exon 465356 465474 0 - . Parent=CG9775.a +3R MB7 exon 465735 466058 0 - . Parent=CG9775.a +3R MB7 exon 467051 467317 0 - . Parent=CG9775.a +3R MB7 three_prime_UTR 463732 464152 0 - . Parent=CG9775.a +3R MB7 stop_codon 464153 464155 0 - 0 Parent=CG9775.a +3R MB7 CDS 464153 464561 0 - 1 Parent=CG9775.a +3R MB7 CDS 464740 465279 0 - 1 Parent=CG9775.a +3R MB7 CDS 465356 465474 0 - 0 Parent=CG9775.a +3R MB7 CDS 465735 465944 0 - 0 Parent=CG9775.a +3R MB7 start_codon 465942 465944 0 - 0 Parent=CG9775.a +3R MB7 five_prime_UTR 465945 466058 0 - . Parent=CG9775.a +3R MB7 five_prime_UTR 467051 467317 0 - . Parent=CG9775.a +3R MB7 mRNA 463732 467317 1 - . ID=CG9775-RD;Parent=CG9775;Name=CG9775-RD +3R MB7 exon 463732 464561 0 - . Parent=CG9775-RD +3R MB7 exon 464740 466058 0 - . Parent=CG9775-RD +3R MB7 exon 467051 467317 0 - . Parent=CG9775-RD +3R MB7 three_prime_UTR 463732 464152 0 - . Parent=CG9775-RD +3R MB7 stop_codon 464153 464155 0 - 0 Parent=CG9775-RD +3R MB7 CDS 464153 464561 0 - 1 Parent=CG9775-RD +3R MB7 CDS 464740 465278 0 - 0 Parent=CG9775-RD +3R MB7 start_codon 465276 465278 0 - 0 Parent=CG9775-RD +3R MB7 five_prime_UTR 465279 466058 0 - . Parent=CG9775-RD +3R MB7 five_prime_UTR 467051 467317 0 - . Parent=CG9775-RD +3R MB7 gene 467696 469014 0 + . ID=CG1057;Name=CG1057 +3R MB7 mRNA 467696 469014 2 + . ID=CG1057-RB;Parent=CG1057;Name=CG1057-RB +3R MB7 exon 467696 467730 0 + . Parent=CG1057-RB +3R MB7 exon 468006 468150 0 + . Parent=CG1057-RB +3R MB7 exon 468291 468380 0 + . Parent=CG1057-RB +3R MB7 exon 468473 469014 0 + . Parent=CG1057-RB +3R MB7 five_prime_UTR 467696 467730 0 + . Parent=CG1057-RB +3R MB7 five_prime_UTR 468006 468122 0 + . Parent=CG1057-RB +3R MB7 start_codon 468123 468125 0 + 0 Parent=CG1057-RB +3R MB7 CDS 468123 468150 0 + 0 Parent=CG1057-RB +3R MB7 CDS 468291 468380 0 + 2 Parent=CG1057-RB +3R MB7 CDS 468473 468969 0 + 2 Parent=CG1057-RB +3R MB7 stop_codon 468967 468969 0 + 0 Parent=CG1057-RB +3R MB7 three_prime_UTR 468970 469014 0 + . Parent=CG1057-RB +3R MB7 mRNA 467696 469014 1 + . ID=CG1057-RA;Parent=CG1057;Name=CG1057-RA +3R MB7 exon 467696 468150 0 + . Parent=CG1057-RA +3R MB7 exon 468291 468380 0 + . Parent=CG1057-RA +3R MB7 exon 468473 469014 0 + . Parent=CG1057-RA +3R MB7 five_prime_UTR 467696 468122 0 + . Parent=CG1057-RA +3R MB7 start_codon 468123 468125 0 + 0 Parent=CG1057-RA +3R MB7 CDS 468123 468150 0 + 0 Parent=CG1057-RA +3R MB7 CDS 468291 468380 0 + 2 Parent=CG1057-RA +3R MB7 CDS 468473 468969 0 + 2 Parent=CG1057-RA +3R MB7 stop_codon 468967 468969 0 + 0 Parent=CG1057-RA +3R MB7 three_prime_UTR 468970 469014 0 + . Parent=CG1057-RA +3R MB7 gene 467696 470358 0 + . ID=CG18271;Name=CG18271 +3R MB7 mRNA 467696 470358 1 + . ID=CG18271-RB;Parent=CG18271;Name=CG18271-RB +3R MB7 exon 467696 467730 0 + . Parent=CG18271-RB +3R MB7 exon 469266 470358 0 + . Parent=CG18271-RB +3R MB7 five_prime_UTR 467696 467717 0 + . Parent=CG18271-RB +3R MB7 start_codon 467718 467720 0 + 0 Parent=CG18271-RB +3R MB7 CDS 467718 467730 0 + 0 Parent=CG18271-RB +3R MB7 CDS 469266 470146 0 + 2 Parent=CG18271-RB +3R MB7 stop_codon 470144 470146 0 + 0 Parent=CG18271-RB +3R MB7 three_prime_UTR 470147 470358 0 + . Parent=CG18271-RB +3R MB7 gene 470349 471316 0 - . ID=CG9771;Name=CG9771 +3R MB7 mRNA 470349 471316 1 - . ID=CG9771-RA;Parent=CG9771;Name=CG9771-RA +3R MB7 exon 470349 470798 0 - . Parent=CG9771-RA +3R MB7 exon 470903 471316 0 - . Parent=CG9771-RA +3R MB7 three_prime_UTR 470349 470505 0 - . Parent=CG9771-RA +3R MB7 stop_codon 470506 470508 0 - 0 Parent=CG9771-RA +3R MB7 CDS 470506 470798 0 - 2 Parent=CG9771-RA +3R MB7 CDS 470903 471290 0 - 0 Parent=CG9771-RA +3R MB7 start_codon 471288 471290 0 - 0 Parent=CG9771-RA +3R MB7 five_prime_UTR 471291 471316 0 - . Parent=CG9771-RA +3R MB7 gene 471653 474613 0 + . ID=CG1058;Name=CG1058 +3R MB7 mRNA 471653 474613 1 + . ID=CG1058-RA;Parent=CG1058;Name=CG1058-RA +3R MB7 exon 471653 472052 0 + . Parent=CG1058-RA +3R MB7 exon 472298 472400 0 + . Parent=CG1058-RA +3R MB7 exon 472468 473042 0 + . Parent=CG1058-RA +3R MB7 exon 473117 474613 0 + . Parent=CG1058-RA +3R MB7 five_prime_UTR 471653 471785 0 + . Parent=CG1058-RA +3R MB7 start_codon 471786 471788 0 + 0 Parent=CG1058-RA +3R MB7 CDS 471786 472052 0 + 0 Parent=CG1058-RA +3R MB7 CDS 472298 472400 0 + 0 Parent=CG1058-RA +3R MB7 CDS 472468 473042 0 + 2 Parent=CG1058-RA +3R MB7 CDS 473117 473860 0 + 0 Parent=CG1058-RA +3R MB7 stop_codon 473858 473860 0 + 0 Parent=CG1058-RA +3R MB7 three_prime_UTR 473861 474613 0 + . Parent=CG1058-RA +3R MB7 gene 474945 480360 0 + . ID=CG1059;Name=CG1059 +3R MB7 mRNA 474945 480360 1 + . ID=CG1059-RA;Parent=CG1059;Name=CG1059-RA +3R MB7 exon 474945 475489 0 + . Parent=CG1059-RA +3R MB7 exon 476307 476456 0 + . Parent=CG1059-RA +3R MB7 exon 476521 477615 0 + . Parent=CG1059-RA +3R MB7 exon 477705 479058 0 + . Parent=CG1059-RA +3R MB7 exon 479174 480360 0 + . Parent=CG1059-RA +3R MB7 five_prime_UTR 474945 475408 0 + . Parent=CG1059-RA +3R MB7 start_codon 475409 475411 0 + 0 Parent=CG1059-RA +3R MB7 CDS 475409 475489 0 + 0 Parent=CG1059-RA +3R MB7 CDS 476307 476456 0 + 0 Parent=CG1059-RA +3R MB7 CDS 476521 477615 0 + 0 Parent=CG1059-RA +3R MB7 CDS 477705 479058 0 + 0 Parent=CG1059-RA +3R MB7 CDS 479174 479811 0 + 2 Parent=CG1059-RA +3R MB7 stop_codon 479809 479811 0 + 0 Parent=CG1059-RA +3R MB7 three_prime_UTR 479812 480360 0 + . Parent=CG1059-RA +3R MB7 gene 480550 483707 0 + . ID=CG12001;Name=CG12001 +3R MB7 mRNA 480550 483707 1 + . ID=CG12001-RA;Parent=CG12001;Name=CG12001-RA +3R MB7 exon 480550 480801 0 + . Parent=CG12001-RA +3R MB7 exon 481240 482377 0 + . Parent=CG12001-RA +3R MB7 exon 482625 482931 0 + . Parent=CG12001-RA +3R MB7 exon 483303 483707 0 + . Parent=CG12001-RA +3R MB7 five_prime_UTR 480550 480801 0 + . Parent=CG12001-RA +3R MB7 five_prime_UTR 481240 481254 0 + . Parent=CG12001-RA +3R MB7 start_codon 481255 481257 0 + 0 Parent=CG12001-RA +3R MB7 CDS 481255 482377 0 + 0 Parent=CG12001-RA +3R MB7 CDS 482625 482931 0 + 2 Parent=CG12001-RA +3R MB7 CDS 483303 483534 0 + 1 Parent=CG12001-RA +3R MB7 stop_codon 483532 483534 0 + 0 Parent=CG12001-RA +3R MB7 three_prime_UTR 483535 483707 0 + . Parent=CG12001-RA +3R MB7 gene 485305 530979 0 + . ID=CG31531;Name=CG31531 +3R MB7 mRNA 485305 530979 2 + . ID=CG31531-RC;Parent=CG31531;Name=CG31531-RC +3R MB7 exon 485305 485615 0 + . Parent=CG31531-RC +3R MB7 exon 485961 486121 0 + . Parent=CG31531-RC +3R MB7 exon 496519 496572 0 + . Parent=CG31531-RC +3R MB7 exon 506501 506559 0 + . Parent=CG31531-RC +3R MB7 exon 522913 523264 0 + . Parent=CG31531-RC +3R MB7 exon 523771 523977 0 + . Parent=CG31531-RC +3R MB7 exon 525439 525581 0 + . Parent=CG31531-RC +3R MB7 exon 525893 526049 0 + . Parent=CG31531-RC +3R MB7 exon 526880 530979 0 + . Parent=CG31531-RC +3R MB7 five_prime_UTR 485305 485615 0 + . Parent=CG31531-RC +3R MB7 five_prime_UTR 485961 486121 0 + . Parent=CG31531-RC +3R MB7 five_prime_UTR 496519 496572 0 + . Parent=CG31531-RC +3R MB7 five_prime_UTR 506501 506559 0 + . Parent=CG31531-RC +3R MB7 five_prime_UTR 522913 523153 0 + . Parent=CG31531-RC +3R MB7 start_codon 523154 523156 0 + 0 Parent=CG31531-RC +3R MB7 CDS 523154 523264 0 + 0 Parent=CG31531-RC +3R MB7 CDS 523771 523977 0 + 0 Parent=CG31531-RC +3R MB7 CDS 525439 525581 0 + 0 Parent=CG31531-RC +3R MB7 CDS 525893 526049 0 + 1 Parent=CG31531-RC +3R MB7 CDS 526880 530380 0 + 0 Parent=CG31531-RC +3R MB7 stop_codon 530378 530380 0 + 0 Parent=CG31531-RC +3R MB7 three_prime_UTR 530381 530979 0 + . Parent=CG31531-RC +3R MB7 mRNA 485305 530979 2 + . ID=CG31531-RA;Parent=CG31531;Name=CG31531-RA +3R MB7 exon 485305 485398 0 + . Parent=CG31531-RA +3R MB7 exon 485961 486121 0 + . Parent=CG31531-RA +3R MB7 exon 496519 496572 0 + . Parent=CG31531-RA +3R MB7 exon 506501 506559 0 + . Parent=CG31531-RA +3R MB7 exon 522913 523264 0 + . Parent=CG31531-RA +3R MB7 exon 523771 523977 0 + . Parent=CG31531-RA +3R MB7 exon 525439 525581 0 + . Parent=CG31531-RA +3R MB7 exon 525893 526049 0 + . Parent=CG31531-RA +3R MB7 exon 526880 530979 0 + . Parent=CG31531-RA +3R MB7 five_prime_UTR 485305 485398 0 + . Parent=CG31531-RA +3R MB7 five_prime_UTR 485961 486121 0 + . Parent=CG31531-RA +3R MB7 five_prime_UTR 496519 496572 0 + . Parent=CG31531-RA +3R MB7 five_prime_UTR 506501 506559 0 + . Parent=CG31531-RA +3R MB7 five_prime_UTR 522913 523153 0 + . Parent=CG31531-RA +3R MB7 start_codon 523154 523156 0 + 0 Parent=CG31531-RA +3R MB7 CDS 523154 523264 0 + 0 Parent=CG31531-RA +3R MB7 CDS 523771 523977 0 + 0 Parent=CG31531-RA +3R MB7 CDS 525439 525581 0 + 0 Parent=CG31531-RA +3R MB7 CDS 525893 526049 0 + 1 Parent=CG31531-RA +3R MB7 CDS 526880 530380 0 + 0 Parent=CG31531-RA +3R MB7 stop_codon 530378 530380 0 + 0 Parent=CG31531-RA +3R MB7 three_prime_UTR 530381 530979 0 + . Parent=CG31531-RA +3R MB7 mRNA 485305 530979 2 + . ID=CG31531.a;Parent=CG31531;Name=CG31531.a +3R MB7 exon 485305 485398 0 + . Parent=CG31531.a +3R MB7 exon 485958 486121 0 + . Parent=CG31531.a +3R MB7 exon 496519 496572 0 + . Parent=CG31531.a +3R MB7 exon 506501 506559 0 + . Parent=CG31531.a +3R MB7 exon 522913 523264 0 + . Parent=CG31531.a +3R MB7 exon 523771 523977 0 + . Parent=CG31531.a +3R MB7 exon 525439 525581 0 + . Parent=CG31531.a +3R MB7 exon 525893 526049 0 + . Parent=CG31531.a +3R MB7 exon 526880 530979 0 + . Parent=CG31531.a +3R MB7 five_prime_UTR 485305 485398 0 + . Parent=CG31531.a +3R MB7 five_prime_UTR 485958 486121 0 + . Parent=CG31531.a +3R MB7 five_prime_UTR 496519 496572 0 + . Parent=CG31531.a +3R MB7 five_prime_UTR 506501 506559 0 + . Parent=CG31531.a +3R MB7 five_prime_UTR 522913 523153 0 + . Parent=CG31531.a +3R MB7 start_codon 523154 523156 0 + 0 Parent=CG31531.a +3R MB7 CDS 523154 523264 0 + 0 Parent=CG31531.a +3R MB7 CDS 523771 523977 0 + 0 Parent=CG31531.a +3R MB7 CDS 525439 525581 0 + 0 Parent=CG31531.a +3R MB7 CDS 525893 526049 0 + 1 Parent=CG31531.a +3R MB7 CDS 526880 530380 0 + 0 Parent=CG31531.a +3R MB7 stop_codon 530378 530380 0 + 0 Parent=CG31531.a +3R MB7 three_prime_UTR 530381 530979 0 + . Parent=CG31531.a +3R MB7 mRNA 485323 530979 1 + . ID=CG31531-RB;Parent=CG31531;Name=CG31531-RB +3R MB7 exon 485323 486121 0 + . Parent=CG31531-RB +3R MB7 exon 496519 496572 0 + . Parent=CG31531-RB +3R MB7 exon 506501 506559 0 + . Parent=CG31531-RB +3R MB7 exon 522913 523264 0 + . Parent=CG31531-RB +3R MB7 exon 523771 523977 0 + . Parent=CG31531-RB +3R MB7 exon 525439 525581 0 + . Parent=CG31531-RB +3R MB7 exon 525893 526049 0 + . Parent=CG31531-RB +3R MB7 exon 526880 530979 0 + . Parent=CG31531-RB +3R MB7 five_prime_UTR 485323 486121 0 + . Parent=CG31531-RB +3R MB7 five_prime_UTR 496519 496572 0 + . Parent=CG31531-RB +3R MB7 five_prime_UTR 506501 506559 0 + . Parent=CG31531-RB +3R MB7 five_prime_UTR 522913 523153 0 + . Parent=CG31531-RB +3R MB7 start_codon 523154 523156 0 + 0 Parent=CG31531-RB +3R MB7 CDS 523154 523264 0 + 0 Parent=CG31531-RB +3R MB7 CDS 523771 523977 0 + 0 Parent=CG31531-RB +3R MB7 CDS 525439 525581 0 + 0 Parent=CG31531-RB +3R MB7 CDS 525893 526049 0 + 1 Parent=CG31531-RB +3R MB7 CDS 526880 530380 0 + 0 Parent=CG31531-RB +3R MB7 stop_codon 530378 530380 0 + 0 Parent=CG31531-RB +3R MB7 three_prime_UTR 530381 530979 0 + . Parent=CG31531-RB +3R MB7 gene 531458 537915 0 + . ID=CG31534;Name=CG31534 +3R MB7 mRNA 531868 537915 3 + . ID=CG31534-RC;Parent=CG31534;Name=CG31534-RC +3R MB7 exon 531868 532087 0 + . Parent=CG31534-RC +3R MB7 exon 532748 533828 0 + . Parent=CG31534-RC +3R MB7 exon 534398 534771 0 + . Parent=CG31534-RC +3R MB7 exon 534882 535792 0 + . Parent=CG31534-RC +3R MB7 exon 535899 536098 0 + . Parent=CG31534-RC +3R MB7 exon 536338 536485 0 + . Parent=CG31534-RC +3R MB7 exon 536620 537915 0 + . Parent=CG31534-RC +3R MB7 five_prime_UTR 531868 532087 0 + . Parent=CG31534-RC +3R MB7 five_prime_UTR 532748 532807 0 + . Parent=CG31534-RC +3R MB7 start_codon 532808 532810 0 + 0 Parent=CG31534-RC +3R MB7 CDS 532808 533828 0 + 0 Parent=CG31534-RC +3R MB7 CDS 534398 534771 0 + 2 Parent=CG31534-RC +3R MB7 CDS 534882 535792 0 + 0 Parent=CG31534-RC +3R MB7 CDS 535899 536098 0 + 1 Parent=CG31534-RC +3R MB7 CDS 536338 536405 0 + 2 Parent=CG31534-RC +3R MB7 stop_codon 536403 536405 0 + 0 Parent=CG31534-RC +3R MB7 three_prime_UTR 536406 536485 0 + . Parent=CG31534-RC +3R MB7 three_prime_UTR 536620 537915 0 + . Parent=CG31534-RC +3R MB7 mRNA 531868 537915 1 + . ID=CG31534-RB;Parent=CG31534;Name=CG31534-RB +3R MB7 exon 531868 532087 0 + . Parent=CG31534-RB +3R MB7 exon 532748 533828 0 + . Parent=CG31534-RB +3R MB7 exon 534398 534771 0 + . Parent=CG31534-RB +3R MB7 exon 534882 535792 0 + . Parent=CG31534-RB +3R MB7 exon 535899 536074 0 + . Parent=CG31534-RB +3R MB7 exon 536338 536442 0 + . Parent=CG31534-RB +3R MB7 exon 536620 537915 0 + . Parent=CG31534-RB +3R MB7 five_prime_UTR 531868 532087 0 + . Parent=CG31534-RB +3R MB7 five_prime_UTR 532748 532807 0 + . Parent=CG31534-RB +3R MB7 start_codon 532808 532810 0 + 0 Parent=CG31534-RB +3R MB7 CDS 532808 533828 0 + 0 Parent=CG31534-RB +3R MB7 CDS 534398 534771 0 + 2 Parent=CG31534-RB +3R MB7 CDS 534882 535792 0 + 0 Parent=CG31534-RB +3R MB7 CDS 535899 536074 0 + 1 Parent=CG31534-RB +3R MB7 CDS 536338 536405 0 + 2 Parent=CG31534-RB +3R MB7 stop_codon 536403 536405 0 + 0 Parent=CG31534-RB +3R MB7 three_prime_UTR 536406 536442 0 + . Parent=CG31534-RB +3R MB7 three_prime_UTR 536620 537915 0 + . Parent=CG31534-RB +3R MB7 mRNA 531868 537915 3 + . ID=CG31534-RA;Parent=CG31534;Name=CG31534-RA +3R MB7 exon 531868 532087 0 + . Parent=CG31534-RA +3R MB7 exon 532748 533828 0 + . Parent=CG31534-RA +3R MB7 exon 534398 534771 0 + . Parent=CG31534-RA +3R MB7 exon 534882 535792 0 + . Parent=CG31534-RA +3R MB7 exon 535899 536074 0 + . Parent=CG31534-RA +3R MB7 exon 536620 537915 0 + . Parent=CG31534-RA +3R MB7 five_prime_UTR 531868 532087 0 + . Parent=CG31534-RA +3R MB7 five_prime_UTR 532748 532807 0 + . Parent=CG31534-RA +3R MB7 start_codon 532808 532810 0 + 0 Parent=CG31534-RA +3R MB7 CDS 532808 533828 0 + 0 Parent=CG31534-RA +3R MB7 CDS 534398 534771 0 + 2 Parent=CG31534-RA +3R MB7 CDS 534882 535792 0 + 0 Parent=CG31534-RA +3R MB7 CDS 535899 536074 0 + 1 Parent=CG31534-RA +3R MB7 CDS 536620 536807 0 + 2 Parent=CG31534-RA +3R MB7 stop_codon 536805 536807 0 + 0 Parent=CG31534-RA +3R MB7 three_prime_UTR 536808 537915 0 + . Parent=CG31534-RA +3R MB7 gene 538609 540025 0 - . ID=CG9769;Name=CG9769 +3R MB7 mRNA 538609 539918 31 - . ID=CG9769-RA.3d;Parent=CG9769;Name=CG9769-RA.3d +3R MB7 exon 538609 539918 0 - . Parent=CG9769-RA.3d +3R MB7 three_prime_UTR 538609 538964 0 - . Parent=CG9769-RA.3d +3R MB7 stop_codon 538965 538967 0 - 0 Parent=CG9769-RA.3d +3R MB7 CDS 538965 539807 0 - 0 Parent=CG9769-RA.3d +3R MB7 start_codon 539805 539807 0 - 0 Parent=CG9769-RA.3d +3R MB7 five_prime_UTR 539808 539918 0 - . Parent=CG9769-RA.3d +3R MB7 mRNA 538609 540025 34 - . ID=CG9769.a;Parent=CG9769;Name=CG9769.a +3R MB7 exon 538609 540025 0 - . Parent=CG9769.a +3R MB7 three_prime_UTR 538609 538964 0 - . Parent=CG9769.a +3R MB7 stop_codon 538965 538967 0 - 0 Parent=CG9769.a +3R MB7 CDS 538965 539807 0 - 0 Parent=CG9769.a +3R MB7 start_codon 539805 539807 0 - 0 Parent=CG9769.a +3R MB7 five_prime_UTR 539808 540025 0 - . Parent=CG9769.a +3R MB7 gene 545519 557597 0 - . ID=CG9761;Name=CG9761 +3R MB7 mRNA 545519 557597 1 - . ID=CG9761-RA;Parent=CG9761;Name=CG9761-RA +3R MB7 exon 545519 545826 0 - . Parent=CG9761-RA +3R MB7 exon 545946 546132 0 - . Parent=CG9761-RA +3R MB7 exon 546187 546437 0 - . Parent=CG9761-RA +3R MB7 exon 546703 547112 0 - . Parent=CG9761-RA +3R MB7 exon 548496 548872 0 - . Parent=CG9761-RA +3R MB7 exon 548926 549102 0 - . Parent=CG9761-RA +3R MB7 exon 549237 549451 0 - . Parent=CG9761-RA +3R MB7 exon 549518 550023 0 - . Parent=CG9761-RA +3R MB7 exon 557268 557597 0 - . Parent=CG9761-RA +3R MB7 three_prime_UTR 545519 545674 0 - . Parent=CG9761-RA +3R MB7 stop_codon 545675 545677 0 - 0 Parent=CG9761-RA +3R MB7 CDS 545675 545826 0 - 2 Parent=CG9761-RA +3R MB7 CDS 545946 546132 0 - 0 Parent=CG9761-RA +3R MB7 CDS 546187 546437 0 - 2 Parent=CG9761-RA +3R MB7 CDS 546703 547112 0 - 1 Parent=CG9761-RA +3R MB7 CDS 548496 548872 0 - 0 Parent=CG9761-RA +3R MB7 CDS 548926 549102 0 - 0 Parent=CG9761-RA +3R MB7 CDS 549237 549451 0 - 2 Parent=CG9761-RA +3R MB7 CDS 549518 550023 0 - 1 Parent=CG9761-RA +3R MB7 CDS 557268 557284 0 - 0 Parent=CG9761-RA +3R MB7 start_codon 557282 557284 0 - 0 Parent=CG9761-RA +3R MB7 five_prime_UTR 557285 557597 0 - . Parent=CG9761-RA +3R MB7 gene 560132 574777 0 - . ID=CG9765;Name=CG9765 +3R MB7 mRNA 560136 574777 1 - . ID=CG9765-RA;Parent=CG9765;Name=CG9765-RA +3R MB7 exon 560136 561068 0 - . Parent=CG9765-RA +3R MB7 exon 561130 561279 0 - . Parent=CG9765-RA +3R MB7 exon 561364 561525 0 - . Parent=CG9765-RA +3R MB7 exon 562745 562849 0 - . Parent=CG9765-RA +3R MB7 exon 562903 562974 0 - . Parent=CG9765-RA +3R MB7 exon 563036 563097 0 - . Parent=CG9765-RA +3R MB7 exon 563195 563502 0 - . Parent=CG9765-RA +3R MB7 exon 567574 569904 0 - . Parent=CG9765-RA +3R MB7 exon 570186 570387 0 - . Parent=CG9765-RA +3R MB7 exon 574513 574777 0 - . Parent=CG9765-RA +3R MB7 three_prime_UTR 560136 560872 0 - . Parent=CG9765-RA +3R MB7 stop_codon 560873 560875 0 - 0 Parent=CG9765-RA +3R MB7 CDS 560873 561068 0 - 1 Parent=CG9765-RA +3R MB7 CDS 561130 561279 0 - 1 Parent=CG9765-RA +3R MB7 CDS 561364 561525 0 - 1 Parent=CG9765-RA +3R MB7 CDS 562745 562849 0 - 1 Parent=CG9765-RA +3R MB7 CDS 562903 562974 0 - 1 Parent=CG9765-RA +3R MB7 CDS 563036 563097 0 - 0 Parent=CG9765-RA +3R MB7 CDS 563195 563502 0 - 2 Parent=CG9765-RA +3R MB7 CDS 567574 569904 0 - 2 Parent=CG9765-RA +3R MB7 CDS 570186 570387 0 - 0 Parent=CG9765-RA +3R MB7 CDS 574513 574605 0 - 0 Parent=CG9765-RA +3R MB7 start_codon 574603 574605 0 - 0 Parent=CG9765-RA +3R MB7 five_prime_UTR 574606 574777 0 - . Parent=CG9765-RA +3R MB7 mRNA 560132 572136 3 - . ID=CG9765-RD;Parent=CG9765;Name=CG9765-RD +3R MB7 exon 560132 561068 0 - . Parent=CG9765-RD +3R MB7 exon 561130 561279 0 - . Parent=CG9765-RD +3R MB7 exon 561364 561525 0 - . Parent=CG9765-RD +3R MB7 exon 562745 562849 0 - . Parent=CG9765-RD +3R MB7 exon 562903 562974 0 - . Parent=CG9765-RD +3R MB7 exon 563036 563100 0 - . Parent=CG9765-RD +3R MB7 exon 563195 563460 0 - . Parent=CG9765-RD +3R MB7 exon 567574 569904 0 - . Parent=CG9765-RD +3R MB7 exon 570186 570387 0 - . Parent=CG9765-RD +3R MB7 exon 571564 572136 0 - . Parent=CG9765-RD +3R MB7 three_prime_UTR 560132 560872 0 - . Parent=CG9765-RD +3R MB7 stop_codon 560873 560875 0 - 0 Parent=CG9765-RD +3R MB7 CDS 560873 561068 0 - 1 Parent=CG9765-RD +3R MB7 CDS 561130 561279 0 - 1 Parent=CG9765-RD +3R MB7 CDS 561364 561525 0 - 1 Parent=CG9765-RD +3R MB7 CDS 562745 562849 0 - 1 Parent=CG9765-RD +3R MB7 CDS 562903 562974 0 - 1 Parent=CG9765-RD +3R MB7 CDS 563036 563100 0 - 0 Parent=CG9765-RD +3R MB7 CDS 563195 563460 0 - 2 Parent=CG9765-RD +3R MB7 CDS 567574 569904 0 - 2 Parent=CG9765-RD +3R MB7 CDS 570186 570387 0 - 0 Parent=CG9765-RD +3R MB7 CDS 571564 571896 0 - 0 Parent=CG9765-RD +3R MB7 start_codon 571894 571896 0 - 0 Parent=CG9765-RD +3R MB7 five_prime_UTR 571897 572136 0 - . Parent=CG9765-RD +3R MB7 mRNA 560132 572136 1 - . ID=CG9765-RC;Parent=CG9765;Name=CG9765-RC +3R MB7 exon 560132 561068 0 - . Parent=CG9765-RC +3R MB7 exon 561130 561279 0 - . Parent=CG9765-RC +3R MB7 exon 561364 561525 0 - . Parent=CG9765-RC +3R MB7 exon 562745 562849 0 - . Parent=CG9765-RC +3R MB7 exon 562903 562974 0 - . Parent=CG9765-RC +3R MB7 exon 563036 563100 0 - . Parent=CG9765-RC +3R MB7 exon 563195 563460 0 - . Parent=CG9765-RC +3R MB7 exon 567574 569904 0 - . Parent=CG9765-RC +3R MB7 exon 570186 570387 0 - . Parent=CG9765-RC +3R MB7 exon 571519 572136 0 - . Parent=CG9765-RC +3R MB7 three_prime_UTR 560132 560872 0 - . Parent=CG9765-RC +3R MB7 stop_codon 560873 560875 0 - 0 Parent=CG9765-RC +3R MB7 CDS 560873 561068 0 - 1 Parent=CG9765-RC +3R MB7 CDS 561130 561279 0 - 1 Parent=CG9765-RC +3R MB7 CDS 561364 561525 0 - 1 Parent=CG9765-RC +3R MB7 CDS 562745 562849 0 - 1 Parent=CG9765-RC +3R MB7 CDS 562903 562974 0 - 1 Parent=CG9765-RC +3R MB7 CDS 563036 563100 0 - 0 Parent=CG9765-RC +3R MB7 CDS 563195 563460 0 - 2 Parent=CG9765-RC +3R MB7 CDS 567574 569904 0 - 2 Parent=CG9765-RC +3R MB7 CDS 570186 570387 0 - 0 Parent=CG9765-RC +3R MB7 CDS 571519 571896 0 - 0 Parent=CG9765-RC +3R MB7 start_codon 571894 571896 0 - 0 Parent=CG9765-RC +3R MB7 five_prime_UTR 571897 572136 0 - . Parent=CG9765-RC +3R MB7 mRNA 560132 564709 2 - . ID=CG9765.a;Parent=CG9765;Name=CG9765.a +3R MB7 exon 560132 561068 0 - . Parent=CG9765.a +3R MB7 exon 561130 561279 0 - . Parent=CG9765.a +3R MB7 exon 561364 561525 0 - . Parent=CG9765.a +3R MB7 exon 562745 562849 0 - . Parent=CG9765.a +3R MB7 exon 562903 562974 0 - . Parent=CG9765.a +3R MB7 exon 563036 563100 0 - . Parent=CG9765.a +3R MB7 exon 563195 563502 0 - . Parent=CG9765.a +3R MB7 exon 563787 563903 0 - . Parent=CG9765.a +3R MB7 exon 564606 564709 0 - . Parent=CG9765.a +3R MB7 three_prime_UTR 560132 560872 0 - . Parent=CG9765.a +3R MB7 stop_codon 560873 560875 0 - 0 Parent=CG9765.a +3R MB7 CDS 560873 561068 0 - 1 Parent=CG9765.a +3R MB7 CDS 561130 561279 0 - 1 Parent=CG9765.a +3R MB7 CDS 561364 561525 0 - 1 Parent=CG9765.a +3R MB7 CDS 562745 562849 0 - 1 Parent=CG9765.a +3R MB7 CDS 562903 562974 0 - 1 Parent=CG9765.a +3R MB7 CDS 563036 563088 0 - 0 Parent=CG9765.a +3R MB7 start_codon 563086 563088 0 - 0 Parent=CG9765.a +3R MB7 five_prime_UTR 563089 563100 0 - . Parent=CG9765.a +3R MB7 five_prime_UTR 563195 563502 0 - . Parent=CG9765.a +3R MB7 five_prime_UTR 563787 563903 0 - . Parent=CG9765.a +3R MB7 five_prime_UTR 564606 564709 0 - . Parent=CG9765.a +3R MB7 mRNA 560132 565269 2 - . ID=CG9765.b;Parent=CG9765;Name=CG9765.b +3R MB7 exon 560132 561068 0 - . Parent=CG9765.b +3R MB7 exon 561130 561279 0 - . Parent=CG9765.b +3R MB7 exon 561364 561525 0 - . Parent=CG9765.b +3R MB7 exon 562745 562849 0 - . Parent=CG9765.b +3R MB7 exon 562903 562974 0 - . Parent=CG9765.b +3R MB7 exon 563036 563100 0 - . Parent=CG9765.b +3R MB7 exon 563195 563484 0 - . Parent=CG9765.b +3R MB7 exon 565233 565269 0 - . Parent=CG9765.b +3R MB7 three_prime_UTR 560132 560872 0 - . Parent=CG9765.b +3R MB7 stop_codon 560873 560875 0 - 0 Parent=CG9765.b +3R MB7 CDS 560873 561068 0 - 1 Parent=CG9765.b +3R MB7 CDS 561130 561279 0 - 1 Parent=CG9765.b +3R MB7 CDS 561364 561525 0 - 1 Parent=CG9765.b +3R MB7 CDS 562745 562849 0 - 1 Parent=CG9765.b +3R MB7 CDS 562903 562974 0 - 1 Parent=CG9765.b +3R MB7 CDS 563036 563088 0 - 0 Parent=CG9765.b +3R MB7 start_codon 563086 563088 0 - 0 Parent=CG9765.b +3R MB7 five_prime_UTR 563089 563100 0 - . Parent=CG9765.b +3R MB7 five_prime_UTR 563195 563484 0 - . Parent=CG9765.b +3R MB7 five_prime_UTR 565233 565269 0 - . Parent=CG9765.b +3R MB7 mRNA 560132 565354 2 - . ID=CG9765.c;Parent=CG9765;Name=CG9765.c +3R MB7 exon 560132 561068 0 - . Parent=CG9765.c +3R MB7 exon 561130 561279 0 - . Parent=CG9765.c +3R MB7 exon 561364 561525 0 - . Parent=CG9765.c +3R MB7 exon 562745 562849 0 - . Parent=CG9765.c +3R MB7 exon 562903 562974 0 - . Parent=CG9765.c +3R MB7 exon 563036 563100 0 - . Parent=CG9765.c +3R MB7 exon 563195 563460 0 - . Parent=CG9765.c +3R MB7 exon 565294 565354 0 - . Parent=CG9765.c +3R MB7 three_prime_UTR 560132 560872 0 - . Parent=CG9765.c +3R MB7 stop_codon 560873 560875 0 - 0 Parent=CG9765.c +3R MB7 CDS 560873 561068 0 - 1 Parent=CG9765.c +3R MB7 CDS 561130 561279 0 - 1 Parent=CG9765.c +3R MB7 CDS 561364 561525 0 - 1 Parent=CG9765.c +3R MB7 CDS 562745 562849 0 - 1 Parent=CG9765.c +3R MB7 CDS 562903 562974 0 - 1 Parent=CG9765.c +3R MB7 CDS 563036 563088 0 - 0 Parent=CG9765.c +3R MB7 start_codon 563086 563088 0 - 0 Parent=CG9765.c +3R MB7 five_prime_UTR 563089 563100 0 - . Parent=CG9765.c +3R MB7 five_prime_UTR 563195 563460 0 - . Parent=CG9765.c +3R MB7 five_prime_UTR 565294 565354 0 - . Parent=CG9765.c +3R MB7 mRNA 560132 565269 2 - . ID=CG9765-RG;Parent=CG9765;Name=CG9765-RG +3R MB7 exon 560132 561068 0 - . Parent=CG9765-RG +3R MB7 exon 561130 561279 0 - . Parent=CG9765-RG +3R MB7 exon 561364 561525 0 - . Parent=CG9765-RG +3R MB7 exon 562745 562849 0 - . Parent=CG9765-RG +3R MB7 exon 562903 562974 0 - . Parent=CG9765-RG +3R MB7 exon 563036 563100 0 - . Parent=CG9765-RG +3R MB7 exon 563195 563502 0 - . Parent=CG9765-RG +3R MB7 exon 565233 565269 0 - . Parent=CG9765-RG +3R MB7 three_prime_UTR 560132 560872 0 - . Parent=CG9765-RG +3R MB7 stop_codon 560873 560875 0 - 0 Parent=CG9765-RG +3R MB7 CDS 560873 561068 0 - 1 Parent=CG9765-RG +3R MB7 CDS 561130 561279 0 - 1 Parent=CG9765-RG +3R MB7 CDS 561364 561525 0 - 1 Parent=CG9765-RG +3R MB7 CDS 562745 562849 0 - 1 Parent=CG9765-RG +3R MB7 CDS 562903 562974 0 - 1 Parent=CG9765-RG +3R MB7 CDS 563036 563088 0 - 0 Parent=CG9765-RG +3R MB7 start_codon 563086 563088 0 - 0 Parent=CG9765-RG +3R MB7 five_prime_UTR 563089 563100 0 - . Parent=CG9765-RG +3R MB7 five_prime_UTR 563195 563502 0 - . Parent=CG9765-RG +3R MB7 five_prime_UTR 565233 565269 0 - . Parent=CG9765-RG +3R MB7 mRNA 560132 565269 2 - . ID=CG9765-RF;Parent=CG9765;Name=CG9765-RF +3R MB7 exon 560132 561068 0 - . Parent=CG9765-RF +3R MB7 exon 561130 561279 0 - . Parent=CG9765-RF +3R MB7 exon 561364 561525 0 - . Parent=CG9765-RF +3R MB7 exon 562745 562849 0 - . Parent=CG9765-RF +3R MB7 exon 562903 562974 0 - . Parent=CG9765-RF +3R MB7 exon 563036 563100 0 - . Parent=CG9765-RF +3R MB7 exon 563195 563460 0 - . Parent=CG9765-RF +3R MB7 exon 565233 565269 0 - . Parent=CG9765-RF +3R MB7 three_prime_UTR 560132 560872 0 - . Parent=CG9765-RF +3R MB7 stop_codon 560873 560875 0 - 0 Parent=CG9765-RF +3R MB7 CDS 560873 561068 0 - 1 Parent=CG9765-RF +3R MB7 CDS 561130 561279 0 - 1 Parent=CG9765-RF +3R MB7 CDS 561364 561525 0 - 1 Parent=CG9765-RF +3R MB7 CDS 562745 562849 0 - 1 Parent=CG9765-RF +3R MB7 CDS 562903 562974 0 - 1 Parent=CG9765-RF +3R MB7 CDS 563036 563088 0 - 0 Parent=CG9765-RF +3R MB7 start_codon 563086 563088 0 - 0 Parent=CG9765-RF +3R MB7 five_prime_UTR 563089 563100 0 - . Parent=CG9765-RF +3R MB7 five_prime_UTR 563195 563460 0 - . Parent=CG9765-RF +3R MB7 five_prime_UTR 565233 565269 0 - . Parent=CG9765-RF +3R MB7 gene 576129 598807 0 - . ID=CG31530;Name=CG31530 +3R MB7 mRNA 576129 598807 1 - . ID=CG31530-RA;Parent=CG31530;Name=CG31530-RA +3R MB7 exon 576129 578312 0 - . Parent=CG31530-RA +3R MB7 exon 578519 578687 0 - . Parent=CG31530-RA +3R MB7 exon 578762 578916 0 - . Parent=CG31530-RA +3R MB7 exon 583265 584133 0 - . Parent=CG31530-RA +3R MB7 exon 598655 598807 0 - . Parent=CG31530-RA +3R MB7 three_prime_UTR 576129 577330 0 - . Parent=CG31530-RA +3R MB7 stop_codon 577331 577333 0 - 0 Parent=CG31530-RA +3R MB7 CDS 577331 578312 0 - 1 Parent=CG31530-RA +3R MB7 CDS 578519 578687 0 - 2 Parent=CG31530-RA +3R MB7 CDS 578762 578916 0 - 1 Parent=CG31530-RA +3R MB7 CDS 583265 583797 0 - 0 Parent=CG31530-RA +3R MB7 start_codon 583795 583797 0 - 0 Parent=CG31530-RA +3R MB7 five_prime_UTR 583798 584133 0 - . Parent=CG31530-RA +3R MB7 five_prime_UTR 598655 598807 0 - . Parent=CG31530-RA +3R MB7 gene 601323 603213 0 + . ID=CG2503;Name=CG2503 +3R MB7 mRNA 601323 603213 1 + . ID=CG2503-RA;Parent=CG2503;Name=CG2503-RA +3R MB7 exon 601323 601501 0 + . Parent=CG2503-RA +3R MB7 exon 601560 602526 0 + . Parent=CG2503-RA +3R MB7 exon 602586 603213 0 + . Parent=CG2503-RA +3R MB7 five_prime_UTR 601323 601427 0 + . Parent=CG2503-RA +3R MB7 start_codon 601428 601430 0 + 0 Parent=CG2503-RA +3R MB7 CDS 601428 601501 0 + 0 Parent=CG2503-RA +3R MB7 CDS 601560 602526 0 + 1 Parent=CG2503-RA +3R MB7 CDS 602586 603161 0 + 0 Parent=CG2503-RA +3R MB7 stop_codon 603159 603161 0 + 0 Parent=CG2503-RA +3R MB7 three_prime_UTR 603162 603213 0 + . Parent=CG2503-RA +3R MB7 gene 603219 606053 0 - . ID=CG14655;Name=CG14655 +3R MB7 mRNA 603219 606053 1 - . ID=CG14655-RA;Parent=CG14655;Name=CG14655-RA +3R MB7 exon 603219 604061 0 - . Parent=CG14655-RA +3R MB7 exon 604232 604841 0 - . Parent=CG14655-RA +3R MB7 exon 605341 606053 0 - . Parent=CG14655-RA +3R MB7 three_prime_UTR 603219 603549 0 - . Parent=CG14655-RA +3R MB7 stop_codon 603550 603552 0 - 0 Parent=CG14655-RA +3R MB7 CDS 603550 604061 0 - 2 Parent=CG14655-RA +3R MB7 CDS 604232 604841 0 - 0 Parent=CG14655-RA +3R MB7 CDS 605341 605796 0 - 0 Parent=CG14655-RA +3R MB7 start_codon 605794 605796 0 - 0 Parent=CG14655-RA +3R MB7 five_prime_UTR 605797 606053 0 - . Parent=CG14655-RA +3R MB7 gene 606847 610444 0 - . ID=CG17387;Name=CG17387 +3R MB7 mRNA 606847 610444 1 - . ID=CG17387-RA.3d;Parent=CG17387;Name=CG17387-RA.3d +3R MB7 exon 606847 607687 0 - . Parent=CG17387-RA.3d +3R MB7 exon 608009 609817 0 - . Parent=CG17387-RA.3d +3R MB7 exon 609949 610096 0 - . Parent=CG17387-RA.3d +3R MB7 exon 610155 610444 0 - . Parent=CG17387-RA.3d +3R MB7 three_prime_UTR 606847 606992 0 - . Parent=CG17387-RA.3d +3R MB7 stop_codon 606993 606995 0 - 0 Parent=CG17387-RA.3d +3R MB7 CDS 606993 607687 0 - 2 Parent=CG17387-RA.3d +3R MB7 CDS 608009 609817 0 - 2 Parent=CG17387-RA.3d +3R MB7 CDS 609949 610096 0 - 0 Parent=CG17387-RA.3d +3R MB7 CDS 610155 610406 0 - 0 Parent=CG17387-RA.3d +3R MB7 start_codon 610404 610406 0 - 0 Parent=CG17387-RA.3d +3R MB7 five_prime_UTR 610407 610444 0 - . Parent=CG17387-RA.3d +3R MB7 gene 612767 627445 0 - . ID=CG42574;Name=CG42574 +3R MB7 mRNA 612767 627445 3 - . ID=CG42574.a;Parent=CG42574;Name=CG42574.a +3R MB7 exon 612767 614009 0 - . Parent=CG42574.a +3R MB7 exon 614096 614297 0 - . Parent=CG42574.a +3R MB7 exon 614403 614591 0 - . Parent=CG42574.a +3R MB7 exon 614655 616490 0 - . Parent=CG42574.a +3R MB7 exon 616598 617586 0 - . Parent=CG42574.a +3R MB7 exon 617680 618784 0 - . Parent=CG42574.a +3R MB7 exon 618940 620786 0 - . Parent=CG42574.a +3R MB7 exon 621459 621545 0 - . Parent=CG42574.a +3R MB7 exon 622211 622789 0 - . Parent=CG42574.a +3R MB7 exon 625414 626400 0 - . Parent=CG42574.a +3R MB7 exon 626935 627445 0 - . Parent=CG42574.a +3R MB7 three_prime_UTR 612767 613548 0 - . Parent=CG42574.a +3R MB7 stop_codon 613549 613551 0 - 0 Parent=CG42574.a +3R MB7 CDS 613549 614009 0 - 2 Parent=CG42574.a +3R MB7 CDS 614096 614297 0 - 0 Parent=CG42574.a +3R MB7 CDS 614403 614591 0 - 0 Parent=CG42574.a +3R MB7 CDS 614655 616490 0 - 0 Parent=CG42574.a +3R MB7 CDS 616598 617586 0 - 2 Parent=CG42574.a +3R MB7 CDS 617680 618784 0 - 0 Parent=CG42574.a +3R MB7 CDS 618940 620786 0 - 2 Parent=CG42574.a +3R MB7 CDS 621459 621545 0 - 2 Parent=CG42574.a +3R MB7 CDS 622211 622789 0 - 2 Parent=CG42574.a +3R MB7 CDS 625414 626400 0 - 2 Parent=CG42574.a +3R MB7 CDS 626935 627445 0 - 0 Parent=CG42574.a +3R MB7 start_codon 627443 627445 0 - 0 Parent=CG42574.a +3R MB7 mRNA 612767 627445 3 - . ID=CG42574-RA;Parent=CG42574;Name=CG42574-RA +3R MB7 exon 612767 614009 0 - . Parent=CG42574-RA +3R MB7 exon 614096 614297 0 - . Parent=CG42574-RA +3R MB7 exon 614403 614591 0 - . Parent=CG42574-RA +3R MB7 exon 614655 616490 0 - . Parent=CG42574-RA +3R MB7 exon 616598 617586 0 - . Parent=CG42574-RA +3R MB7 exon 617680 618784 0 - . Parent=CG42574-RA +3R MB7 exon 618940 620786 0 - . Parent=CG42574-RA +3R MB7 exon 621459 621545 0 - . Parent=CG42574-RA +3R MB7 exon 622211 623419 0 - . Parent=CG42574-RA +3R MB7 exon 625414 626400 0 - . Parent=CG42574-RA +3R MB7 exon 626935 627445 0 - . Parent=CG42574-RA +3R MB7 three_prime_UTR 612767 613548 0 - . Parent=CG42574-RA +3R MB7 stop_codon 613549 613551 0 - 0 Parent=CG42574-RA +3R MB7 CDS 613549 614009 0 - 2 Parent=CG42574-RA +3R MB7 CDS 614096 614297 0 - 0 Parent=CG42574-RA +3R MB7 CDS 614403 614591 0 - 0 Parent=CG42574-RA +3R MB7 CDS 614655 616490 0 - 0 Parent=CG42574-RA +3R MB7 CDS 616598 617586 0 - 2 Parent=CG42574-RA +3R MB7 CDS 617680 618784 0 - 0 Parent=CG42574-RA +3R MB7 CDS 618940 620786 0 - 2 Parent=CG42574-RA +3R MB7 CDS 621459 621545 0 - 2 Parent=CG42574-RA +3R MB7 CDS 622211 623419 0 - 2 Parent=CG42574-RA +3R MB7 CDS 625414 626400 0 - 2 Parent=CG42574-RA +3R MB7 CDS 626935 627445 0 - 0 Parent=CG42574-RA +3R MB7 start_codon 627443 627445 0 - 0 Parent=CG42574-RA +3R MB7 mRNA 612767 627445 3 - . ID=CG42574.b;Parent=CG42574;Name=CG42574.b +3R MB7 exon 612767 614009 0 - . Parent=CG42574.b +3R MB7 exon 614096 614297 0 - . Parent=CG42574.b +3R MB7 exon 614403 614591 0 - . Parent=CG42574.b +3R MB7 exon 614655 616490 0 - . Parent=CG42574.b +3R MB7 exon 616598 617586 0 - . Parent=CG42574.b +3R MB7 exon 617680 618784 0 - . Parent=CG42574.b +3R MB7 exon 618940 620786 0 - . Parent=CG42574.b +3R MB7 exon 625414 626400 0 - . Parent=CG42574.b +3R MB7 exon 626935 627445 0 - . Parent=CG42574.b +3R MB7 three_prime_UTR 612767 613548 0 - . Parent=CG42574.b +3R MB7 stop_codon 613549 613551 0 - 0 Parent=CG42574.b +3R MB7 CDS 613549 614009 0 - 2 Parent=CG42574.b +3R MB7 CDS 614096 614297 0 - 0 Parent=CG42574.b +3R MB7 CDS 614403 614591 0 - 0 Parent=CG42574.b +3R MB7 CDS 614655 616490 0 - 0 Parent=CG42574.b +3R MB7 CDS 616598 617586 0 - 2 Parent=CG42574.b +3R MB7 CDS 617680 618784 0 - 0 Parent=CG42574.b +3R MB7 CDS 618940 620786 0 - 2 Parent=CG42574.b +3R MB7 CDS 625414 626400 0 - 2 Parent=CG42574.b +3R MB7 CDS 626935 627445 0 - 0 Parent=CG42574.b +3R MB7 start_codon 627443 627445 0 - 0 Parent=CG42574.b +3R MB7 gene 612767 620844 0 - . ID=CG17735;Name=CG17735 +3R MB7 mRNA 612767 620844 3 - . ID=CG17735-RB;Parent=CG17735;Name=CG17735-RB +3R MB7 exon 612767 614009 0 - . Parent=CG17735-RB +3R MB7 exon 614096 614297 0 - . Parent=CG17735-RB +3R MB7 exon 614403 614591 0 - . Parent=CG17735-RB +3R MB7 exon 614655 616490 0 - . Parent=CG17735-RB +3R MB7 exon 616598 617586 0 - . Parent=CG17735-RB +3R MB7 exon 617680 618784 0 - . Parent=CG17735-RB +3R MB7 exon 618940 620844 0 - . Parent=CG17735-RB +3R MB7 three_prime_UTR 612767 613548 0 - . Parent=CG17735-RB +3R MB7 stop_codon 613549 613551 0 - 0 Parent=CG17735-RB +3R MB7 CDS 613549 614009 0 - 2 Parent=CG17735-RB +3R MB7 CDS 614096 614297 0 - 0 Parent=CG17735-RB +3R MB7 CDS 614403 614591 0 - 0 Parent=CG17735-RB +3R MB7 CDS 614655 616490 0 - 0 Parent=CG17735-RB +3R MB7 CDS 616598 617586 0 - 2 Parent=CG17735-RB +3R MB7 CDS 617680 618784 0 - 0 Parent=CG17735-RB +3R MB7 CDS 618940 620844 0 - 0 Parent=CG17735-RB +3R MB7 start_codon 620842 620844 0 - 0 Parent=CG17735-RB +3R MB7 gene 622113 627445 0 - . ID=CG14656;Name=CG14656 +3R MB7 mRNA 622113 627445 3 - . ID=CG14656-RA;Parent=CG14656;Name=CG14656-RA +3R MB7 exon 622113 623419 0 - . Parent=CG14656-RA +3R MB7 exon 625414 626400 0 - . Parent=CG14656-RA +3R MB7 exon 626935 627445 0 - . Parent=CG14656-RA +3R MB7 stop_codon 622113 622115 0 - 0 Parent=CG14656-RA +3R MB7 CDS 622113 623419 0 - 2 Parent=CG14656-RA +3R MB7 CDS 625414 626400 0 - 2 Parent=CG14656-RA +3R MB7 CDS 626935 627445 0 - 0 Parent=CG14656-RA +3R MB7 start_codon 627443 627445 0 - 0 Parent=CG14656-RA +3R MB7 gene 634058 637788 0 - . ID=CG2525;Name=CG2525 +3R MB7 mRNA 634058 637788 1 - . ID=CG2525-RA;Parent=CG2525;Name=CG2525-RA +3R MB7 exon 634058 634996 0 - . Parent=CG2525-RA +3R MB7 exon 637705 637788 0 - . Parent=CG2525-RA +3R MB7 three_prime_UTR 634058 634144 0 - . Parent=CG2525-RA +3R MB7 stop_codon 634145 634147 0 - 0 Parent=CG2525-RA +3R MB7 CDS 634145 634981 0 - 0 Parent=CG2525-RA +3R MB7 start_codon 634979 634981 0 - 0 Parent=CG2525-RA +3R MB7 five_prime_UTR 634982 634996 0 - . Parent=CG2525-RA +3R MB7 five_prime_UTR 637705 637788 0 - . Parent=CG2525-RA +3R MB7 gene 639058 641751 0 + . ID=CG1129;Name=CG1129 +3R MB7 mRNA 639076 641751 1 + . ID=CG1129-RA;Parent=CG1129;Name=CG1129-RA +3R MB7 exon 639076 639101 0 + . Parent=CG1129-RA +3R MB7 exon 639241 639330 0 + . Parent=CG1129-RA +3R MB7 exon 639393 639698 0 + . Parent=CG1129-RA +3R MB7 exon 639961 640495 0 + . Parent=CG1129-RA +3R MB7 exon 641009 641751 0 + . Parent=CG1129-RA +3R MB7 five_prime_UTR 639076 639101 0 + . Parent=CG1129-RA +3R MB7 five_prime_UTR 639241 639330 0 + . Parent=CG1129-RA +3R MB7 five_prime_UTR 639393 639524 0 + . Parent=CG1129-RA +3R MB7 start_codon 639525 639527 0 + 0 Parent=CG1129-RA +3R MB7 CDS 639525 639698 0 + 0 Parent=CG1129-RA +3R MB7 CDS 639961 640495 0 + 0 Parent=CG1129-RA +3R MB7 CDS 641009 641409 0 + 2 Parent=CG1129-RA +3R MB7 stop_codon 641407 641409 0 + 0 Parent=CG1129-RA +3R MB7 three_prime_UTR 641410 641751 0 + . Parent=CG1129-RA +3R MB7 mRNA 639058 641751 1 + . ID=CG1129-RB;Parent=CG1129;Name=CG1129-RB +3R MB7 exon 639058 639330 0 + . Parent=CG1129-RB +3R MB7 exon 639393 639698 0 + . Parent=CG1129-RB +3R MB7 exon 639961 640495 0 + . Parent=CG1129-RB +3R MB7 exon 641009 641751 0 + . Parent=CG1129-RB +3R MB7 five_prime_UTR 639058 639330 0 + . Parent=CG1129-RB +3R MB7 five_prime_UTR 639393 639524 0 + . Parent=CG1129-RB +3R MB7 start_codon 639525 639527 0 + 0 Parent=CG1129-RB +3R MB7 CDS 639525 639698 0 + 0 Parent=CG1129-RB +3R MB7 CDS 639961 640495 0 + 0 Parent=CG1129-RB +3R MB7 CDS 641009 641409 0 + 2 Parent=CG1129-RB +3R MB7 stop_codon 641407 641409 0 + 0 Parent=CG1129-RB +3R MB7 three_prime_UTR 641410 641751 0 + . Parent=CG1129-RB +3R MB7 mRNA 639363 641751 3 + . ID=CG1129.a;Parent=CG1129;Name=CG1129.a +3R MB7 exon 639363 639698 0 + . Parent=CG1129.a +3R MB7 exon 639961 640495 0 + . Parent=CG1129.a +3R MB7 exon 641009 641751 0 + . Parent=CG1129.a +3R MB7 five_prime_UTR 639363 639524 0 + . Parent=CG1129.a +3R MB7 start_codon 639525 639527 0 + 0 Parent=CG1129.a +3R MB7 CDS 639525 639698 0 + 0 Parent=CG1129.a +3R MB7 CDS 639961 640495 0 + 0 Parent=CG1129.a +3R MB7 CDS 641009 641409 0 + 2 Parent=CG1129.a +3R MB7 stop_codon 641407 641409 0 + 0 Parent=CG1129.a +3R MB7 three_prime_UTR 641410 641751 0 + . Parent=CG1129.a +3R MB7 gene 642055 643498 0 + . ID=CG1126;Name=CG1126 +3R MB7 mRNA 642056 643498 1 + . ID=CG1126-RA;Parent=CG1126;Name=CG1126-RA +3R MB7 exon 642056 642150 0 + . Parent=CG1126-RA +3R MB7 exon 642209 642357 0 + . Parent=CG1126-RA +3R MB7 exon 642418 642613 0 + . Parent=CG1126-RA +3R MB7 exon 642674 642911 0 + . Parent=CG1126-RA +3R MB7 exon 642965 643498 0 + . Parent=CG1126-RA +3R MB7 start_codon 642056 642058 0 + 0 Parent=CG1126-RA +3R MB7 CDS 642056 642150 0 + 0 Parent=CG1126-RA +3R MB7 CDS 642209 642357 0 + 1 Parent=CG1126-RA +3R MB7 CDS 642418 642613 0 + 2 Parent=CG1126-RA +3R MB7 CDS 642674 642911 0 + 1 Parent=CG1126-RA +3R MB7 CDS 642965 643432 0 + 0 Parent=CG1126-RA +3R MB7 stop_codon 643430 643432 0 + 0 Parent=CG1126-RA +3R MB7 three_prime_UTR 643433 643498 0 + . Parent=CG1126-RA +3R MB7 mRNA 642055 643489 1 + . ID=CG1126.a;Parent=CG1126;Name=CG1126.a +3R MB7 exon 642055 642150 0 + . Parent=CG1126.a +3R MB7 exon 642209 642613 0 + . Parent=CG1126.a +3R MB7 exon 642674 642911 0 + . Parent=CG1126.a +3R MB7 exon 642965 643489 0 + . Parent=CG1126.a +3R MB7 five_prime_UTR 642055 642150 0 + . Parent=CG1126.a +3R MB7 five_prime_UTR 642209 642464 0 + . Parent=CG1126.a +3R MB7 start_codon 642465 642467 0 + 0 Parent=CG1126.a +3R MB7 CDS 642465 642613 0 + 0 Parent=CG1126.a +3R MB7 CDS 642674 642911 0 + 1 Parent=CG1126.a +3R MB7 CDS 642965 643432 0 + 0 Parent=CG1126.a +3R MB7 stop_codon 643430 643432 0 + 0 Parent=CG1126.a +3R MB7 three_prime_UTR 643433 643489 0 + . Parent=CG1126.a +3R MB7 gene 644020 647150 0 - . ID=CG14657;Name=CG14657 +3R MB7 mRNA 644020 647150 1 - . ID=CG14657-RB;Parent=CG14657;Name=CG14657-RB +3R MB7 exon 644020 645459 0 - . Parent=CG14657-RB +3R MB7 exon 645516 645632 0 - . Parent=CG14657-RB +3R MB7 exon 646055 647150 0 - . Parent=CG14657-RB +3R MB7 three_prime_UTR 644020 644828 0 - . Parent=CG14657-RB +3R MB7 stop_codon 644829 644831 0 - 0 Parent=CG14657-RB +3R MB7 CDS 644829 645459 0 - 1 Parent=CG14657-RB +3R MB7 CDS 645516 645632 0 - 1 Parent=CG14657-RB +3R MB7 CDS 646055 646641 0 - 0 Parent=CG14657-RB +3R MB7 start_codon 646639 646641 0 - 0 Parent=CG14657-RB +3R MB7 five_prime_UTR 646642 647150 0 - . Parent=CG14657-RB +3R MB7 gene 655633 656321 0 - . ID=CG14658;Name=CG14658 +3R MB7 mRNA 655633 656232 34 - . ID=CG14658-RA;Parent=CG14658;Name=CG14658-RA +3R MB7 exon 655633 656232 0 - . Parent=CG14658-RA +3R MB7 three_prime_UTR 655633 655785 0 - . Parent=CG14658-RA +3R MB7 stop_codon 655786 655788 0 - 0 Parent=CG14658-RA +3R MB7 CDS 655786 656187 0 - 0 Parent=CG14658-RA +3R MB7 start_codon 656185 656187 0 - 0 Parent=CG14658-RA +3R MB7 five_prime_UTR 656188 656232 0 - . Parent=CG14658-RA +3R MB7 mRNA 655633 656321 34 - . ID=CG14658.a;Parent=CG14658;Name=CG14658.a +3R MB7 exon 655633 656321 0 - . Parent=CG14658.a +3R MB7 three_prime_UTR 655633 655785 0 - . Parent=CG14658.a +3R MB7 stop_codon 655786 655788 0 - 0 Parent=CG14658.a +3R MB7 CDS 655786 656187 0 - 0 Parent=CG14658.a +3R MB7 start_codon 656185 656187 0 - 0 Parent=CG14658.a +3R MB7 five_prime_UTR 656188 656321 0 - . Parent=CG14658.a +3R MB7 gene 656571 657019 0 - . ID=CG14659;Name=CG14659 +3R MB7 mRNA 656571 657019 31 - . ID=CG14659-RA.3d;Parent=CG14659;Name=CG14659-RA.3d +3R MB7 exon 656571 657019 0 - . Parent=CG14659-RA.3d +3R MB7 three_prime_UTR 656571 656691 0 - . Parent=CG14659-RA.3d +3R MB7 stop_codon 656692 656694 0 - 0 Parent=CG14659-RA.3d +3R MB7 CDS 656692 656985 0 - 0 Parent=CG14659-RA.3d +3R MB7 start_codon 656983 656985 0 - 0 Parent=CG14659-RA.3d +3R MB7 five_prime_UTR 656986 657019 0 - . Parent=CG14659-RA.3d +3R MB7 gene 678535 695709 0 + . ID=CG1133;Name=CG1133 +3R MB7 mRNA 678535 695709 1 + . ID=CG1133-RA;Parent=CG1133;Name=CG1133-RA +3R MB7 exon 678535 679776 0 + . Parent=CG1133-RA +3R MB7 exon 693865 694034 0 + . Parent=CG1133-RA +3R MB7 exon 694175 695709 0 + . Parent=CG1133-RA +3R MB7 five_prime_UTR 678535 678827 0 + . Parent=CG1133-RA +3R MB7 start_codon 678828 678830 0 + 0 Parent=CG1133-RA +3R MB7 CDS 678828 679776 0 + 0 Parent=CG1133-RA +3R MB7 CDS 693865 694034 0 + 2 Parent=CG1133-RA +3R MB7 CDS 694175 694885 0 + 0 Parent=CG1133-RA +3R MB7 stop_codon 694883 694885 0 + 0 Parent=CG1133-RA +3R MB7 three_prime_UTR 694886 695709 0 + . Parent=CG1133-RA +3R MB7 gene 701727 704255 0 - . ID=CG14660;Name=CG14660 +3R MB7 mRNA 701727 704255 1 - . ID=CG14660-RA;Parent=CG14660;Name=CG14660-RA +3R MB7 exon 701727 702453 0 - . Parent=CG14660-RA +3R MB7 exon 702531 704147 0 - . Parent=CG14660-RA +3R MB7 exon 704199 704255 0 - . Parent=CG14660-RA +3R MB7 three_prime_UTR 701727 701811 0 - . Parent=CG14660-RA +3R MB7 stop_codon 701812 701814 0 - 0 Parent=CG14660-RA +3R MB7 CDS 701812 702453 0 - 0 Parent=CG14660-RA +3R MB7 CDS 702531 704147 0 - 0 Parent=CG14660-RA +3R MB7 start_codon 704199 704201 0 - 0 Parent=CG14660-RA +3R MB7 CDS 704199 704201 0 - 0 Parent=CG14660-RA +3R MB7 five_prime_UTR 704202 704255 0 - . Parent=CG14660-RA +3R MB7 gene 732340 735803 0 + . ID=CG1119;Name=CG1119 +3R MB7 mRNA 732340 735803 1 + . ID=CG1119-RB;Parent=CG1119;Name=CG1119-RB +3R MB7 exon 732340 732444 0 + . Parent=CG1119-RB +3R MB7 exon 732511 733841 0 + . Parent=CG1119-RB +3R MB7 exon 733904 734812 0 + . Parent=CG1119-RB +3R MB7 exon 734871 735803 0 + . Parent=CG1119-RB +3R MB7 five_prime_UTR 732340 732435 0 + . Parent=CG1119-RB +3R MB7 start_codon 732436 732438 0 + 0 Parent=CG1119-RB +3R MB7 CDS 732436 732444 0 + 0 Parent=CG1119-RB +3R MB7 CDS 732511 733841 0 + 0 Parent=CG1119-RB +3R MB7 CDS 733904 734812 0 + 1 Parent=CG1119-RB +3R MB7 CDS 734871 735648 0 + 1 Parent=CG1119-RB +3R MB7 stop_codon 735646 735648 0 + 0 Parent=CG1119-RB +3R MB7 three_prime_UTR 735649 735803 0 + . Parent=CG1119-RB +3R MB7 mRNA 732340 735803 1 + . ID=CG1119-RA;Parent=CG1119;Name=CG1119-RA +3R MB7 exon 732340 732444 0 + . Parent=CG1119-RA +3R MB7 exon 732511 733841 0 + . Parent=CG1119-RA +3R MB7 exon 733970 734812 0 + . Parent=CG1119-RA +3R MB7 exon 734871 735803 0 + . Parent=CG1119-RA +3R MB7 five_prime_UTR 732340 732435 0 + . Parent=CG1119-RA +3R MB7 start_codon 732436 732438 0 + 0 Parent=CG1119-RA +3R MB7 CDS 732436 732444 0 + 0 Parent=CG1119-RA +3R MB7 CDS 732511 733841 0 + 0 Parent=CG1119-RA +3R MB7 CDS 733970 734812 0 + 1 Parent=CG1119-RA +3R MB7 CDS 734871 735648 0 + 1 Parent=CG1119-RA +3R MB7 stop_codon 735646 735648 0 + 0 Parent=CG1119-RA +3R MB7 three_prime_UTR 735649 735803 0 + . Parent=CG1119-RA +3R MB7 gene 736278 771298 0 + . ID=CG31536;Name=CG31536 +3R MB7 mRNA 736279 771295 2 + . ID=CG31536.a;Parent=CG31536;Name=CG31536.a +3R MB7 exon 736279 736807 0 + . Parent=CG31536.a +3R MB7 exon 743119 743853 0 + . Parent=CG31536.a +3R MB7 exon 748314 748546 0 + . Parent=CG31536.a +3R MB7 exon 748669 748890 0 + . Parent=CG31536.a +3R MB7 exon 748956 749199 0 + . Parent=CG31536.a +3R MB7 exon 749254 749414 0 + . Parent=CG31536.a +3R MB7 exon 749476 749550 0 + . Parent=CG31536.a +3R MB7 exon 751268 751374 0 + . Parent=CG31536.a +3R MB7 exon 751616 751731 0 + . Parent=CG31536.a +3R MB7 exon 751798 752053 0 + . Parent=CG31536.a +3R MB7 exon 766397 767662 0 + . Parent=CG31536.a +3R MB7 exon 768024 768510 0 + . Parent=CG31536.a +3R MB7 exon 770697 771295 0 + . Parent=CG31536.a +3R MB7 five_prime_UTR 736279 736807 0 + . Parent=CG31536.a +3R MB7 five_prime_UTR 743119 743595 0 + . Parent=CG31536.a +3R MB7 start_codon 743596 743598 0 + 0 Parent=CG31536.a +3R MB7 CDS 743596 743853 0 + 0 Parent=CG31536.a +3R MB7 CDS 748314 748546 0 + 0 Parent=CG31536.a +3R MB7 CDS 748669 748890 0 + 1 Parent=CG31536.a +3R MB7 CDS 748956 749199 0 + 1 Parent=CG31536.a +3R MB7 CDS 749254 749414 0 + 0 Parent=CG31536.a +3R MB7 CDS 749476 749550 0 + 1 Parent=CG31536.a +3R MB7 CDS 751268 751374 0 + 1 Parent=CG31536.a +3R MB7 CDS 751616 751731 0 + 2 Parent=CG31536.a +3R MB7 CDS 751798 752053 0 + 0 Parent=CG31536.a +3R MB7 CDS 766397 767662 0 + 2 Parent=CG31536.a +3R MB7 CDS 768024 768510 0 + 2 Parent=CG31536.a +3R MB7 CDS 770697 770775 0 + 1 Parent=CG31536.a +3R MB7 stop_codon 770773 770775 0 + 0 Parent=CG31536.a +3R MB7 three_prime_UTR 770776 771295 0 + . Parent=CG31536.a +3R MB7 mRNA 736278 749883 1 + . ID=CG31536-RC;Parent=CG31536;Name=CG31536-RC +3R MB7 exon 736278 736807 0 + . Parent=CG31536-RC +3R MB7 exon 743119 743853 0 + . Parent=CG31536-RC +3R MB7 exon 748314 748546 0 + . Parent=CG31536-RC +3R MB7 exon 748669 748890 0 + . Parent=CG31536-RC +3R MB7 exon 748956 749199 0 + . Parent=CG31536-RC +3R MB7 exon 749254 749414 0 + . Parent=CG31536-RC +3R MB7 exon 749476 749883 0 + . Parent=CG31536-RC +3R MB7 five_prime_UTR 736278 736807 0 + . Parent=CG31536-RC +3R MB7 five_prime_UTR 743119 743595 0 + . Parent=CG31536-RC +3R MB7 start_codon 743596 743598 0 + 0 Parent=CG31536-RC +3R MB7 CDS 743596 743853 0 + 0 Parent=CG31536-RC +3R MB7 CDS 748314 748546 0 + 0 Parent=CG31536-RC +3R MB7 CDS 748669 748890 0 + 1 Parent=CG31536-RC +3R MB7 CDS 748956 749199 0 + 1 Parent=CG31536-RC +3R MB7 CDS 749254 749414 0 + 0 Parent=CG31536-RC +3R MB7 CDS 749476 749572 0 + 1 Parent=CG31536-RC +3R MB7 stop_codon 749570 749572 0 + 0 Parent=CG31536-RC +3R MB7 three_prime_UTR 749573 749883 0 + . Parent=CG31536-RC +3R MB7 gene 752643 764363 0 + . ID=CG34306;Name=CG34306 +3R MB7 mRNA 752643 764363 2 + . ID=CG34306-RA;Parent=CG34306;Name=CG34306-RA +3R MB7 exon 752643 758312 0 + . Parent=CG34306-RA +3R MB7 exon 758452 764363 0 + . Parent=CG34306-RA +3R MB7 start_codon 752643 752645 0 + 0 Parent=CG34306-RA +3R MB7 CDS 752643 758312 0 + 0 Parent=CG34306-RA +3R MB7 CDS 758452 763797 0 + 0 Parent=CG34306-RA +3R MB7 stop_codon 763795 763797 0 + 0 Parent=CG34306-RA +3R MB7 three_prime_UTR 763798 764363 0 + . Parent=CG34306-RA +3R MB7 gene 774476 778406 0 - . ID=CG2013;Name=CG2013 +3R MB7 mRNA 774476 776919 2 - . ID=CG2013.a;Parent=CG2013;Name=CG2013.a +3R MB7 exon 774476 776126 0 - . Parent=CG2013.a +3R MB7 exon 776189 776474 0 - . Parent=CG2013.a +3R MB7 exon 776833 776919 0 - . Parent=CG2013.a +3R MB7 three_prime_UTR 774476 776000 0 - . Parent=CG2013.a +3R MB7 stop_codon 776001 776003 0 - 0 Parent=CG2013.a +3R MB7 CDS 776001 776126 0 - 0 Parent=CG2013.a +3R MB7 CDS 776189 776419 0 - 0 Parent=CG2013.a +3R MB7 start_codon 776417 776419 0 - 0 Parent=CG2013.a +3R MB7 five_prime_UTR 776420 776474 0 - . Parent=CG2013.a +3R MB7 five_prime_UTR 776833 776919 0 - . Parent=CG2013.a +3R MB7 mRNA 774476 778406 1 - . ID=CG2013-RA;Parent=CG2013;Name=CG2013-RA +3R MB7 exon 774476 776126 0 - . Parent=CG2013-RA +3R MB7 exon 776189 776474 0 - . Parent=CG2013-RA +3R MB7 exon 778175 778406 0 - . Parent=CG2013-RA +3R MB7 three_prime_UTR 774476 776000 0 - . Parent=CG2013-RA +3R MB7 stop_codon 776001 776003 0 - 0 Parent=CG2013-RA +3R MB7 CDS 776001 776126 0 - 0 Parent=CG2013-RA +3R MB7 CDS 776189 776474 0 - 1 Parent=CG2013-RA +3R MB7 CDS 778175 778218 0 - 0 Parent=CG2013-RA +3R MB7 start_codon 778216 778218 0 - 0 Parent=CG2013-RA +3R MB7 five_prime_UTR 778219 778406 0 - . Parent=CG2013-RA +3R MB7 gene 779225 780974 0 - . ID=CG14661;Name=CG14661 +3R MB7 mRNA 779225 780974 1 - . ID=CG14661-RA;Parent=CG14661;Name=CG14661-RA +3R MB7 exon 779225 780000 0 - . Parent=CG14661-RA +3R MB7 exon 780058 780152 0 - . Parent=CG14661-RA +3R MB7 exon 780760 780974 0 - . Parent=CG14661-RA +3R MB7 three_prime_UTR 779225 779329 0 - . Parent=CG14661-RA +3R MB7 stop_codon 779330 779332 0 - 0 Parent=CG14661-RA +3R MB7 CDS 779330 780000 0 - 2 Parent=CG14661-RA +3R MB7 CDS 780058 780127 0 - 0 Parent=CG14661-RA +3R MB7 start_codon 780125 780127 0 - 0 Parent=CG14661-RA +3R MB7 five_prime_UTR 780128 780152 0 - . Parent=CG14661-RA +3R MB7 five_prime_UTR 780760 780974 0 - . Parent=CG14661-RA +3R MB7 gene 782717 787070 0 - . ID=CG2016;Name=CG2016 +3R MB7 mRNA 782717 787070 1 - . ID=CG2016-RB;Parent=CG2016;Name=CG2016-RB +3R MB7 exon 782717 782945 0 - . Parent=CG2016-RB +3R MB7 exon 783012 783164 0 - . Parent=CG2016-RB +3R MB7 exon 783223 783356 0 - . Parent=CG2016-RB +3R MB7 exon 785359 785480 0 - . Parent=CG2016-RB +3R MB7 exon 785626 785744 0 - . Parent=CG2016-RB +3R MB7 exon 786616 786695 0 - . Parent=CG2016-RB +3R MB7 exon 787034 787070 0 - . Parent=CG2016-RB +3R MB7 three_prime_UTR 782717 782790 0 - . Parent=CG2016-RB +3R MB7 stop_codon 782791 782793 0 - 0 Parent=CG2016-RB +3R MB7 CDS 782791 782945 0 - 2 Parent=CG2016-RB +3R MB7 CDS 783012 783164 0 - 2 Parent=CG2016-RB +3R MB7 CDS 783223 783356 0 - 1 Parent=CG2016-RB +3R MB7 CDS 785359 785480 0 - 0 Parent=CG2016-RB +3R MB7 CDS 785626 785744 0 - 2 Parent=CG2016-RB +3R MB7 CDS 786616 786682 0 - 0 Parent=CG2016-RB +3R MB7 start_codon 786680 786682 0 - 0 Parent=CG2016-RB +3R MB7 five_prime_UTR 786683 786695 0 - . Parent=CG2016-RB +3R MB7 five_prime_UTR 787034 787070 0 - . Parent=CG2016-RB +3R MB7 mRNA 782717 787070 3 - . ID=CG2016.a;Parent=CG2016;Name=CG2016.a +3R MB7 exon 782717 782945 0 - . Parent=CG2016.a +3R MB7 exon 783012 783164 0 - . Parent=CG2016.a +3R MB7 exon 783223 783356 0 - . Parent=CG2016.a +3R MB7 exon 785359 785480 0 - . Parent=CG2016.a +3R MB7 exon 785626 785744 0 - . Parent=CG2016.a +3R MB7 exon 787034 787070 0 - . Parent=CG2016.a +3R MB7 three_prime_UTR 782717 782790 0 - . Parent=CG2016.a +3R MB7 stop_codon 782791 782793 0 - 0 Parent=CG2016.a +3R MB7 CDS 782791 782945 0 - 2 Parent=CG2016.a +3R MB7 CDS 783012 783164 0 - 2 Parent=CG2016.a +3R MB7 CDS 783223 783356 0 - 1 Parent=CG2016.a +3R MB7 CDS 785359 785468 0 - 0 Parent=CG2016.a +3R MB7 start_codon 785466 785468 0 - 0 Parent=CG2016.a +3R MB7 five_prime_UTR 785469 785480 0 - . Parent=CG2016.a +3R MB7 five_prime_UTR 785626 785744 0 - . Parent=CG2016.a +3R MB7 five_prime_UTR 787034 787070 0 - . Parent=CG2016.a +3R MB7 mRNA 782717 787070 2 - . ID=CG2016.b;Parent=CG2016;Name=CG2016.b +3R MB7 exon 782717 782945 0 - . Parent=CG2016.b +3R MB7 exon 783012 783164 0 - . Parent=CG2016.b +3R MB7 exon 783223 783356 0 - . Parent=CG2016.b +3R MB7 exon 785359 785480 0 - . Parent=CG2016.b +3R MB7 exon 785626 785744 0 - . Parent=CG2016.b +3R MB7 exon 786616 787070 0 - . Parent=CG2016.b +3R MB7 three_prime_UTR 782717 782790 0 - . Parent=CG2016.b +3R MB7 stop_codon 782791 782793 0 - 0 Parent=CG2016.b +3R MB7 CDS 782791 782945 0 - 2 Parent=CG2016.b +3R MB7 CDS 783012 783164 0 - 2 Parent=CG2016.b +3R MB7 CDS 783223 783356 0 - 1 Parent=CG2016.b +3R MB7 CDS 785359 785480 0 - 0 Parent=CG2016.b +3R MB7 CDS 785626 785744 0 - 2 Parent=CG2016.b +3R MB7 CDS 786616 786682 0 - 0 Parent=CG2016.b +3R MB7 start_codon 786680 786682 0 - 0 Parent=CG2016.b +3R MB7 five_prime_UTR 786683 787070 0 - . Parent=CG2016.b +3R MB7 gene 791168 794226 0 + . ID=CG1124;Name=CG1124 +3R MB7 mRNA 791168 794226 1 + . ID=CG1124-RA;Parent=CG1124;Name=CG1124-RA +3R MB7 exon 791168 791369 0 + . Parent=CG1124-RA +3R MB7 exon 792851 792960 0 + . Parent=CG1124-RA +3R MB7 exon 793343 793757 0 + . Parent=CG1124-RA +3R MB7 exon 793820 794226 0 + . Parent=CG1124-RA +3R MB7 five_prime_UTR 791168 791305 0 + . Parent=CG1124-RA +3R MB7 start_codon 791306 791308 0 + 0 Parent=CG1124-RA +3R MB7 CDS 791306 791369 0 + 0 Parent=CG1124-RA +3R MB7 CDS 792851 792960 0 + 2 Parent=CG1124-RA +3R MB7 CDS 793343 793757 0 + 0 Parent=CG1124-RA +3R MB7 CDS 793820 793971 0 + 2 Parent=CG1124-RA +3R MB7 stop_codon 793969 793971 0 + 0 Parent=CG1124-RA +3R MB7 three_prime_UTR 793972 794226 0 + . Parent=CG1124-RA +3R MB7 gene 807721 809954 0 - . ID=CG14662;Name=CG14662 +3R MB7 mRNA 807721 809954 1 - . ID=CG14662-RA;Parent=CG14662;Name=CG14662-RA +3R MB7 exon 807721 808115 0 - . Parent=CG14662-RA +3R MB7 exon 808350 809954 0 - . Parent=CG14662-RA +3R MB7 three_prime_UTR 807721 807898 0 - . Parent=CG14662-RA +3R MB7 stop_codon 807899 807901 0 - 0 Parent=CG14662-RA +3R MB7 CDS 807899 808115 0 - 1 Parent=CG14662-RA +3R MB7 CDS 808350 809785 0 - 0 Parent=CG14662-RA +3R MB7 start_codon 809783 809785 0 - 0 Parent=CG14662-RA +3R MB7 five_prime_UTR 809786 809954 0 - . Parent=CG14662-RA +3R MB7 gene 812222 836754 0 - . ID=CG2022;Name=CG2022 +3R MB7 mRNA 812222 836754 1 - . ID=CG2022-RB;Parent=CG2022;Name=CG2022-RB +3R MB7 exon 812222 812608 0 - . Parent=CG2022-RB +3R MB7 exon 813973 814180 0 - . Parent=CG2022-RB +3R MB7 exon 814260 814487 0 - . Parent=CG2022-RB +3R MB7 exon 836675 836754 0 - . Parent=CG2022-RB +3R MB7 three_prime_UTR 812222 812386 0 - . Parent=CG2022-RB +3R MB7 stop_codon 812387 812389 0 - 0 Parent=CG2022-RB +3R MB7 CDS 812387 812608 0 - 0 Parent=CG2022-RB +3R MB7 CDS 813973 814180 0 - 1 Parent=CG2022-RB +3R MB7 CDS 814260 814411 0 - 0 Parent=CG2022-RB +3R MB7 start_codon 814409 814411 0 - 0 Parent=CG2022-RB +3R MB7 five_prime_UTR 814412 814487 0 - . Parent=CG2022-RB +3R MB7 five_prime_UTR 836675 836754 0 - . Parent=CG2022-RB +3R MB7 gene 909343 912749 0 - . ID=CG2530;Name=CG2530 +3R MB7 mRNA 909775 912749 31 - . ID=CG2530.a;Parent=CG2530;Name=CG2530.a +3R MB7 exon 909775 912749 0 - . Parent=CG2530.a +3R MB7 three_prime_UTR 909775 910094 0 - . Parent=CG2530.a +3R MB7 stop_codon 910095 910097 0 - 0 Parent=CG2530.a +3R MB7 CDS 910095 911747 0 - 0 Parent=CG2530.a +3R MB7 start_codon 911745 911747 0 - 0 Parent=CG2530.a +3R MB7 five_prime_UTR 911748 912749 0 - . Parent=CG2530.a +3R MB7 mRNA 909343 912749 34 - . ID=CG2530-RA.5d;Parent=CG2530;Name=CG2530-RA.5d +3R MB7 exon 909343 912749 0 - . Parent=CG2530-RA.5d +3R MB7 three_prime_UTR 909343 910094 0 - . Parent=CG2530-RA.5d +3R MB7 stop_codon 910095 910097 0 - 0 Parent=CG2530-RA.5d +3R MB7 CDS 910095 911747 0 - 0 Parent=CG2530-RA.5d +3R MB7 start_codon 911745 911747 0 - 0 Parent=CG2530-RA.5d +3R MB7 five_prime_UTR 911748 912749 0 - . Parent=CG2530-RA.5d +3R MB7 gene 953810 955665 0 + . ID=CG12007;Name=CG12007 +3R MB7 mRNA 953812 955661 34 + . ID=CG12007.a;Parent=CG12007;Name=CG12007.a +3R MB7 exon 953812 955661 0 + . Parent=CG12007.a +3R MB7 five_prime_UTR 953812 953889 0 + . Parent=CG12007.a +3R MB7 start_codon 953890 953892 0 + 0 Parent=CG12007.a +3R MB7 CDS 953890 955437 0 + 0 Parent=CG12007.a +3R MB7 stop_codon 955435 955437 0 + 0 Parent=CG12007.a +3R MB7 three_prime_UTR 955438 955661 0 + . Parent=CG12007.a +3R MB7 mRNA 953810 955665 34 + . ID=CG12007-RA;Parent=CG12007;Name=CG12007-RA +3R MB7 exon 953810 955665 0 + . Parent=CG12007-RA +3R MB7 five_prime_UTR 953810 953889 0 + . Parent=CG12007-RA +3R MB7 start_codon 953890 953892 0 + 0 Parent=CG12007-RA +3R MB7 CDS 953890 955437 0 + 0 Parent=CG12007-RA +3R MB7 stop_codon 955435 955437 0 + 0 Parent=CG12007-RA +3R MB7 three_prime_UTR 955438 955665 0 + . Parent=CG12007-RA +3R MB7 gene 962779 963295 0 - . ID=CG12589;Name=CG12589 +3R MB7 mRNA 962779 963295 31 - . ID=CG12589-RA.3d;Parent=CG12589;Name=CG12589-RA.3d +3R MB7 exon 962779 963295 0 - . Parent=CG12589-RA.3d +3R MB7 three_prime_UTR 962779 962908 0 - . Parent=CG12589-RA.3d +3R MB7 stop_codon 962909 962911 0 - 0 Parent=CG12589-RA.3d +3R MB7 CDS 962909 963199 0 - 0 Parent=CG12589-RA.3d +3R MB7 start_codon 963197 963199 0 - 0 Parent=CG12589-RA.3d +3R MB7 five_prime_UTR 963200 963295 0 - . Parent=CG12589-RA.3d +3R MB7 gene 976630 995849 0 + . ID=CG12591;Name=CG12591 +3R MB7 mRNA 976630 995849 1 + . ID=CG12591-RA;Parent=CG12591;Name=CG12591-RA +3R MB7 exon 976630 977008 0 + . Parent=CG12591-RA +3R MB7 exon 979245 979819 0 + . Parent=CG12591-RA +3R MB7 exon 991060 992153 0 + . Parent=CG12591-RA +3R MB7 exon 992585 992811 0 + . Parent=CG12591-RA +3R MB7 exon 992882 992987 0 + . Parent=CG12591-RA +3R MB7 exon 995170 995849 0 + . Parent=CG12591-RA +3R MB7 five_prime_UTR 976630 977008 0 + . Parent=CG12591-RA +3R MB7 five_prime_UTR 979245 979819 0 + . Parent=CG12591-RA +3R MB7 five_prime_UTR 991060 991645 0 + . Parent=CG12591-RA +3R MB7 start_codon 991646 991648 0 + 0 Parent=CG12591-RA +3R MB7 CDS 991646 992153 0 + 0 Parent=CG12591-RA +3R MB7 CDS 992585 992811 0 + 2 Parent=CG12591-RA +3R MB7 CDS 992882 992987 0 + 0 Parent=CG12591-RA +3R MB7 CDS 995170 995288 0 + 2 Parent=CG12591-RA +3R MB7 stop_codon 995286 995288 0 + 0 Parent=CG12591-RA +3R MB7 three_prime_UTR 995289 995849 0 + . Parent=CG12591-RA +3R MB7 gene 985334 986627 0 + . ID=CG12590;Name=CG12590 +3R MB7 mRNA 985334 986627 34 + . ID=CG12590-RA;Parent=CG12590;Name=CG12590-RA +3R MB7 exon 985334 986627 0 + . Parent=CG12590-RA +3R MB7 five_prime_UTR 985334 985472 0 + . Parent=CG12590-RA +3R MB7 start_codon 985473 985475 0 + 0 Parent=CG12590-RA +3R MB7 CDS 985473 986474 0 + 0 Parent=CG12590-RA +3R MB7 stop_codon 986472 986474 0 + 0 Parent=CG12590-RA +3R MB7 three_prime_UTR 986475 986627 0 + . Parent=CG12590-RA +3R MB7 gene 998392 1043147 0 - . ID=CG42312;Name=CG42312 +3R MB7 mRNA 999324 1043147 1 - . ID=CG42312-RE;Parent=CG42312;Name=CG42312-RE +3R MB7 exon 999324 999717 0 - . Parent=CG42312-RE +3R MB7 exon 999778 999899 0 - . Parent=CG42312-RE +3R MB7 exon 999987 1002012 0 - . Parent=CG42312-RE +3R MB7 exon 1003016 1003232 0 - . Parent=CG42312-RE +3R MB7 exon 1003359 1003607 0 - . Parent=CG42312-RE +3R MB7 exon 1006779 1006897 0 - . Parent=CG42312-RE +3R MB7 exon 1006958 1007205 0 - . Parent=CG42312-RE +3R MB7 exon 1007270 1007794 0 - . Parent=CG42312-RE +3R MB7 exon 1008142 1008607 0 - . Parent=CG42312-RE +3R MB7 exon 1009499 1009705 0 - . Parent=CG42312-RE +3R MB7 exon 1010001 1010245 0 - . Parent=CG42312-RE +3R MB7 exon 1010309 1010363 0 - . Parent=CG42312-RE +3R MB7 exon 1011091 1011212 0 - . Parent=CG42312-RE +3R MB7 exon 1013030 1013382 0 - . Parent=CG42312-RE +3R MB7 exon 1027367 1027448 0 - . Parent=CG42312-RE +3R MB7 exon 1027790 1028308 0 - . Parent=CG42312-RE +3R MB7 exon 1028382 1028575 0 - . Parent=CG42312-RE +3R MB7 exon 1028772 1028880 0 - . Parent=CG42312-RE +3R MB7 exon 1028946 1029156 0 - . Parent=CG42312-RE +3R MB7 exon 1042655 1043147 0 - . Parent=CG42312-RE +3R MB7 three_prime_UTR 999324 999524 0 - . Parent=CG42312-RE +3R MB7 stop_codon 999525 999527 0 - 0 Parent=CG42312-RE +3R MB7 CDS 999525 999717 0 - 1 Parent=CG42312-RE +3R MB7 CDS 999778 999899 0 - 0 Parent=CG42312-RE +3R MB7 CDS 999987 1002012 0 - 1 Parent=CG42312-RE +3R MB7 CDS 1003016 1003232 0 - 2 Parent=CG42312-RE +3R MB7 CDS 1003359 1003607 0 - 2 Parent=CG42312-RE +3R MB7 CDS 1006779 1006897 0 - 1 Parent=CG42312-RE +3R MB7 CDS 1006958 1007205 0 - 0 Parent=CG42312-RE +3R MB7 CDS 1007270 1007794 0 - 0 Parent=CG42312-RE +3R MB7 CDS 1008142 1008607 0 - 1 Parent=CG42312-RE +3R MB7 CDS 1009499 1009705 0 - 1 Parent=CG42312-RE +3R MB7 CDS 1010001 1010245 0 - 0 Parent=CG42312-RE +3R MB7 CDS 1010309 1010363 0 - 1 Parent=CG42312-RE +3R MB7 CDS 1011091 1011212 0 - 0 Parent=CG42312-RE +3R MB7 CDS 1013030 1013382 0 - 2 Parent=CG42312-RE +3R MB7 CDS 1027367 1027448 0 - 0 Parent=CG42312-RE +3R MB7 CDS 1027790 1028308 0 - 0 Parent=CG42312-RE +3R MB7 CDS 1028382 1028575 0 - 2 Parent=CG42312-RE +3R MB7 CDS 1028772 1028880 0 - 0 Parent=CG42312-RE +3R MB7 CDS 1028946 1029050 0 - 0 Parent=CG42312-RE +3R MB7 start_codon 1029048 1029050 0 - 0 Parent=CG42312-RE +3R MB7 five_prime_UTR 1029051 1029156 0 - . Parent=CG42312-RE +3R MB7 five_prime_UTR 1042655 1043147 0 - . Parent=CG42312-RE +3R MB7 mRNA 998392 1043147 1 - . ID=CG42312-RC;Parent=CG42312;Name=CG42312-RC +3R MB7 exon 998392 999717 0 - . Parent=CG42312-RC +3R MB7 exon 999778 999899 0 - . Parent=CG42312-RC +3R MB7 exon 999987 1002012 0 - . Parent=CG42312-RC +3R MB7 exon 1003016 1003232 0 - . Parent=CG42312-RC +3R MB7 exon 1003359 1003607 0 - . Parent=CG42312-RC +3R MB7 exon 1006779 1006897 0 - . Parent=CG42312-RC +3R MB7 exon 1006958 1007205 0 - . Parent=CG42312-RC +3R MB7 exon 1007270 1007794 0 - . Parent=CG42312-RC +3R MB7 exon 1008142 1008607 0 - . Parent=CG42312-RC +3R MB7 exon 1011091 1011212 0 - . Parent=CG42312-RC +3R MB7 exon 1013030 1013382 0 - . Parent=CG42312-RC +3R MB7 exon 1027367 1027448 0 - . Parent=CG42312-RC +3R MB7 exon 1027790 1028308 0 - . Parent=CG42312-RC +3R MB7 exon 1028382 1028575 0 - . Parent=CG42312-RC +3R MB7 exon 1028772 1028880 0 - . Parent=CG42312-RC +3R MB7 exon 1028946 1029156 0 - . Parent=CG42312-RC +3R MB7 exon 1042655 1043147 0 - . Parent=CG42312-RC +3R MB7 three_prime_UTR 998392 999524 0 - . Parent=CG42312-RC +3R MB7 stop_codon 999525 999527 0 - 0 Parent=CG42312-RC +3R MB7 CDS 999525 999717 0 - 1 Parent=CG42312-RC +3R MB7 CDS 999778 999899 0 - 0 Parent=CG42312-RC +3R MB7 CDS 999987 1002012 0 - 1 Parent=CG42312-RC +3R MB7 CDS 1003016 1003232 0 - 2 Parent=CG42312-RC +3R MB7 CDS 1003359 1003607 0 - 2 Parent=CG42312-RC +3R MB7 CDS 1006779 1006897 0 - 1 Parent=CG42312-RC +3R MB7 CDS 1006958 1007205 0 - 0 Parent=CG42312-RC +3R MB7 CDS 1007270 1007794 0 - 0 Parent=CG42312-RC +3R MB7 CDS 1008142 1008607 0 - 1 Parent=CG42312-RC +3R MB7 CDS 1011091 1011212 0 - 0 Parent=CG42312-RC +3R MB7 CDS 1013030 1013382 0 - 2 Parent=CG42312-RC +3R MB7 CDS 1027367 1027448 0 - 0 Parent=CG42312-RC +3R MB7 CDS 1027790 1028308 0 - 0 Parent=CG42312-RC +3R MB7 CDS 1028382 1028575 0 - 2 Parent=CG42312-RC +3R MB7 CDS 1028772 1028880 0 - 0 Parent=CG42312-RC +3R MB7 CDS 1028946 1029050 0 - 0 Parent=CG42312-RC +3R MB7 start_codon 1029048 1029050 0 - 0 Parent=CG42312-RC +3R MB7 five_prime_UTR 1029051 1029156 0 - . Parent=CG42312-RC +3R MB7 five_prime_UTR 1042655 1043147 0 - . Parent=CG42312-RC +3R MB7 gene 1043473 1045168 0 - . ID=CG12161;Name=CG12161 +3R MB7 mRNA 1043473 1045168 1 - . ID=CG12161-RA;Parent=CG12161;Name=CG12161-RA +3R MB7 exon 1043473 1044427 0 - . Parent=CG12161-RA +3R MB7 exon 1044493 1044672 0 - . Parent=CG12161-RA +3R MB7 exon 1045067 1045168 0 - . Parent=CG12161-RA +3R MB7 three_prime_UTR 1043473 1043730 0 - . Parent=CG12161-RA +3R MB7 stop_codon 1043731 1043733 0 - 0 Parent=CG12161-RA +3R MB7 CDS 1043731 1044427 0 - 1 Parent=CG12161-RA +3R MB7 CDS 1044493 1044672 0 - 1 Parent=CG12161-RA +3R MB7 CDS 1045067 1045158 0 - 0 Parent=CG12161-RA +3R MB7 start_codon 1045156 1045158 0 - 0 Parent=CG12161-RA +3R MB7 five_prime_UTR 1045159 1045168 0 - . Parent=CG12161-RA +3R MB7 gene 1045390 1047270 0 + . ID=CG1116;Name=CG1116 +3R MB7 mRNA 1045390 1047270 3 + . ID=CG1116.a;Parent=CG1116;Name=CG1116.a +3R MB7 exon 1045390 1045577 0 + . Parent=CG1116.a +3R MB7 exon 1045638 1045855 0 + . Parent=CG1116.a +3R MB7 exon 1045921 1046192 0 + . Parent=CG1116.a +3R MB7 exon 1046258 1046407 0 + . Parent=CG1116.a +3R MB7 exon 1046471 1047047 0 + . Parent=CG1116.a +3R MB7 exon 1047114 1047270 0 + . Parent=CG1116.a +3R MB7 five_prime_UTR 1045390 1045428 0 + . Parent=CG1116.a +3R MB7 start_codon 1045429 1045431 0 + 0 Parent=CG1116.a +3R MB7 CDS 1045429 1045577 0 + 0 Parent=CG1116.a +3R MB7 CDS 1045638 1045855 0 + 1 Parent=CG1116.a +3R MB7 CDS 1045921 1046192 0 + 2 Parent=CG1116.a +3R MB7 CDS 1046258 1046407 0 + 0 Parent=CG1116.a +3R MB7 CDS 1046471 1047013 0 + 0 Parent=CG1116.a +3R MB7 stop_codon 1047011 1047013 0 + 0 Parent=CG1116.a +3R MB7 three_prime_UTR 1047014 1047047 0 + . Parent=CG1116.a +3R MB7 three_prime_UTR 1047114 1047270 0 + . Parent=CG1116.a +3R MB7 mRNA 1045390 1047270 1 + . ID=CG1116-RA;Parent=CG1116;Name=CG1116-RA +3R MB7 exon 1045390 1045577 0 + . Parent=CG1116-RA +3R MB7 exon 1045641 1045855 0 + . Parent=CG1116-RA +3R MB7 exon 1045921 1046192 0 + . Parent=CG1116-RA +3R MB7 exon 1046258 1046407 0 + . Parent=CG1116-RA +3R MB7 exon 1046471 1047047 0 + . Parent=CG1116-RA +3R MB7 exon 1047114 1047270 0 + . Parent=CG1116-RA +3R MB7 five_prime_UTR 1045390 1045428 0 + . Parent=CG1116-RA +3R MB7 start_codon 1045429 1045431 0 + 0 Parent=CG1116-RA +3R MB7 CDS 1045429 1045577 0 + 0 Parent=CG1116-RA +3R MB7 CDS 1045641 1045855 0 + 1 Parent=CG1116-RA +3R MB7 CDS 1045921 1046192 0 + 2 Parent=CG1116-RA +3R MB7 CDS 1046258 1046407 0 + 0 Parent=CG1116-RA +3R MB7 CDS 1046471 1047013 0 + 0 Parent=CG1116-RA +3R MB7 stop_codon 1047011 1047013 0 + 0 Parent=CG1116-RA +3R MB7 three_prime_UTR 1047014 1047047 0 + . Parent=CG1116-RA +3R MB7 three_prime_UTR 1047114 1047270 0 + . Parent=CG1116-RA +3R MB7 mRNA 1045390 1047270 3 + . ID=CG1116-RB;Parent=CG1116;Name=CG1116-RB +3R MB7 exon 1045390 1045855 0 + . Parent=CG1116-RB +3R MB7 exon 1045921 1046192 0 + . Parent=CG1116-RB +3R MB7 exon 1046258 1046407 0 + . Parent=CG1116-RB +3R MB7 exon 1046471 1047047 0 + . Parent=CG1116-RB +3R MB7 exon 1047114 1047270 0 + . Parent=CG1116-RB +3R MB7 five_prime_UTR 1045390 1045737 0 + . Parent=CG1116-RB +3R MB7 start_codon 1045738 1045740 0 + 0 Parent=CG1116-RB +3R MB7 CDS 1045738 1045855 0 + 0 Parent=CG1116-RB +3R MB7 CDS 1045921 1046192 0 + 2 Parent=CG1116-RB +3R MB7 CDS 1046258 1046407 0 + 0 Parent=CG1116-RB +3R MB7 CDS 1046471 1047013 0 + 0 Parent=CG1116-RB +3R MB7 stop_codon 1047011 1047013 0 + 0 Parent=CG1116-RB +3R MB7 three_prime_UTR 1047014 1047047 0 + . Parent=CG1116-RB +3R MB7 three_prime_UTR 1047114 1047270 0 + . Parent=CG1116-RB +3R MB7 gene 1047347 1049197 0 - . ID=CG2604;Name=CG2604 +3R MB7 mRNA 1047359 1049197 2 - . ID=CG2604-RC;Parent=CG2604;Name=CG2604-RC +3R MB7 exon 1047359 1048868 0 - . Parent=CG2604-RC +3R MB7 exon 1048972 1049197 0 - . Parent=CG2604-RC +3R MB7 three_prime_UTR 1047359 1047560 0 - . Parent=CG2604-RC +3R MB7 stop_codon 1047561 1047563 0 - 0 Parent=CG2604-RC +3R MB7 CDS 1047561 1048853 0 - 0 Parent=CG2604-RC +3R MB7 start_codon 1048851 1048853 0 - 0 Parent=CG2604-RC +3R MB7 five_prime_UTR 1048854 1048868 0 - . Parent=CG2604-RC +3R MB7 five_prime_UTR 1048972 1049197 0 - . Parent=CG2604-RC +3R MB7 mRNA 1047347 1049197 1 - . ID=CG2604-RA;Parent=CG2604;Name=CG2604-RA +3R MB7 exon 1047347 1048910 0 - . Parent=CG2604-RA +3R MB7 exon 1048972 1049197 0 - . Parent=CG2604-RA +3R MB7 three_prime_UTR 1047347 1047560 0 - . Parent=CG2604-RA +3R MB7 stop_codon 1047561 1047563 0 - 0 Parent=CG2604-RA +3R MB7 CDS 1047561 1048853 0 - 0 Parent=CG2604-RA +3R MB7 start_codon 1048851 1048853 0 - 0 Parent=CG2604-RA +3R MB7 five_prime_UTR 1048854 1048910 0 - . Parent=CG2604-RA +3R MB7 five_prime_UTR 1048972 1049197 0 - . Parent=CG2604-RA +3R MB7 gene 1051882 1053248 0 + . ID=CG1115;Name=CG1115 +3R MB7 mRNA 1051882 1053248 1 + . ID=CG1115-RA;Parent=CG1115;Name=CG1115-RA +3R MB7 exon 1051882 1052700 0 + . Parent=CG1115-RA +3R MB7 exon 1053046 1053248 0 + . Parent=CG1115-RA +3R MB7 five_prime_UTR 1051882 1051991 0 + . Parent=CG1115-RA +3R MB7 start_codon 1051992 1051994 0 + 0 Parent=CG1115-RA +3R MB7 CDS 1051992 1052636 0 + 0 Parent=CG1115-RA +3R MB7 stop_codon 1052634 1052636 0 + 0 Parent=CG1115-RA +3R MB7 three_prime_UTR 1052637 1052700 0 + . Parent=CG1115-RA +3R MB7 three_prime_UTR 1053046 1053248 0 + . Parent=CG1115-RA +3R MB7 gene 1053010 1057940 0 - . ID=CG10229;Name=CG10229 +3R MB7 mRNA 1053010 1057940 3 - . ID=CG10229.a;Parent=CG10229;Name=CG10229.a +3R MB7 exon 1053010 1053912 0 - . Parent=CG10229.a +3R MB7 exon 1053999 1054558 0 - . Parent=CG10229.a +3R MB7 exon 1055429 1055550 0 - . Parent=CG10229.a +3R MB7 exon 1055744 1056347 0 - . Parent=CG10229.a +3R MB7 exon 1056715 1056936 0 - . Parent=CG10229.a +3R MB7 exon 1057628 1057940 0 - . Parent=CG10229.a +3R MB7 three_prime_UTR 1053010 1053713 0 - . Parent=CG10229.a +3R MB7 stop_codon 1053714 1053716 0 - 0 Parent=CG10229.a +3R MB7 CDS 1053714 1053912 0 - 1 Parent=CG10229.a +3R MB7 CDS 1053999 1054558 0 - 0 Parent=CG10229.a +3R MB7 CDS 1055429 1055550 0 - 2 Parent=CG10229.a +3R MB7 CDS 1055744 1056347 0 - 0 Parent=CG10229.a +3R MB7 CDS 1056715 1056894 0 - 0 Parent=CG10229.a +3R MB7 start_codon 1056892 1056894 0 - 0 Parent=CG10229.a +3R MB7 five_prime_UTR 1056895 1056936 0 - . Parent=CG10229.a +3R MB7 five_prime_UTR 1057628 1057940 0 - . Parent=CG10229.a +3R MB7 mRNA 1053010 1057940 3 - . ID=CG10229.b;Parent=CG10229;Name=CG10229.b +3R MB7 exon 1053010 1053912 0 - . Parent=CG10229.b +3R MB7 exon 1053999 1054558 0 - . Parent=CG10229.b +3R MB7 exon 1055429 1055550 0 - . Parent=CG10229.b +3R MB7 exon 1055744 1056347 0 - . Parent=CG10229.b +3R MB7 exon 1056715 1057035 0 - . Parent=CG10229.b +3R MB7 exon 1057779 1057940 0 - . Parent=CG10229.b +3R MB7 three_prime_UTR 1053010 1053713 0 - . Parent=CG10229.b +3R MB7 stop_codon 1053714 1053716 0 - 0 Parent=CG10229.b +3R MB7 CDS 1053714 1053912 0 - 1 Parent=CG10229.b +3R MB7 CDS 1053999 1054558 0 - 0 Parent=CG10229.b +3R MB7 CDS 1055429 1055550 0 - 2 Parent=CG10229.b +3R MB7 CDS 1055744 1056347 0 - 0 Parent=CG10229.b +3R MB7 CDS 1056715 1057035 0 - 0 Parent=CG10229.b +3R MB7 CDS 1057779 1057790 0 - 0 Parent=CG10229.b +3R MB7 start_codon 1057788 1057790 0 - 0 Parent=CG10229.b +3R MB7 five_prime_UTR 1057791 1057940 0 - . Parent=CG10229.b +3R MB7 mRNA 1053010 1057940 1 - . ID=CG10229-RA;Parent=CG10229;Name=CG10229-RA +3R MB7 exon 1053010 1053912 0 - . Parent=CG10229-RA +3R MB7 exon 1053999 1054558 0 - . Parent=CG10229-RA +3R MB7 exon 1055429 1055550 0 - . Parent=CG10229-RA +3R MB7 exon 1055744 1056347 0 - . Parent=CG10229-RA +3R MB7 exon 1056715 1056936 0 - . Parent=CG10229-RA +3R MB7 exon 1057779 1057940 0 - . Parent=CG10229-RA +3R MB7 three_prime_UTR 1053010 1053713 0 - . Parent=CG10229-RA +3R MB7 stop_codon 1053714 1053716 0 - 0 Parent=CG10229-RA +3R MB7 CDS 1053714 1053912 0 - 1 Parent=CG10229-RA +3R MB7 CDS 1053999 1054558 0 - 0 Parent=CG10229-RA +3R MB7 CDS 1055429 1055550 0 - 2 Parent=CG10229-RA +3R MB7 CDS 1055744 1056347 0 - 0 Parent=CG10229-RA +3R MB7 CDS 1056715 1056936 0 - 0 Parent=CG10229-RA +3R MB7 CDS 1057779 1057790 0 - 0 Parent=CG10229-RA +3R MB7 start_codon 1057788 1057790 0 - 0 Parent=CG10229-RA +3R MB7 five_prime_UTR 1057791 1057940 0 - . Parent=CG10229-RA +3R MB7 gene 1058268 1062011 0 + . ID=CG12005;Name=CG12005 +3R MB7 mRNA 1058268 1062011 1 + . ID=CG12005-RB;Parent=CG12005;Name=CG12005-RB +3R MB7 exon 1058268 1058448 0 + . Parent=CG12005-RB +3R MB7 exon 1058513 1058896 0 + . Parent=CG12005-RB +3R MB7 exon 1059107 1059456 0 + . Parent=CG12005-RB +3R MB7 exon 1059515 1060960 0 + . Parent=CG12005-RB +3R MB7 exon 1061028 1061450 0 + . Parent=CG12005-RB +3R MB7 exon 1061565 1062011 0 + . Parent=CG12005-RB +3R MB7 five_prime_UTR 1058268 1058363 0 + . Parent=CG12005-RB +3R MB7 start_codon 1058364 1058366 0 + 0 Parent=CG12005-RB +3R MB7 CDS 1058364 1058448 0 + 0 Parent=CG12005-RB +3R MB7 CDS 1058513 1058896 0 + 2 Parent=CG12005-RB +3R MB7 CDS 1059107 1059456 0 + 2 Parent=CG12005-RB +3R MB7 CDS 1059515 1060960 0 + 0 Parent=CG12005-RB +3R MB7 CDS 1061028 1061450 0 + 0 Parent=CG12005-RB +3R MB7 CDS 1061565 1061756 0 + 0 Parent=CG12005-RB +3R MB7 stop_codon 1061754 1061756 0 + 0 Parent=CG12005-RB +3R MB7 three_prime_UTR 1061757 1062011 0 + . Parent=CG12005-RB +3R MB7 gene 1061780 1063038 0 - . ID=CG10233;Name=CG10233 +3R MB7 mRNA 1061780 1063038 1 - . ID=CG10233-RA;Parent=CG10233;Name=CG10233-RA +3R MB7 exon 1061780 1062388 0 - . Parent=CG10233-RA +3R MB7 exon 1062595 1062895 0 - . Parent=CG10233-RA +3R MB7 exon 1062954 1063038 0 - . Parent=CG10233-RA +3R MB7 three_prime_UTR 1061780 1062120 0 - . Parent=CG10233-RA +3R MB7 stop_codon 1062121 1062123 0 - 0 Parent=CG10233-RA +3R MB7 CDS 1062121 1062388 0 - 1 Parent=CG10233-RA +3R MB7 CDS 1062595 1062895 0 - 2 Parent=CG10233-RA +3R MB7 CDS 1062954 1062981 0 - 0 Parent=CG10233-RA +3R MB7 start_codon 1062979 1062981 0 - 0 Parent=CG10233-RA +3R MB7 five_prime_UTR 1062982 1063038 0 - . Parent=CG10233-RA +3R MB7 mRNA 1062472 1063038 2 - . ID=CG10233-RB;Parent=CG10233;Name=CG10233-RB +3R MB7 exon 1062472 1062895 0 - . Parent=CG10233-RB +3R MB7 exon 1062954 1063038 0 - . Parent=CG10233-RB +3R MB7 three_prime_UTR 1062472 1062566 0 - . Parent=CG10233-RB +3R MB7 stop_codon 1062567 1062569 0 - 0 Parent=CG10233-RB +3R MB7 CDS 1062567 1062895 0 - 2 Parent=CG10233-RB +3R MB7 CDS 1062954 1062981 0 - 0 Parent=CG10233-RB +3R MB7 start_codon 1062979 1062981 0 - 0 Parent=CG10233-RB +3R MB7 five_prime_UTR 1062982 1063038 0 - . Parent=CG10233-RB +3R MB7 gene 1063223 1077468 0 - . ID=CG12163;Name=CG12163 +3R MB7 mRNA 1063223 1077468 1 - . ID=CG12163-RA;Parent=CG12163;Name=CG12163-RA +3R MB7 exon 1063223 1063878 0 - . Parent=CG12163-RA +3R MB7 exon 1063935 1064116 0 - . Parent=CG12163-RA +3R MB7 exon 1064176 1064919 0 - . Parent=CG12163-RA +3R MB7 exon 1065214 1065341 0 - . Parent=CG12163-RA +3R MB7 exon 1069560 1069976 0 - . Parent=CG12163-RA +3R MB7 exon 1077146 1077468 0 - . Parent=CG12163-RA +3R MB7 three_prime_UTR 1063223 1063612 0 - . Parent=CG12163-RA +3R MB7 stop_codon 1063613 1063615 0 - 0 Parent=CG12163-RA +3R MB7 CDS 1063613 1063878 0 - 2 Parent=CG12163-RA +3R MB7 CDS 1063935 1064116 0 - 1 Parent=CG12163-RA +3R MB7 CDS 1064176 1064919 0 - 1 Parent=CG12163-RA +3R MB7 CDS 1065214 1065341 0 - 0 Parent=CG12163-RA +3R MB7 CDS 1069560 1069976 0 - 0 Parent=CG12163-RA +3R MB7 CDS 1077146 1077253 0 - 0 Parent=CG12163-RA +3R MB7 start_codon 1077251 1077253 0 - 0 Parent=CG12163-RA +3R MB7 five_prime_UTR 1077254 1077468 0 - . Parent=CG12163-RA +3R MB7 mRNA 1063223 1077468 2 - . ID=CG12163-RB;Parent=CG12163;Name=CG12163-RB +3R MB7 exon 1063223 1063878 0 - . Parent=CG12163-RB +3R MB7 exon 1063935 1064116 0 - . Parent=CG12163-RB +3R MB7 exon 1064176 1064919 0 - . Parent=CG12163-RB +3R MB7 exon 1065214 1065341 0 - . Parent=CG12163-RB +3R MB7 exon 1077146 1077468 0 - . Parent=CG12163-RB +3R MB7 three_prime_UTR 1063223 1063612 0 - . Parent=CG12163-RB +3R MB7 stop_codon 1063613 1063615 0 - 0 Parent=CG12163-RB +3R MB7 CDS 1063613 1063878 0 - 2 Parent=CG12163-RB +3R MB7 CDS 1063935 1064116 0 - 1 Parent=CG12163-RB +3R MB7 CDS 1064176 1064919 0 - 1 Parent=CG12163-RB +3R MB7 CDS 1065214 1065341 0 - 0 Parent=CG12163-RB +3R MB7 CDS 1077146 1077253 0 - 0 Parent=CG12163-RB +3R MB7 start_codon 1077251 1077253 0 - 0 Parent=CG12163-RB +3R MB7 five_prime_UTR 1077254 1077468 0 - . Parent=CG12163-RB +3R MB7 mRNA 1063223 1077468 2 - . ID=CG12163.a;Parent=CG12163;Name=CG12163.a +3R MB7 exon 1063223 1063878 0 - . Parent=CG12163.a +3R MB7 exon 1063935 1064116 0 - . Parent=CG12163.a +3R MB7 exon 1064176 1064919 0 - . Parent=CG12163.a +3R MB7 exon 1065214 1065341 0 - . Parent=CG12163.a +3R MB7 exon 1077140 1077468 0 - . Parent=CG12163.a +3R MB7 three_prime_UTR 1063223 1063612 0 - . Parent=CG12163.a +3R MB7 stop_codon 1063613 1063615 0 - 0 Parent=CG12163.a +3R MB7 CDS 1063613 1063878 0 - 2 Parent=CG12163.a +3R MB7 CDS 1063935 1064116 0 - 1 Parent=CG12163.a +3R MB7 CDS 1064176 1064919 0 - 1 Parent=CG12163.a +3R MB7 CDS 1065214 1065341 0 - 0 Parent=CG12163.a +3R MB7 CDS 1077140 1077253 0 - 0 Parent=CG12163.a +3R MB7 start_codon 1077251 1077253 0 - 0 Parent=CG12163.a +3R MB7 five_prime_UTR 1077254 1077468 0 - . Parent=CG12163.a +3R MB7 gene 1065728 1066457 0 - . ID=CG33293;Name=CG33293 +3R MB7 mRNA 1065728 1066457 1 - . ID=CG33293-RA;Parent=CG33293;Name=CG33293-RA +3R MB7 exon 1065728 1066300 0 - . Parent=CG33293-RA +3R MB7 exon 1066362 1066457 0 - . Parent=CG33293-RA +3R MB7 three_prime_UTR 1065728 1066025 0 - . Parent=CG33293-RA +3R MB7 stop_codon 1066026 1066028 0 - 0 Parent=CG33293-RA +3R MB7 CDS 1066026 1066286 0 - 0 Parent=CG33293-RA +3R MB7 start_codon 1066284 1066286 0 - 0 Parent=CG33293-RA +3R MB7 five_prime_UTR 1066287 1066300 0 - . Parent=CG33293-RA +3R MB7 five_prime_UTR 1066362 1066457 0 - . Parent=CG33293-RA +3R MB7 gene 1079070 1081125 0 + . ID=CG1113;Name=CG1113 +3R MB7 mRNA 1079070 1081125 3 + . ID=CG1113-RA;Parent=CG1113;Name=CG1113-RA +3R MB7 exon 1079070 1079391 0 + . Parent=CG1113-RA +3R MB7 exon 1079597 1080641 0 + . Parent=CG1113-RA +3R MB7 exon 1080696 1081125 0 + . Parent=CG1113-RA +3R MB7 five_prime_UTR 1079070 1079177 0 + . Parent=CG1113-RA +3R MB7 start_codon 1079178 1079180 0 + 0 Parent=CG1113-RA +3R MB7 CDS 1079178 1079391 0 + 0 Parent=CG1113-RA +3R MB7 CDS 1079597 1080641 0 + 2 Parent=CG1113-RA +3R MB7 CDS 1080696 1081125 0 + 1 Parent=CG1113-RA +3R MB7 stop_codon 1081123 1081125 0 + 0 Parent=CG1113-RA +3R MB7 gene 1081166 1082423 0 - . ID=CG12173;Name=CG12173 +3R MB7 mRNA 1081176 1082423 1 - . ID=CG12173-RA;Parent=CG12173;Name=CG12173-RA +3R MB7 exon 1081176 1081341 0 - . Parent=CG12173-RA +3R MB7 exon 1081404 1081660 0 - . Parent=CG12173-RA +3R MB7 exon 1081970 1082423 0 - . Parent=CG12173-RA +3R MB7 three_prime_UTR 1081176 1081183 0 - . Parent=CG12173-RA +3R MB7 stop_codon 1081184 1081186 0 - 0 Parent=CG12173-RA +3R MB7 CDS 1081184 1081341 0 - 2 Parent=CG12173-RA +3R MB7 CDS 1081404 1081660 0 - 1 Parent=CG12173-RA +3R MB7 CDS 1081970 1082325 0 - 0 Parent=CG12173-RA +3R MB7 start_codon 1082323 1082325 0 - 0 Parent=CG12173-RA +3R MB7 five_prime_UTR 1082326 1082423 0 - . Parent=CG12173-RA +3R MB7 mRNA 1081166 1082423 1 - . ID=CG12173-RB;Parent=CG12173;Name=CG12173-RB +3R MB7 exon 1081166 1081341 0 - . Parent=CG12173-RB +3R MB7 exon 1081404 1081660 0 - . Parent=CG12173-RB +3R MB7 exon 1081970 1082423 0 - . Parent=CG12173-RB +3R MB7 three_prime_UTR 1081166 1081183 0 - . Parent=CG12173-RB +3R MB7 stop_codon 1081184 1081186 0 - 0 Parent=CG12173-RB +3R MB7 CDS 1081184 1081341 0 - 2 Parent=CG12173-RB +3R MB7 CDS 1081404 1081660 0 - 1 Parent=CG12173-RB +3R MB7 CDS 1081970 1082325 0 - 0 Parent=CG12173-RB +3R MB7 start_codon 1082323 1082325 0 - 0 Parent=CG12173-RB +3R MB7 five_prime_UTR 1082326 1082423 0 - . Parent=CG12173-RB +3R MB7 gene 1082763 1094320 0 + . ID=CG31543;Name=CG31543 +3R MB7 mRNA 1090666 1094320 1 + . ID=CG31543-RB.3d;Parent=CG31543;Name=CG31543-RB.3d +3R MB7 exon 1090666 1090924 0 + . Parent=CG31543-RB.3d +3R MB7 exon 1092475 1092754 0 + . Parent=CG31543-RB.3d +3R MB7 exon 1092843 1092923 0 + . Parent=CG31543-RB.3d +3R MB7 exon 1092985 1093124 0 + . Parent=CG31543-RB.3d +3R MB7 exon 1093184 1094320 0 + . Parent=CG31543-RB.3d +3R MB7 five_prime_UTR 1090666 1090924 0 + . Parent=CG31543-RB.3d +3R MB7 five_prime_UTR 1092475 1092517 0 + . Parent=CG31543-RB.3d +3R MB7 start_codon 1092518 1092520 0 + 0 Parent=CG31543-RB.3d +3R MB7 CDS 1092518 1092754 0 + 0 Parent=CG31543-RB.3d +3R MB7 CDS 1092843 1092923 0 + 0 Parent=CG31543-RB.3d +3R MB7 CDS 1092985 1093124 0 + 0 Parent=CG31543-RB.3d +3R MB7 CDS 1093184 1093562 0 + 1 Parent=CG31543-RB.3d +3R MB7 stop_codon 1093560 1093562 0 + 0 Parent=CG31543-RB.3d +3R MB7 three_prime_UTR 1093563 1094320 0 + . Parent=CG31543-RB.3d +3R MB7 mRNA 1090664 1094197 1 + . ID=CG31543-RA;Parent=CG31543;Name=CG31543-RA +3R MB7 exon 1090664 1091359 0 + . Parent=CG31543-RA +3R MB7 exon 1092475 1092754 0 + . Parent=CG31543-RA +3R MB7 exon 1092843 1092923 0 + . Parent=CG31543-RA +3R MB7 exon 1092985 1093124 0 + . Parent=CG31543-RA +3R MB7 exon 1093184 1094197 0 + . Parent=CG31543-RA +3R MB7 five_prime_UTR 1090664 1091261 0 + . Parent=CG31543-RA +3R MB7 start_codon 1091262 1091264 0 + 0 Parent=CG31543-RA +3R MB7 CDS 1091262 1091359 0 + 0 Parent=CG31543-RA +3R MB7 CDS 1092475 1092754 0 + 1 Parent=CG31543-RA +3R MB7 CDS 1092843 1092923 0 + 0 Parent=CG31543-RA +3R MB7 CDS 1092985 1093124 0 + 0 Parent=CG31543-RA +3R MB7 CDS 1093184 1093562 0 + 1 Parent=CG31543-RA +3R MB7 stop_codon 1093560 1093562 0 + 0 Parent=CG31543-RA +3R MB7 three_prime_UTR 1093563 1094197 0 + . Parent=CG31543-RA +3R MB7 mRNA 1082763 1094197 1 + . ID=CG31543-RC;Parent=CG31543;Name=CG31543-RC +3R MB7 exon 1082763 1083843 0 + . Parent=CG31543-RC +3R MB7 exon 1092475 1092754 0 + . Parent=CG31543-RC +3R MB7 exon 1092843 1092923 0 + . Parent=CG31543-RC +3R MB7 exon 1092985 1093124 0 + . Parent=CG31543-RC +3R MB7 exon 1093184 1094197 0 + . Parent=CG31543-RC +3R MB7 five_prime_UTR 1082763 1083286 0 + . Parent=CG31543-RC +3R MB7 start_codon 1083287 1083289 0 + 0 Parent=CG31543-RC +3R MB7 CDS 1083287 1083843 0 + 0 Parent=CG31543-RC +3R MB7 CDS 1092475 1092754 0 + 1 Parent=CG31543-RC +3R MB7 CDS 1092843 1092923 0 + 0 Parent=CG31543-RC +3R MB7 CDS 1092985 1093124 0 + 0 Parent=CG31543-RC +3R MB7 CDS 1093184 1093562 0 + 1 Parent=CG31543-RC +3R MB7 stop_codon 1093560 1093562 0 + 0 Parent=CG31543-RC +3R MB7 three_prime_UTR 1093563 1094197 0 + . Parent=CG31543-RC +3R MB7 gene 1084193 1084867 0 - . ID=CG14666;Name=CG14666 +3R MB7 mRNA 1084193 1084867 34 - . ID=CG14666-RA;Parent=CG14666;Name=CG14666-RA +3R MB7 exon 1084193 1084867 0 - . Parent=CG14666-RA +3R MB7 stop_codon 1084193 1084195 0 - 0 Parent=CG14666-RA +3R MB7 CDS 1084193 1084867 0 - 0 Parent=CG14666-RA +3R MB7 start_codon 1084865 1084867 0 - 0 Parent=CG14666-RA +3R MB7 gene 1098665 1176165 0 - . ID=CG32464;Name=CG32464 +3R MB7 mRNA 1098665 1149566 3 - . ID=CG32464.a;Parent=CG32464;Name=CG32464.a +3R MB7 exon 1098665 1099804 0 - . Parent=CG32464.a +3R MB7 exon 1099871 1100040 0 - . Parent=CG32464.a +3R MB7 exon 1100457 1100616 0 - . Parent=CG32464.a +3R MB7 exon 1100688 1100809 0 - . Parent=CG32464.a +3R MB7 exon 1118362 1118563 0 - . Parent=CG32464.a +3R MB7 exon 1118720 1118882 0 - . Parent=CG32464.a +3R MB7 exon 1118941 1119092 0 - . Parent=CG32464.a +3R MB7 exon 1119784 1119956 0 - . Parent=CG32464.a +3R MB7 exon 1120028 1120577 0 - . Parent=CG32464.a +3R MB7 exon 1121363 1121517 0 - . Parent=CG32464.a +3R MB7 exon 1121579 1121685 0 - . Parent=CG32464.a +3R MB7 exon 1121869 1122357 0 - . Parent=CG32464.a +3R MB7 exon 1123924 1124211 0 - . Parent=CG32464.a +3R MB7 exon 1125192 1125295 0 - . Parent=CG32464.a +3R MB7 exon 1129833 1129904 0 - . Parent=CG32464.a +3R MB7 exon 1138711 1139219 0 - . Parent=CG32464.a +3R MB7 exon 1139660 1140027 0 - . Parent=CG32464.a +3R MB7 exon 1148710 1148847 0 - . Parent=CG32464.a +3R MB7 exon 1149161 1149566 0 - . Parent=CG32464.a +3R MB7 three_prime_UTR 1098665 1099668 0 - . Parent=CG32464.a +3R MB7 stop_codon 1099669 1099671 0 - 0 Parent=CG32464.a +3R MB7 CDS 1099669 1099804 0 - 1 Parent=CG32464.a +3R MB7 CDS 1099871 1100040 0 - 0 Parent=CG32464.a +3R MB7 CDS 1100457 1100616 0 - 1 Parent=CG32464.a +3R MB7 CDS 1100688 1100809 0 - 0 Parent=CG32464.a +3R MB7 CDS 1118362 1118563 0 - 1 Parent=CG32464.a +3R MB7 CDS 1118720 1118882 0 - 2 Parent=CG32464.a +3R MB7 CDS 1118941 1119092 0 - 1 Parent=CG32464.a +3R MB7 CDS 1119784 1119956 0 - 0 Parent=CG32464.a +3R MB7 CDS 1120028 1120577 0 - 1 Parent=CG32464.a +3R MB7 CDS 1121363 1121517 0 - 0 Parent=CG32464.a +3R MB7 CDS 1121579 1121685 0 - 2 Parent=CG32464.a +3R MB7 CDS 1121869 1122357 0 - 2 Parent=CG32464.a +3R MB7 CDS 1123924 1124211 0 - 2 Parent=CG32464.a +3R MB7 CDS 1125192 1125295 0 - 1 Parent=CG32464.a +3R MB7 CDS 1129833 1129904 0 - 1 Parent=CG32464.a +3R MB7 CDS 1138711 1139219 0 - 0 Parent=CG32464.a +3R MB7 CDS 1139660 1139920 0 - 0 Parent=CG32464.a +3R MB7 start_codon 1139918 1139920 0 - 0 Parent=CG32464.a +3R MB7 five_prime_UTR 1139921 1140027 0 - . Parent=CG32464.a +3R MB7 five_prime_UTR 1148710 1148847 0 - . Parent=CG32464.a +3R MB7 five_prime_UTR 1149161 1149566 0 - . Parent=CG32464.a +3R MB7 mRNA 1098665 1149566 3 - . ID=CG32464-RN;Parent=CG32464;Name=CG32464-RN +3R MB7 exon 1098665 1099804 0 - . Parent=CG32464-RN +3R MB7 exon 1099871 1100040 0 - . Parent=CG32464-RN +3R MB7 exon 1100457 1100616 0 - . Parent=CG32464-RN +3R MB7 exon 1100688 1100809 0 - . Parent=CG32464-RN +3R MB7 exon 1118362 1118563 0 - . Parent=CG32464-RN +3R MB7 exon 1118720 1118882 0 - . Parent=CG32464-RN +3R MB7 exon 1118941 1119092 0 - . Parent=CG32464-RN +3R MB7 exon 1119784 1119956 0 - . Parent=CG32464-RN +3R MB7 exon 1120028 1120577 0 - . Parent=CG32464-RN +3R MB7 exon 1121363 1121517 0 - . Parent=CG32464-RN +3R MB7 exon 1121579 1121685 0 - . Parent=CG32464-RN +3R MB7 exon 1121869 1122357 0 - . Parent=CG32464-RN +3R MB7 exon 1123924 1124211 0 - . Parent=CG32464-RN +3R MB7 exon 1125192 1125295 0 - . Parent=CG32464-RN +3R MB7 exon 1129833 1129904 0 - . Parent=CG32464-RN +3R MB7 exon 1138711 1139219 0 - . Parent=CG32464-RN +3R MB7 exon 1139660 1140027 0 - . Parent=CG32464-RN +3R MB7 exon 1148710 1148847 0 - . Parent=CG32464-RN +3R MB7 exon 1149414 1149566 0 - . Parent=CG32464-RN +3R MB7 three_prime_UTR 1098665 1099668 0 - . Parent=CG32464-RN +3R MB7 stop_codon 1099669 1099671 0 - 0 Parent=CG32464-RN +3R MB7 CDS 1099669 1099804 0 - 1 Parent=CG32464-RN +3R MB7 CDS 1099871 1100040 0 - 0 Parent=CG32464-RN +3R MB7 CDS 1100457 1100616 0 - 1 Parent=CG32464-RN +3R MB7 CDS 1100688 1100809 0 - 0 Parent=CG32464-RN +3R MB7 CDS 1118362 1118563 0 - 1 Parent=CG32464-RN +3R MB7 CDS 1118720 1118882 0 - 2 Parent=CG32464-RN +3R MB7 CDS 1118941 1119092 0 - 1 Parent=CG32464-RN +3R MB7 CDS 1119784 1119956 0 - 0 Parent=CG32464-RN +3R MB7 CDS 1120028 1120577 0 - 1 Parent=CG32464-RN +3R MB7 CDS 1121363 1121517 0 - 0 Parent=CG32464-RN +3R MB7 CDS 1121579 1121685 0 - 2 Parent=CG32464-RN +3R MB7 CDS 1121869 1122357 0 - 2 Parent=CG32464-RN +3R MB7 CDS 1123924 1124211 0 - 2 Parent=CG32464-RN +3R MB7 CDS 1125192 1125295 0 - 1 Parent=CG32464-RN +3R MB7 CDS 1129833 1129904 0 - 1 Parent=CG32464-RN +3R MB7 CDS 1138711 1139219 0 - 0 Parent=CG32464-RN +3R MB7 CDS 1139660 1139920 0 - 0 Parent=CG32464-RN +3R MB7 start_codon 1139918 1139920 0 - 0 Parent=CG32464-RN +3R MB7 five_prime_UTR 1139921 1140027 0 - . Parent=CG32464-RN +3R MB7 five_prime_UTR 1148710 1148847 0 - . Parent=CG32464-RN +3R MB7 five_prime_UTR 1149414 1149566 0 - . Parent=CG32464-RN +3R MB7 mRNA 1098665 1149566 3 - . ID=CG32464-RJ;Parent=CG32464;Name=CG32464-RJ +3R MB7 exon 1098665 1099804 0 - . Parent=CG32464-RJ +3R MB7 exon 1099871 1100040 0 - . Parent=CG32464-RJ +3R MB7 exon 1100457 1100616 0 - . Parent=CG32464-RJ +3R MB7 exon 1100688 1100809 0 - . Parent=CG32464-RJ +3R MB7 exon 1118362 1118563 0 - . Parent=CG32464-RJ +3R MB7 exon 1118720 1118882 0 - . Parent=CG32464-RJ +3R MB7 exon 1118941 1119092 0 - . Parent=CG32464-RJ +3R MB7 exon 1119784 1119956 0 - . Parent=CG32464-RJ +3R MB7 exon 1120028 1120577 0 - . Parent=CG32464-RJ +3R MB7 exon 1121363 1121517 0 - . Parent=CG32464-RJ +3R MB7 exon 1121579 1121685 0 - . Parent=CG32464-RJ +3R MB7 exon 1121869 1122357 0 - . Parent=CG32464-RJ +3R MB7 exon 1123924 1124211 0 - . Parent=CG32464-RJ +3R MB7 exon 1125192 1125295 0 - . Parent=CG32464-RJ +3R MB7 exon 1129833 1129904 0 - . Parent=CG32464-RJ +3R MB7 exon 1138711 1139219 0 - . Parent=CG32464-RJ +3R MB7 exon 1139660 1140027 0 - . Parent=CG32464-RJ +3R MB7 exon 1148710 1148847 0 - . Parent=CG32464-RJ +3R MB7 exon 1149461 1149566 0 - . Parent=CG32464-RJ +3R MB7 three_prime_UTR 1098665 1099668 0 - . Parent=CG32464-RJ +3R MB7 stop_codon 1099669 1099671 0 - 0 Parent=CG32464-RJ +3R MB7 CDS 1099669 1099804 0 - 1 Parent=CG32464-RJ +3R MB7 CDS 1099871 1100040 0 - 0 Parent=CG32464-RJ +3R MB7 CDS 1100457 1100616 0 - 1 Parent=CG32464-RJ +3R MB7 CDS 1100688 1100809 0 - 0 Parent=CG32464-RJ +3R MB7 CDS 1118362 1118563 0 - 1 Parent=CG32464-RJ +3R MB7 CDS 1118720 1118882 0 - 2 Parent=CG32464-RJ +3R MB7 CDS 1118941 1119092 0 - 1 Parent=CG32464-RJ +3R MB7 CDS 1119784 1119956 0 - 0 Parent=CG32464-RJ +3R MB7 CDS 1120028 1120577 0 - 1 Parent=CG32464-RJ +3R MB7 CDS 1121363 1121517 0 - 0 Parent=CG32464-RJ +3R MB7 CDS 1121579 1121685 0 - 2 Parent=CG32464-RJ +3R MB7 CDS 1121869 1122357 0 - 2 Parent=CG32464-RJ +3R MB7 CDS 1123924 1124211 0 - 2 Parent=CG32464-RJ +3R MB7 CDS 1125192 1125295 0 - 1 Parent=CG32464-RJ +3R MB7 CDS 1129833 1129904 0 - 1 Parent=CG32464-RJ +3R MB7 CDS 1138711 1139219 0 - 0 Parent=CG32464-RJ +3R MB7 CDS 1139660 1139920 0 - 0 Parent=CG32464-RJ +3R MB7 start_codon 1139918 1139920 0 - 0 Parent=CG32464-RJ +3R MB7 five_prime_UTR 1139921 1140027 0 - . Parent=CG32464-RJ +3R MB7 five_prime_UTR 1148710 1148847 0 - . Parent=CG32464-RJ +3R MB7 five_prime_UTR 1149461 1149566 0 - . Parent=CG32464-RJ +3R MB7 mRNA 1098665 1149566 1 - . ID=CG32464-RB;Parent=CG32464;Name=CG32464-RB +3R MB7 exon 1098665 1099804 0 - . Parent=CG32464-RB +3R MB7 exon 1099871 1100040 0 - . Parent=CG32464-RB +3R MB7 exon 1100457 1100616 0 - . Parent=CG32464-RB +3R MB7 exon 1100688 1100809 0 - . Parent=CG32464-RB +3R MB7 exon 1118362 1118563 0 - . Parent=CG32464-RB +3R MB7 exon 1118720 1118882 0 - . Parent=CG32464-RB +3R MB7 exon 1118941 1119092 0 - . Parent=CG32464-RB +3R MB7 exon 1119784 1119956 0 - . Parent=CG32464-RB +3R MB7 exon 1120028 1120577 0 - . Parent=CG32464-RB +3R MB7 exon 1121363 1121517 0 - . Parent=CG32464-RB +3R MB7 exon 1121579 1121685 0 - . Parent=CG32464-RB +3R MB7 exon 1121869 1122357 0 - . Parent=CG32464-RB +3R MB7 exon 1123924 1124211 0 - . Parent=CG32464-RB +3R MB7 exon 1125192 1125295 0 - . Parent=CG32464-RB +3R MB7 exon 1129833 1129904 0 - . Parent=CG32464-RB +3R MB7 exon 1138711 1139219 0 - . Parent=CG32464-RB +3R MB7 exon 1139660 1140027 0 - . Parent=CG32464-RB +3R MB7 exon 1148710 1148847 0 - . Parent=CG32464-RB +3R MB7 exon 1149387 1149566 0 - . Parent=CG32464-RB +3R MB7 three_prime_UTR 1098665 1099668 0 - . Parent=CG32464-RB +3R MB7 stop_codon 1099669 1099671 0 - 0 Parent=CG32464-RB +3R MB7 CDS 1099669 1099804 0 - 1 Parent=CG32464-RB +3R MB7 CDS 1099871 1100040 0 - 0 Parent=CG32464-RB +3R MB7 CDS 1100457 1100616 0 - 1 Parent=CG32464-RB +3R MB7 CDS 1100688 1100809 0 - 0 Parent=CG32464-RB +3R MB7 CDS 1118362 1118563 0 - 1 Parent=CG32464-RB +3R MB7 CDS 1118720 1118882 0 - 2 Parent=CG32464-RB +3R MB7 CDS 1118941 1119092 0 - 1 Parent=CG32464-RB +3R MB7 CDS 1119784 1119956 0 - 0 Parent=CG32464-RB +3R MB7 CDS 1120028 1120577 0 - 1 Parent=CG32464-RB +3R MB7 CDS 1121363 1121517 0 - 0 Parent=CG32464-RB +3R MB7 CDS 1121579 1121685 0 - 2 Parent=CG32464-RB +3R MB7 CDS 1121869 1122357 0 - 2 Parent=CG32464-RB +3R MB7 CDS 1123924 1124211 0 - 2 Parent=CG32464-RB +3R MB7 CDS 1125192 1125295 0 - 1 Parent=CG32464-RB +3R MB7 CDS 1129833 1129904 0 - 1 Parent=CG32464-RB +3R MB7 CDS 1138711 1139219 0 - 0 Parent=CG32464-RB +3R MB7 CDS 1139660 1139920 0 - 0 Parent=CG32464-RB +3R MB7 start_codon 1139918 1139920 0 - 0 Parent=CG32464-RB +3R MB7 five_prime_UTR 1139921 1140027 0 - . Parent=CG32464-RB +3R MB7 five_prime_UTR 1148710 1148847 0 - . Parent=CG32464-RB +3R MB7 five_prime_UTR 1149387 1149566 0 - . Parent=CG32464-RB +3R MB7 mRNA 1098665 1149566 3 - . ID=CG32464-RU;Parent=CG32464;Name=CG32464-RU +3R MB7 exon 1098665 1099804 0 - . Parent=CG32464-RU +3R MB7 exon 1099871 1100040 0 - . Parent=CG32464-RU +3R MB7 exon 1100457 1100616 0 - . Parent=CG32464-RU +3R MB7 exon 1100688 1100809 0 - . Parent=CG32464-RU +3R MB7 exon 1118362 1118563 0 - . Parent=CG32464-RU +3R MB7 exon 1118720 1118882 0 - . Parent=CG32464-RU +3R MB7 exon 1118941 1119092 0 - . Parent=CG32464-RU +3R MB7 exon 1119784 1119956 0 - . Parent=CG32464-RU +3R MB7 exon 1120028 1120577 0 - . Parent=CG32464-RU +3R MB7 exon 1121363 1121517 0 - . Parent=CG32464-RU +3R MB7 exon 1121579 1121685 0 - . Parent=CG32464-RU +3R MB7 exon 1121869 1122357 0 - . Parent=CG32464-RU +3R MB7 exon 1123924 1124211 0 - . Parent=CG32464-RU +3R MB7 exon 1125192 1125295 0 - . Parent=CG32464-RU +3R MB7 exon 1138711 1139219 0 - . Parent=CG32464-RU +3R MB7 exon 1139660 1140027 0 - . Parent=CG32464-RU +3R MB7 exon 1148710 1148847 0 - . Parent=CG32464-RU +3R MB7 exon 1149387 1149566 0 - . Parent=CG32464-RU +3R MB7 three_prime_UTR 1098665 1099668 0 - . Parent=CG32464-RU +3R MB7 stop_codon 1099669 1099671 0 - 0 Parent=CG32464-RU +3R MB7 CDS 1099669 1099804 0 - 1 Parent=CG32464-RU +3R MB7 CDS 1099871 1100040 0 - 0 Parent=CG32464-RU +3R MB7 CDS 1100457 1100616 0 - 1 Parent=CG32464-RU +3R MB7 CDS 1100688 1100809 0 - 0 Parent=CG32464-RU +3R MB7 CDS 1118362 1118563 0 - 1 Parent=CG32464-RU +3R MB7 CDS 1118720 1118882 0 - 2 Parent=CG32464-RU +3R MB7 CDS 1118941 1119092 0 - 1 Parent=CG32464-RU +3R MB7 CDS 1119784 1119956 0 - 0 Parent=CG32464-RU +3R MB7 CDS 1120028 1120577 0 - 1 Parent=CG32464-RU +3R MB7 CDS 1121363 1121517 0 - 0 Parent=CG32464-RU +3R MB7 CDS 1121579 1121685 0 - 2 Parent=CG32464-RU +3R MB7 CDS 1121869 1122357 0 - 2 Parent=CG32464-RU +3R MB7 CDS 1123924 1124211 0 - 2 Parent=CG32464-RU +3R MB7 CDS 1125192 1125295 0 - 1 Parent=CG32464-RU +3R MB7 CDS 1138711 1139219 0 - 0 Parent=CG32464-RU +3R MB7 CDS 1139660 1139920 0 - 0 Parent=CG32464-RU +3R MB7 start_codon 1139918 1139920 0 - 0 Parent=CG32464-RU +3R MB7 five_prime_UTR 1139921 1140027 0 - . Parent=CG32464-RU +3R MB7 five_prime_UTR 1148710 1148847 0 - . Parent=CG32464-RU +3R MB7 five_prime_UTR 1149387 1149566 0 - . Parent=CG32464-RU
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/aceview_hs_37.gff3 Thu Apr 23 17:57:49 2015 -0400 @@ -0,0 +1,3164 @@ +##gff-version 3 +7 AceView gene 34386126 34873948 . - . ID=AAA1;Name=AAA1 +7 AceView transcript 34606334 34797884 . - . ID=AAA1.jAug10;Parent=AAA1 +7 AceView exon 34606334 34606424 . - . Parent=AAA1.jAug10 +7 AceView exon 34606693 34606763 . - . Parent=AAA1.jAug10 +7 AceView exon 34609324 34609473 . - . Parent=AAA1.jAug10 +7 AceView exon 34743692 34743811 . - . Parent=AAA1.jAug10 +7 AceView exon 34768349 34768428 . - . Parent=AAA1.jAug10 +7 AceView exon 34797686 34797884 . - . Parent=AAA1.jAug10 +7 AceView mRNA 34682839 34800803 . - . ID=AAA1.dAug10;Parent=AAA1 +7 AceView five_prime_UTR 34800803 34800803 . - . Parent=AAA1.dAug10 +7 AceView CDS 34682958 34682963 . - 0 Parent=AAA1.dAug10 +7 AceView CDS 34768349 34768428 . - 2 Parent=AAA1.dAug10 +7 AceView CDS 34800724 34800802 . - 0 Parent=AAA1.dAug10 +7 AceView three_prime_UTR 34682839 34682957 . - . Parent=AAA1.dAug10 +7 AceView exon 34682839 34682963 . - . Parent=AAA1.dAug10 +7 AceView exon 34768349 34768428 . - . Parent=AAA1.dAug10 +7 AceView exon 34800724 34800803 . - . Parent=AAA1.dAug10 +7 AceView transcript 34758474 34873943 . - . ID=AAA1.hAug10;Parent=AAA1 +7 AceView exon 34758474 34759420 . - . Parent=AAA1.hAug10 +7 AceView exon 34762896 34763007 . - . Parent=AAA1.hAug10 +7 AceView exon 34768349 34768428 . - . Parent=AAA1.hAug10 +7 AceView exon 34807954 34808052 . - . Parent=AAA1.hAug10 +7 AceView exon 34873773 34873943 . - . Parent=AAA1.hAug10 +7 AceView transcript 34386126 34797884 . - . ID=AAA1.eAug10;Parent=AAA1 +7 AceView exon 34386126 34390459 . - . Parent=AAA1.eAug10 +7 AceView exon 34457191 34457284 . - . Parent=AAA1.eAug10 +7 AceView exon 34609324 34609473 . - . Parent=AAA1.eAug10 +7 AceView exon 34768349 34768428 . - . Parent=AAA1.eAug10 +7 AceView exon 34797686 34797884 . - . Parent=AAA1.eAug10 +7 AceView mRNA 34386126 34797884 . - . ID=AAA1.bAug10;Parent=AAA1 +7 AceView five_prime_UTR 34797711 34797884 . - . Parent=AAA1.bAug10 +7 AceView CDS 34457198 34457284 . - 0 Parent=AAA1.bAug10 +7 AceView CDS 34768349 34768428 . - 2 Parent=AAA1.bAug10 +7 AceView CDS 34797686 34797710 . - 0 Parent=AAA1.bAug10 +7 AceView three_prime_UTR 34386126 34390459 . - . Parent=AAA1.bAug10 +7 AceView three_prime_UTR 34457191 34457197 . - . Parent=AAA1.bAug10 +7 AceView exon 34386126 34390459 . - . Parent=AAA1.bAug10 +7 AceView exon 34457191 34457284 . - . Parent=AAA1.bAug10 +7 AceView exon 34768349 34768428 . - . Parent=AAA1.bAug10 +7 AceView exon 34797686 34797884 . - . Parent=AAA1.bAug10 +7 AceView transcript 34390034 34800803 . - . ID=AAA1.iAug10;Parent=AAA1 +7 AceView exon 34390034 34390459 . - . Parent=AAA1.iAug10 +7 AceView exon 34457191 34457284 . - . Parent=AAA1.iAug10 +7 AceView exon 34609324 34609473 . - . Parent=AAA1.iAug10 +7 AceView exon 34768349 34768428 . - . Parent=AAA1.iAug10 +7 AceView exon 34800724 34800803 . - . Parent=AAA1.iAug10 +7 AceView mRNA 34743462 34800803 . - . ID=AAA1.cAug10;Parent=AAA1 +7 AceView five_prime_UTR 34800803 34800803 . - . Parent=AAA1.cAug10 +7 AceView CDS 34743797 34743811 . - 0 Parent=AAA1.cAug10 +7 AceView CDS 34768349 34768428 . - 2 Parent=AAA1.cAug10 +7 AceView CDS 34800724 34800802 . - 0 Parent=AAA1.cAug10 +7 AceView three_prime_UTR 34743462 34743796 . - . Parent=AAA1.cAug10 +7 AceView exon 34743462 34743811 . - . Parent=AAA1.cAug10 +7 AceView exon 34768349 34768428 . - . Parent=AAA1.cAug10 +7 AceView exon 34800724 34800803 . - . Parent=AAA1.cAug10 +7 AceView transcript 34758474 34873941 . - . ID=AAA1.fAug10;Parent=AAA1 +7 AceView exon 34758474 34759420 . - . Parent=AAA1.fAug10 +7 AceView exon 34760254 34760397 . - . Parent=AAA1.fAug10 +7 AceView exon 34762896 34763007 . - . Parent=AAA1.fAug10 +7 AceView exon 34768349 34768428 . - . Parent=AAA1.fAug10 +7 AceView exon 34800724 34800803 . - . Parent=AAA1.fAug10 +7 AceView exon 34873749 34873941 . - . Parent=AAA1.fAug10 +7 AceView mRNA 34607864 34797884 . - . ID=AAA1.aAug10;Parent=AAA1 +7 AceView five_prime_UTR 34797711 34797884 . - . Parent=AAA1.aAug10 +7 AceView CDS 34609384 34609473 . - 0 Parent=AAA1.aAug10 +7 AceView CDS 34768349 34768428 . - 2 Parent=AAA1.aAug10 +7 AceView CDS 34797686 34797710 . - 0 Parent=AAA1.aAug10 +7 AceView three_prime_UTR 34607864 34607984 . - . Parent=AAA1.aAug10 +7 AceView three_prime_UTR 34609324 34609383 . - . Parent=AAA1.aAug10 +7 AceView exon 34607864 34607984 . - . Parent=AAA1.aAug10 +7 AceView exon 34609324 34609473 . - . Parent=AAA1.aAug10 +7 AceView exon 34768349 34768428 . - . Parent=AAA1.aAug10 +7 AceView exon 34797686 34797884 . - . Parent=AAA1.aAug10 +7 AceView transcript 34758479 34873948 . - . ID=AAA1.gAug10;Parent=AAA1 +7 AceView exon 34758479 34759420 . - . Parent=AAA1.gAug10 +7 AceView exon 34760254 34760397 . - . Parent=AAA1.gAug10 +7 AceView exon 34762896 34763007 . - . Parent=AAA1.gAug10 +7 AceView exon 34768349 34768428 . - . Parent=AAA1.gAug10 +7 AceView exon 34800724 34800803 . - . Parent=AAA1.gAug10 +7 AceView exon 34873773 34873948 . - . Parent=AAA1.gAug10 +12 AceView gene 53701240 53718648 . - . ID=AAAS;Name=AAAS +12 AceView mRNA 53709165 53715369 . - . ID=AAAS.tAug10;Parent=AAAS +12 AceView five_prime_UTR 53714447 53714476 . - . Parent=AAAS.tAug10 +12 AceView five_prime_UTR 53715236 53715369 . - . Parent=AAAS.tAug10 +12 AceView CDS 53709167 53709210 . - 2 Parent=AAAS.tAug10 +12 AceView CDS 53709511 53709566 . - 1 Parent=AAAS.tAug10 +12 AceView CDS 53714349 53714446 . - 0 Parent=AAAS.tAug10 +12 AceView three_prime_UTR 53709165 53709166 . - . Parent=AAAS.tAug10 +12 AceView exon 53709165 53709210 . - . Parent=AAAS.tAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.tAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.tAug10 +12 AceView exon 53715236 53715369 . - . Parent=AAAS.tAug10 +12 AceView mRNA 53708248 53715324 . - . ID=AAAS.nAug10;Parent=AAAS +12 AceView CDS 53708874 53708924 . - 0 Parent=AAAS.nAug10 +12 AceView CDS 53709119 53709210 . - 2 Parent=AAAS.nAug10 +12 AceView CDS 53709511 53709566 . - 1 Parent=AAAS.nAug10 +12 AceView CDS 53714349 53714476 . - 0 Parent=AAAS.nAug10 +12 AceView CDS 53715127 53715324 . - 0 Parent=AAAS.nAug10 +12 AceView three_prime_UTR 53708248 53708873 . - . Parent=AAAS.nAug10 +12 AceView exon 53708248 53708924 . - . Parent=AAAS.nAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.nAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.nAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.nAug10 +12 AceView exon 53715127 53715324 . - . Parent=AAAS.nAug10 +12 AceView mRNA 53708131 53715028 . - . ID=AAAS.kAug10;Parent=AAAS +12 AceView five_prime_UTR 53715021 53715028 . - . Parent=AAAS.kAug10 +12 AceView CDS 53708132 53708225 . - 1 Parent=AAAS.kAug10 +12 AceView CDS 53708535 53708633 . - 1 Parent=AAAS.kAug10 +12 AceView CDS 53708878 53708924 . - 0 Parent=AAAS.kAug10 +12 AceView CDS 53709119 53709210 . - 2 Parent=AAAS.kAug10 +12 AceView CDS 53709511 53709566 . - 1 Parent=AAAS.kAug10 +12 AceView CDS 53714349 53714476 . - 0 Parent=AAAS.kAug10 +12 AceView CDS 53714985 53715020 . - 0 Parent=AAAS.kAug10 +12 AceView three_prime_UTR 53708131 53708131 . - . Parent=AAAS.kAug10 +12 AceView exon 53708131 53708225 . - . Parent=AAAS.kAug10 +12 AceView exon 53708535 53708633 . - . Parent=AAAS.kAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.kAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.kAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.kAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.kAug10 +12 AceView exon 53714985 53715028 . - . Parent=AAAS.kAug10 +12 AceView mRNA 53701240 53715412 . - . ID=AAAS.aAug10;Parent=AAAS +12 AceView five_prime_UTR 53715250 53715412 . - . Parent=AAAS.aAug10 +12 AceView CDS 53701273 53701497 . - 0 Parent=AAAS.aAug10 +12 AceView CDS 53701629 53701713 . - 1 Parent=AAAS.aAug10 +12 AceView CDS 53701836 53701917 . - 2 Parent=AAAS.aAug10 +12 AceView CDS 53702066 53702133 . - 1 Parent=AAAS.aAug10 +12 AceView CDS 53702219 53702312 . - 2 Parent=AAAS.aAug10 +12 AceView CDS 53702509 53702599 . - 0 Parent=AAAS.aAug10 +12 AceView CDS 53702744 53702804 . - 1 Parent=AAAS.aAug10 +12 AceView CDS 53702941 53703065 . - 0 Parent=AAAS.aAug10 +12 AceView CDS 53703385 53703505 . - 1 Parent=AAAS.aAug10 +12 AceView CDS 53708082 53708225 . - 1 Parent=AAAS.aAug10 +12 AceView CDS 53708535 53708633 . - 1 Parent=AAAS.aAug10 +12 AceView CDS 53708878 53708924 . - 0 Parent=AAAS.aAug10 +12 AceView CDS 53709119 53709210 . - 2 Parent=AAAS.aAug10 +12 AceView CDS 53709511 53709566 . - 1 Parent=AAAS.aAug10 +12 AceView CDS 53714349 53714476 . - 0 Parent=AAAS.aAug10 +12 AceView CDS 53715127 53715249 . - 0 Parent=AAAS.aAug10 +12 AceView three_prime_UTR 53701240 53701272 . - . Parent=AAAS.aAug10 +12 AceView exon 53701240 53701497 . - . Parent=AAAS.aAug10 +12 AceView exon 53701629 53701713 . - . Parent=AAAS.aAug10 +12 AceView exon 53701836 53701917 . - . Parent=AAAS.aAug10 +12 AceView exon 53702066 53702133 . - . Parent=AAAS.aAug10 +12 AceView exon 53702219 53702312 . - . Parent=AAAS.aAug10 +12 AceView exon 53702509 53702599 . - . Parent=AAAS.aAug10 +12 AceView exon 53702744 53702804 . - . Parent=AAAS.aAug10 +12 AceView exon 53702941 53703065 . - . Parent=AAAS.aAug10 +12 AceView exon 53703385 53703505 . - . Parent=AAAS.aAug10 +12 AceView exon 53708082 53708225 . - . Parent=AAAS.aAug10 +12 AceView exon 53708535 53708633 . - . Parent=AAAS.aAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.aAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.aAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.aAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.aAug10 +12 AceView exon 53715127 53715412 . - . Parent=AAAS.aAug10 +12 AceView mRNA 53701240 53715369 . - . ID=AAAS.dAug10;Parent=AAAS +12 AceView five_prime_UTR 53714447 53714476 . - . Parent=AAAS.dAug10 +12 AceView five_prime_UTR 53715255 53715369 . - . Parent=AAAS.dAug10 +12 AceView CDS 53701263 53701497 . - 1 Parent=AAAS.dAug10 +12 AceView CDS 53701836 53701917 . - 2 Parent=AAAS.dAug10 +12 AceView CDS 53702066 53702133 . - 1 Parent=AAAS.dAug10 +12 AceView CDS 53702219 53702312 . - 2 Parent=AAAS.dAug10 +12 AceView CDS 53702509 53702599 . - 0 Parent=AAAS.dAug10 +12 AceView CDS 53702744 53702804 . - 1 Parent=AAAS.dAug10 +12 AceView CDS 53702941 53703065 . - 0 Parent=AAAS.dAug10 +12 AceView CDS 53703385 53703505 . - 1 Parent=AAAS.dAug10 +12 AceView CDS 53708082 53708225 . - 1 Parent=AAAS.dAug10 +12 AceView CDS 53708535 53708633 . - 1 Parent=AAAS.dAug10 +12 AceView CDS 53708878 53708924 . - 0 Parent=AAAS.dAug10 +12 AceView CDS 53709119 53709210 . - 2 Parent=AAAS.dAug10 +12 AceView CDS 53709511 53709566 . - 1 Parent=AAAS.dAug10 +12 AceView CDS 53714349 53714446 . - 0 Parent=AAAS.dAug10 +12 AceView three_prime_UTR 53701240 53701262 . - . Parent=AAAS.dAug10 +12 AceView exon 53701240 53701497 . - . Parent=AAAS.dAug10 +12 AceView exon 53701836 53701917 . - . Parent=AAAS.dAug10 +12 AceView exon 53702066 53702133 . - . Parent=AAAS.dAug10 +12 AceView exon 53702219 53702312 . - . Parent=AAAS.dAug10 +12 AceView exon 53702509 53702599 . - . Parent=AAAS.dAug10 +12 AceView exon 53702744 53702804 . - . Parent=AAAS.dAug10 +12 AceView exon 53702941 53703065 . - . Parent=AAAS.dAug10 +12 AceView exon 53703385 53703505 . - . Parent=AAAS.dAug10 +12 AceView exon 53708082 53708225 . - . Parent=AAAS.dAug10 +12 AceView exon 53708535 53708633 . - . Parent=AAAS.dAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.dAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.dAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.dAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.dAug10 +12 AceView exon 53715255 53715369 . - . Parent=AAAS.dAug10 +12 AceView mRNA 53702746 53703768 . - . ID=AAAS.sAug10;Parent=AAAS +12 AceView five_prime_UTR 53703555 53703768 . - . Parent=AAAS.sAug10 +12 AceView CDS 53703005 53703065 . - 1 Parent=AAAS.sAug10 +12 AceView CDS 53703385 53703554 . - 0 Parent=AAAS.sAug10 +12 AceView three_prime_UTR 53702746 53703004 . - . Parent=AAAS.sAug10 +12 AceView exon 53702746 53703065 . - . Parent=AAAS.sAug10 +12 AceView exon 53703385 53703768 . - . Parent=AAAS.sAug10 +12 AceView mRNA 53708143 53714984 . - . ID=AAAS.mAug10;Parent=AAAS +12 AceView CDS 53708144 53708225 . - 1 Parent=AAAS.mAug10 +12 AceView CDS 53708535 53708633 . - 1 Parent=AAAS.mAug10 +12 AceView CDS 53708878 53708924 . - 0 Parent=AAAS.mAug10 +12 AceView CDS 53709119 53709210 . - 2 Parent=AAAS.mAug10 +12 AceView CDS 53709511 53709566 . - 1 Parent=AAAS.mAug10 +12 AceView CDS 53714349 53714476 . - 0 Parent=AAAS.mAug10 +12 AceView CDS 53714955 53714984 . - 0 Parent=AAAS.mAug10 +12 AceView three_prime_UTR 53708143 53708143 . - . Parent=AAAS.mAug10 +12 AceView exon 53708143 53708225 . - . Parent=AAAS.mAug10 +12 AceView exon 53708535 53708633 . - . Parent=AAAS.mAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.mAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.mAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.mAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.mAug10 +12 AceView exon 53714955 53714984 . - . Parent=AAAS.mAug10 +12 AceView mRNA 53701245 53718648 . - . ID=AAAS.uAug10;Parent=AAAS +12 AceView five_prime_UTR 53702112 53702133 . - . Parent=AAAS.uAug10 +12 AceView five_prime_UTR 53702229 53702312 . - . Parent=AAAS.uAug10 +12 AceView five_prime_UTR 53702509 53702599 . - . Parent=AAAS.uAug10 +12 AceView five_prime_UTR 53702744 53702804 . - . Parent=AAAS.uAug10 +12 AceView five_prime_UTR 53702941 53703065 . - . Parent=AAAS.uAug10 +12 AceView five_prime_UTR 53703385 53703505 . - . Parent=AAAS.uAug10 +12 AceView five_prime_UTR 53708082 53708225 . - . Parent=AAAS.uAug10 +12 AceView five_prime_UTR 53708535 53708633 . - . Parent=AAAS.uAug10 +12 AceView five_prime_UTR 53708878 53708924 . - . Parent=AAAS.uAug10 +12 AceView five_prime_UTR 53709119 53709210 . - . Parent=AAAS.uAug10 +12 AceView five_prime_UTR 53709511 53709566 . - . Parent=AAAS.uAug10 +12 AceView five_prime_UTR 53714349 53714476 . - . Parent=AAAS.uAug10 +12 AceView five_prime_UTR 53718476 53718648 . - . Parent=AAAS.uAug10 +12 AceView CDS 53701273 53701497 . - 0 Parent=AAAS.uAug10 +12 AceView CDS 53701629 53701713 . - 1 Parent=AAAS.uAug10 +12 AceView CDS 53701836 53701917 . - 2 Parent=AAAS.uAug10 +12 AceView CDS 53702066 53702111 . - 0 Parent=AAAS.uAug10 +12 AceView three_prime_UTR 53701245 53701272 . - . Parent=AAAS.uAug10 +12 AceView exon 53701245 53701497 . - . Parent=AAAS.uAug10 +12 AceView exon 53701629 53701713 . - . Parent=AAAS.uAug10 +12 AceView exon 53701836 53701917 . - . Parent=AAAS.uAug10 +12 AceView exon 53702066 53702133 . - . Parent=AAAS.uAug10 +12 AceView exon 53702229 53702312 . - . Parent=AAAS.uAug10 +12 AceView exon 53702509 53702599 . - . Parent=AAAS.uAug10 +12 AceView exon 53702744 53702804 . - . Parent=AAAS.uAug10 +12 AceView exon 53702941 53703065 . - . Parent=AAAS.uAug10 +12 AceView exon 53703385 53703505 . - . Parent=AAAS.uAug10 +12 AceView exon 53708082 53708225 . - . Parent=AAAS.uAug10 +12 AceView exon 53708535 53708633 . - . Parent=AAAS.uAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.uAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.uAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.uAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.uAug10 +12 AceView exon 53718476 53718648 . - . Parent=AAAS.uAug10 +12 AceView mRNA 53709336 53715343 . - . ID=AAAS.rAug10;Parent=AAAS +12 AceView five_prime_UTR 53715250 53715343 . - . Parent=AAAS.rAug10 +12 AceView CDS 53709413 53709566 . - 1 Parent=AAAS.rAug10 +12 AceView CDS 53714349 53714476 . - 0 Parent=AAAS.rAug10 +12 AceView CDS 53715127 53715249 . - 0 Parent=AAAS.rAug10 +12 AceView three_prime_UTR 53709336 53709412 . - . Parent=AAAS.rAug10 +12 AceView exon 53709336 53709566 . - . Parent=AAAS.rAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.rAug10 +12 AceView exon 53715127 53715343 . - . Parent=AAAS.rAug10 +12 AceView mRNA 53701241 53701917 . - . ID=AAAS.jAug10-unspliced;Parent=AAAS +12 AceView five_prime_UTR 53701827 53701917 . - . Parent=AAAS.jAug10-unspliced +12 AceView CDS 53701263 53701826 . - 0 Parent=AAAS.jAug10-unspliced +12 AceView three_prime_UTR 53701241 53701262 . - . Parent=AAAS.jAug10-unspliced +12 AceView exon 53701241 53701917 . - . Parent=AAAS.jAug10-unspliced +12 AceView mRNA 53701241 53718496 . - . ID=AAAS.fAug10;Parent=AAAS +12 AceView five_prime_UTR 53708186 53708633 . - . Parent=AAAS.fAug10 +12 AceView five_prime_UTR 53708878 53708924 . - . Parent=AAAS.fAug10 +12 AceView five_prime_UTR 53709119 53709210 . - . Parent=AAAS.fAug10 +12 AceView five_prime_UTR 53709511 53709566 . - . Parent=AAAS.fAug10 +12 AceView five_prime_UTR 53714349 53714476 . - . Parent=AAAS.fAug10 +12 AceView five_prime_UTR 53718346 53718496 . - . Parent=AAAS.fAug10 +12 AceView CDS 53701832 53701917 . - 2 Parent=AAAS.fAug10 +12 AceView CDS 53702066 53702133 . - 1 Parent=AAAS.fAug10 +12 AceView CDS 53702219 53702312 . - 2 Parent=AAAS.fAug10 +12 AceView CDS 53702509 53702599 . - 0 Parent=AAAS.fAug10 +12 AceView CDS 53702744 53702804 . - 1 Parent=AAAS.fAug10 +12 AceView CDS 53702941 53703065 . - 0 Parent=AAAS.fAug10 +12 AceView CDS 53703385 53703505 . - 1 Parent=AAAS.fAug10 +12 AceView CDS 53708082 53708185 . - 0 Parent=AAAS.fAug10 +12 AceView three_prime_UTR 53701241 53701497 . - . Parent=AAAS.fAug10 +12 AceView three_prime_UTR 53701629 53701831 . - . Parent=AAAS.fAug10 +12 AceView exon 53701241 53701497 . - . Parent=AAAS.fAug10 +12 AceView exon 53701629 53701917 . - . Parent=AAAS.fAug10 +12 AceView exon 53702066 53702133 . - . Parent=AAAS.fAug10 +12 AceView exon 53702219 53702312 . - . Parent=AAAS.fAug10 +12 AceView exon 53702509 53702599 . - . Parent=AAAS.fAug10 +12 AceView exon 53702744 53702804 . - . Parent=AAAS.fAug10 +12 AceView exon 53702941 53703065 . - . Parent=AAAS.fAug10 +12 AceView exon 53703385 53703505 . - . Parent=AAAS.fAug10 +12 AceView exon 53708082 53708633 . - . Parent=AAAS.fAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.fAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.fAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.fAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.fAug10 +12 AceView exon 53718346 53718496 . - . Parent=AAAS.fAug10 +12 AceView mRNA 53702941 53715767 . - . ID=AAAS.iAug10;Parent=AAAS +12 AceView five_prime_UTR 53709538 53709566 . - . Parent=AAAS.iAug10 +12 AceView five_prime_UTR 53714349 53714476 . - . Parent=AAAS.iAug10 +12 AceView five_prime_UTR 53715661 53715767 . - . Parent=AAAS.iAug10 +12 AceView CDS 53702943 53703065 . - 0 Parent=AAAS.iAug10 +12 AceView CDS 53703385 53703505 . - 1 Parent=AAAS.iAug10 +12 AceView CDS 53708082 53708225 . - 1 Parent=AAAS.iAug10 +12 AceView CDS 53708535 53708633 . - 1 Parent=AAAS.iAug10 +12 AceView CDS 53708878 53708924 . - 0 Parent=AAAS.iAug10 +12 AceView CDS 53709511 53709537 . - 0 Parent=AAAS.iAug10 +12 AceView three_prime_UTR 53702941 53702942 . - . Parent=AAAS.iAug10 +12 AceView exon 53702941 53703065 . - . Parent=AAAS.iAug10 +12 AceView exon 53703385 53703505 . - . Parent=AAAS.iAug10 +12 AceView exon 53708082 53708225 . - . Parent=AAAS.iAug10 +12 AceView exon 53708535 53708633 . - . Parent=AAAS.iAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.iAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.iAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.iAug10 +12 AceView exon 53715661 53715767 . - . Parent=AAAS.iAug10 +12 AceView transcript 53708738 53715393 . - . ID=AAAS.vaAug10;Parent=AAAS +12 AceView exon 53708738 53709566 . - . Parent=AAAS.vaAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.vaAug10 +12 AceView exon 53715255 53715393 . - . Parent=AAAS.vaAug10 +12 AceView mRNA 53701241 53715363 . - . ID=AAAS.gAug10;Parent=AAAS +12 AceView five_prime_UTR 53702789 53702804 . - . Parent=AAAS.gAug10 +12 AceView five_prime_UTR 53702941 53703065 . - . Parent=AAAS.gAug10 +12 AceView five_prime_UTR 53703385 53703505 . - . Parent=AAAS.gAug10 +12 AceView five_prime_UTR 53708082 53708225 . - . Parent=AAAS.gAug10 +12 AceView five_prime_UTR 53708878 53708924 . - . Parent=AAAS.gAug10 +12 AceView five_prime_UTR 53709119 53709210 . - . Parent=AAAS.gAug10 +12 AceView five_prime_UTR 53709511 53709566 . - . Parent=AAAS.gAug10 +12 AceView five_prime_UTR 53714349 53715363 . - . Parent=AAAS.gAug10 +12 AceView CDS 53701273 53701497 . - 0 Parent=AAAS.gAug10 +12 AceView CDS 53701629 53701713 . - 1 Parent=AAAS.gAug10 +12 AceView CDS 53701836 53701917 . - 2 Parent=AAAS.gAug10 +12 AceView CDS 53702066 53702133 . - 1 Parent=AAAS.gAug10 +12 AceView CDS 53702219 53702312 . - 2 Parent=AAAS.gAug10 +12 AceView CDS 53702509 53702599 . - 0 Parent=AAAS.gAug10 +12 AceView CDS 53702744 53702788 . - 0 Parent=AAAS.gAug10 +12 AceView three_prime_UTR 53701241 53701272 . - . Parent=AAAS.gAug10 +12 AceView exon 53701241 53701497 . - . Parent=AAAS.gAug10 +12 AceView exon 53701629 53701713 . - . Parent=AAAS.gAug10 +12 AceView exon 53701836 53701917 . - . Parent=AAAS.gAug10 +12 AceView exon 53702066 53702133 . - . Parent=AAAS.gAug10 +12 AceView exon 53702219 53702312 . - . Parent=AAAS.gAug10 +12 AceView exon 53702509 53702599 . - . Parent=AAAS.gAug10 +12 AceView exon 53702744 53702804 . - . Parent=AAAS.gAug10 +12 AceView exon 53702941 53703065 . - . Parent=AAAS.gAug10 +12 AceView exon 53703385 53703505 . - . Parent=AAAS.gAug10 +12 AceView exon 53708082 53708225 . - . Parent=AAAS.gAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.gAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.gAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.gAug10 +12 AceView exon 53714349 53715363 . - . Parent=AAAS.gAug10 +12 AceView mRNA 53701304 53715399 . - . ID=AAAS.hAug10;Parent=AAAS +12 AceView five_prime_UTR 53702789 53702804 . - . Parent=AAAS.hAug10 +12 AceView five_prime_UTR 53702941 53703065 . - . Parent=AAAS.hAug10 +12 AceView five_prime_UTR 53703385 53703505 . - . Parent=AAAS.hAug10 +12 AceView five_prime_UTR 53708082 53708225 . - . Parent=AAAS.hAug10 +12 AceView five_prime_UTR 53708535 53708633 . - . Parent=AAAS.hAug10 +12 AceView five_prime_UTR 53708878 53708924 . - . Parent=AAAS.hAug10 +12 AceView five_prime_UTR 53709119 53709210 . - . Parent=AAAS.hAug10 +12 AceView five_prime_UTR 53709511 53709566 . - . Parent=AAAS.hAug10 +12 AceView five_prime_UTR 53714349 53714476 . - . Parent=AAAS.hAug10 +12 AceView five_prime_UTR 53715255 53715399 . - . Parent=AAAS.hAug10 +12 AceView CDS 53701306 53701497 . - 0 Parent=AAAS.hAug10 +12 AceView CDS 53701629 53701713 . - 1 Parent=AAAS.hAug10 +12 AceView CDS 53701836 53701917 . - 2 Parent=AAAS.hAug10 +12 AceView CDS 53702066 53702133 . - 1 Parent=AAAS.hAug10 +12 AceView CDS 53702219 53702312 . - 2 Parent=AAAS.hAug10 +12 AceView CDS 53702509 53702599 . - 0 Parent=AAAS.hAug10 +12 AceView CDS 53702744 53702788 . - 0 Parent=AAAS.hAug10 +12 AceView three_prime_UTR 53701304 53701305 . - . Parent=AAAS.hAug10 +12 AceView exon 53701304 53701497 . - . Parent=AAAS.hAug10 +12 AceView exon 53701629 53701713 . - . Parent=AAAS.hAug10 +12 AceView exon 53701836 53701917 . - . Parent=AAAS.hAug10 +12 AceView exon 53702066 53702133 . - . Parent=AAAS.hAug10 +12 AceView exon 53702219 53702312 . - . Parent=AAAS.hAug10 +12 AceView exon 53702509 53702599 . - . Parent=AAAS.hAug10 +12 AceView exon 53702744 53702804 . - . Parent=AAAS.hAug10 +12 AceView exon 53702941 53703065 . - . Parent=AAAS.hAug10 +12 AceView exon 53703385 53703505 . - . Parent=AAAS.hAug10 +12 AceView exon 53708082 53708225 . - . Parent=AAAS.hAug10 +12 AceView exon 53708535 53708633 . - . Parent=AAAS.hAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.hAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.hAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.hAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.hAug10 +12 AceView exon 53715255 53715399 . - . Parent=AAAS.hAug10 +12 AceView mRNA 53701240 53715781 . - . ID=AAAS.bAug10;Parent=AAAS +12 AceView five_prime_UTR 53715781 53715781 . - . Parent=AAAS.bAug10 +12 AceView CDS 53701263 53701497 . - 1 Parent=AAAS.bAug10 +12 AceView CDS 53701836 53701917 . - 2 Parent=AAAS.bAug10 +12 AceView CDS 53702066 53702133 . - 1 Parent=AAAS.bAug10 +12 AceView CDS 53702219 53702312 . - 2 Parent=AAAS.bAug10 +12 AceView CDS 53702509 53702599 . - 0 Parent=AAAS.bAug10 +12 AceView CDS 53702744 53702804 . - 1 Parent=AAAS.bAug10 +12 AceView CDS 53702941 53703065 . - 0 Parent=AAAS.bAug10 +12 AceView CDS 53703385 53703505 . - 1 Parent=AAAS.bAug10 +12 AceView CDS 53708082 53708225 . - 1 Parent=AAAS.bAug10 +12 AceView CDS 53708535 53708633 . - 1 Parent=AAAS.bAug10 +12 AceView CDS 53708878 53708924 . - 0 Parent=AAAS.bAug10 +12 AceView CDS 53709119 53709210 . - 2 Parent=AAAS.bAug10 +12 AceView CDS 53709511 53709566 . - 1 Parent=AAAS.bAug10 +12 AceView CDS 53714349 53714476 . - 0 Parent=AAAS.bAug10 +12 AceView CDS 53715661 53715780 . - 0 Parent=AAAS.bAug10 +12 AceView three_prime_UTR 53701240 53701262 . - . Parent=AAAS.bAug10 +12 AceView exon 53701240 53701497 . - . Parent=AAAS.bAug10 +12 AceView exon 53701836 53701917 . - . Parent=AAAS.bAug10 +12 AceView exon 53702066 53702133 . - . Parent=AAAS.bAug10 +12 AceView exon 53702219 53702312 . - . Parent=AAAS.bAug10 +12 AceView exon 53702509 53702599 . - . Parent=AAAS.bAug10 +12 AceView exon 53702744 53702804 . - . Parent=AAAS.bAug10 +12 AceView exon 53702941 53703065 . - . Parent=AAAS.bAug10 +12 AceView exon 53703385 53703505 . - . Parent=AAAS.bAug10 +12 AceView exon 53708082 53708225 . - . Parent=AAAS.bAug10 +12 AceView exon 53708535 53708633 . - . Parent=AAAS.bAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.bAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.bAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.bAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.bAug10 +12 AceView exon 53715661 53715781 . - . Parent=AAAS.bAug10 +12 AceView transcript 53708184 53715042 . - . ID=AAAS.vbAug10;Parent=AAAS +12 AceView exon 53708184 53708225 . - . Parent=AAAS.vbAug10 +12 AceView exon 53708535 53708633 . - . Parent=AAAS.vbAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.vbAug10 +12 AceView exon 53709119 53709270 . - . Parent=AAAS.vbAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.vbAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.vbAug10 +12 AceView exon 53714985 53715042 . - . Parent=AAAS.vbAug10 +12 AceView mRNA 53708634 53715402 . - . ID=AAAS.lAug10;Parent=AAAS +12 AceView five_prime_UTR 53715250 53715402 . - . Parent=AAAS.lAug10 +12 AceView CDS 53708978 53709210 . - 2 Parent=AAAS.lAug10 +12 AceView CDS 53709511 53709566 . - 1 Parent=AAAS.lAug10 +12 AceView CDS 53714349 53714476 . - 0 Parent=AAAS.lAug10 +12 AceView CDS 53715127 53715249 . - 0 Parent=AAAS.lAug10 +12 AceView three_prime_UTR 53708634 53708977 . - . Parent=AAAS.lAug10 +12 AceView exon 53708634 53709210 . - . Parent=AAAS.lAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.lAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.lAug10 +12 AceView exon 53715127 53715402 . - . Parent=AAAS.lAug10 +12 AceView mRNA 53701241 53709028 . - . ID=AAAS.eAug10;Parent=AAAS +12 AceView five_prime_UTR 53708982 53709028 . - . Parent=AAAS.eAug10 +12 AceView CDS 53701263 53701497 . - 1 Parent=AAAS.eAug10 +12 AceView CDS 53701629 53701700 . - 1 Parent=AAAS.eAug10 +12 AceView CDS 53701836 53701917 . - 2 Parent=AAAS.eAug10 +12 AceView CDS 53702066 53702133 . - 1 Parent=AAAS.eAug10 +12 AceView CDS 53702219 53702312 . - 2 Parent=AAAS.eAug10 +12 AceView CDS 53702509 53702599 . - 0 Parent=AAAS.eAug10 +12 AceView CDS 53702744 53702804 . - 1 Parent=AAAS.eAug10 +12 AceView CDS 53702941 53703065 . - 0 Parent=AAAS.eAug10 +12 AceView CDS 53703385 53703505 . - 1 Parent=AAAS.eAug10 +12 AceView CDS 53708082 53708225 . - 1 Parent=AAAS.eAug10 +12 AceView CDS 53708535 53708633 . - 1 Parent=AAAS.eAug10 +12 AceView CDS 53708878 53708981 . - 0 Parent=AAAS.eAug10 +12 AceView three_prime_UTR 53701241 53701262 . - . Parent=AAAS.eAug10 +12 AceView exon 53701241 53701497 . - . Parent=AAAS.eAug10 +12 AceView exon 53701629 53701700 . - . Parent=AAAS.eAug10 +12 AceView exon 53701836 53701917 . - . Parent=AAAS.eAug10 +12 AceView exon 53702066 53702133 . - . Parent=AAAS.eAug10 +12 AceView exon 53702219 53702312 . - . Parent=AAAS.eAug10 +12 AceView exon 53702509 53702599 . - . Parent=AAAS.eAug10 +12 AceView exon 53702744 53702804 . - . Parent=AAAS.eAug10 +12 AceView exon 53702941 53703065 . - . Parent=AAAS.eAug10 +12 AceView exon 53703385 53703505 . - . Parent=AAAS.eAug10 +12 AceView exon 53708082 53708225 . - . Parent=AAAS.eAug10 +12 AceView exon 53708535 53708633 . - . Parent=AAAS.eAug10 +12 AceView exon 53708878 53709028 . - . Parent=AAAS.eAug10 +12 AceView mRNA 53708145 53714810 . - . ID=AAAS.qAug10;Parent=AAAS +12 AceView five_prime_UTR 53714447 53714810 . - . Parent=AAAS.qAug10 +12 AceView CDS 53708147 53708225 . - 1 Parent=AAAS.qAug10 +12 AceView CDS 53708535 53708633 . - 1 Parent=AAAS.qAug10 +12 AceView CDS 53708878 53708924 . - 0 Parent=AAAS.qAug10 +12 AceView CDS 53709119 53709210 . - 2 Parent=AAAS.qAug10 +12 AceView CDS 53709511 53709566 . - 1 Parent=AAAS.qAug10 +12 AceView CDS 53714349 53714446 . - 0 Parent=AAAS.qAug10 +12 AceView three_prime_UTR 53708145 53708146 . - . Parent=AAAS.qAug10 +12 AceView exon 53708145 53708225 . - . Parent=AAAS.qAug10 +12 AceView exon 53708535 53708633 . - . Parent=AAAS.qAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.qAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.qAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.qAug10 +12 AceView exon 53714349 53714810 . - . Parent=AAAS.qAug10 +12 AceView mRNA 53703008 53715363 . - . ID=AAAS.pAug10;Parent=AAAS +12 AceView five_prime_UTR 53709538 53709566 . - . Parent=AAAS.pAug10 +12 AceView five_prime_UTR 53714349 53714476 . - . Parent=AAAS.pAug10 +12 AceView five_prime_UTR 53715127 53715363 . - . Parent=AAAS.pAug10 +12 AceView CDS 53703009 53703065 . - 0 Parent=AAAS.pAug10 +12 AceView CDS 53703385 53703505 . - 1 Parent=AAAS.pAug10 +12 AceView CDS 53708082 53708225 . - 1 Parent=AAAS.pAug10 +12 AceView CDS 53708535 53708633 . - 1 Parent=AAAS.pAug10 +12 AceView CDS 53708878 53708924 . - 0 Parent=AAAS.pAug10 +12 AceView CDS 53709511 53709537 . - 0 Parent=AAAS.pAug10 +12 AceView three_prime_UTR 53703008 53703008 . - . Parent=AAAS.pAug10 +12 AceView exon 53703008 53703065 . - . Parent=AAAS.pAug10 +12 AceView exon 53703385 53703505 . - . Parent=AAAS.pAug10 +12 AceView exon 53708082 53708225 . - . Parent=AAAS.pAug10 +12 AceView exon 53708535 53708633 . - . Parent=AAAS.pAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.pAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.pAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.pAug10 +12 AceView exon 53715127 53715363 . - . Parent=AAAS.pAug10 +12 AceView mRNA 53703423 53715351 . - . ID=AAAS.oAug10;Parent=AAAS +12 AceView five_prime_UTR 53714447 53714476 . - . Parent=AAAS.oAug10 +12 AceView five_prime_UTR 53715255 53715351 . - . Parent=AAAS.oAug10 +12 AceView CDS 53703424 53703505 . - 1 Parent=AAAS.oAug10 +12 AceView CDS 53708082 53708225 . - 1 Parent=AAAS.oAug10 +12 AceView CDS 53708878 53708924 . - 0 Parent=AAAS.oAug10 +12 AceView CDS 53709119 53709210 . - 2 Parent=AAAS.oAug10 +12 AceView CDS 53709511 53709566 . - 1 Parent=AAAS.oAug10 +12 AceView CDS 53714349 53714446 . - 0 Parent=AAAS.oAug10 +12 AceView three_prime_UTR 53703423 53703423 . - . Parent=AAAS.oAug10 +12 AceView exon 53703423 53703505 . - . Parent=AAAS.oAug10 +12 AceView exon 53708082 53708225 . - . Parent=AAAS.oAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.oAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.oAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.oAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.oAug10 +12 AceView exon 53715255 53715351 . - . Parent=AAAS.oAug10 +12 AceView mRNA 53701240 53715416 . - . ID=AAAS.cAug10;Parent=AAAS +12 AceView five_prime_UTR 53715250 53715416 . - . Parent=AAAS.cAug10 +12 AceView CDS 53701273 53701497 . - 0 Parent=AAAS.cAug10 +12 AceView CDS 53701629 53701713 . - 1 Parent=AAAS.cAug10 +12 AceView CDS 53701836 53701917 . - 2 Parent=AAAS.cAug10 +12 AceView CDS 53702066 53702133 . - 1 Parent=AAAS.cAug10 +12 AceView CDS 53702219 53702312 . - 2 Parent=AAAS.cAug10 +12 AceView CDS 53702509 53702599 . - 0 Parent=AAAS.cAug10 +12 AceView CDS 53702744 53702804 . - 1 Parent=AAAS.cAug10 +12 AceView CDS 53702941 53703065 . - 0 Parent=AAAS.cAug10 +12 AceView CDS 53703385 53703505 . - 1 Parent=AAAS.cAug10 +12 AceView CDS 53708082 53708225 . - 1 Parent=AAAS.cAug10 +12 AceView CDS 53708878 53708924 . - 0 Parent=AAAS.cAug10 +12 AceView CDS 53709119 53709210 . - 2 Parent=AAAS.cAug10 +12 AceView CDS 53709511 53709566 . - 1 Parent=AAAS.cAug10 +12 AceView CDS 53714349 53714476 . - 0 Parent=AAAS.cAug10 +12 AceView CDS 53715127 53715249 . - 0 Parent=AAAS.cAug10 +12 AceView three_prime_UTR 53701240 53701272 . - . Parent=AAAS.cAug10 +12 AceView exon 53701240 53701497 . - . Parent=AAAS.cAug10 +12 AceView exon 53701629 53701713 . - . Parent=AAAS.cAug10 +12 AceView exon 53701836 53701917 . - . Parent=AAAS.cAug10 +12 AceView exon 53702066 53702133 . - . Parent=AAAS.cAug10 +12 AceView exon 53702219 53702312 . - . Parent=AAAS.cAug10 +12 AceView exon 53702509 53702599 . - . Parent=AAAS.cAug10 +12 AceView exon 53702744 53702804 . - . Parent=AAAS.cAug10 +12 AceView exon 53702941 53703065 . - . Parent=AAAS.cAug10 +12 AceView exon 53703385 53703505 . - . Parent=AAAS.cAug10 +12 AceView exon 53708082 53708225 . - . Parent=AAAS.cAug10 +12 AceView exon 53708878 53708924 . - . Parent=AAAS.cAug10 +12 AceView exon 53709119 53709210 . - . Parent=AAAS.cAug10 +12 AceView exon 53709511 53709566 . - . Parent=AAAS.cAug10 +12 AceView exon 53714349 53714476 . - . Parent=AAAS.cAug10 +12 AceView exon 53715127 53715416 . - . Parent=AAAS.cAug10 +12 AceView gene 9220302 9280190 . - . ID=A2M;Name=A2M +12 AceView mRNA 9220338 9268615 . - . ID=A2M.cAug10;Parent=A2M +12 AceView five_prime_UTR 9267744 9268032 . - . Parent=A2M.cAug10 +12 AceView five_prime_UTR 9268360 9268615 . - . Parent=A2M.cAug10 +12 AceView CDS 9220419 9220435 . - 1 Parent=A2M.cAug10 +12 AceView CDS 9220779 9220820 . - 1 Parent=A2M.cAug10 +12 AceView CDS 9221336 9221438 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9222341 9222409 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9223084 9223174 . - 0 Parent=A2M.cAug10 +12 AceView CDS 9224955 9225082 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9225249 9225467 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9227156 9227379 . - 1 Parent=A2M.cAug10 +12 AceView CDS 9229352 9229532 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9229942 9230016 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9230297 9230453 . - 0 Parent=A2M.cAug10 +12 AceView CDS 9231840 9231927 . - 1 Parent=A2M.cAug10 +12 AceView CDS 9232235 9232411 . - 1 Parent=A2M.cAug10 +12 AceView CDS 9232690 9232773 . - 1 Parent=A2M.cAug10 +12 AceView CDS 9241796 9241847 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9242498 9242619 . - 1 Parent=A2M.cAug10 +12 AceView CDS 9242952 9243078 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9243797 9244025 . - 0 Parent=A2M.cAug10 +12 AceView CDS 9246061 9246175 . - 1 Parent=A2M.cAug10 +12 AceView CDS 9247569 9247680 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9248135 9248296 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9251203 9251352 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9251977 9252119 . - 1 Parent=A2M.cAug10 +12 AceView CDS 9253740 9253803 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9254043 9254270 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9256835 9256996 . - 2 Parent=A2M.cAug10 +12 AceView CDS 9258832 9258941 . - 1 Parent=A2M.cAug10 +12 AceView CDS 9259087 9259109 . - 0 Parent=A2M.cAug10 +12 AceView three_prime_UTR 9220338 9220418 . - . Parent=A2M.cAug10 +12 AceView exon 9220338 9220435 . - . Parent=A2M.cAug10 +12 AceView exon 9220779 9220820 . - . Parent=A2M.cAug10 +12 AceView exon 9221336 9221438 . - . Parent=A2M.cAug10 +12 AceView exon 9222341 9222409 . - . Parent=A2M.cAug10 +12 AceView exon 9223084 9223174 . - . Parent=A2M.cAug10 +12 AceView exon 9224955 9225082 . - . Parent=A2M.cAug10 +12 AceView exon 9225249 9225467 . - . Parent=A2M.cAug10 +12 AceView exon 9227156 9227379 . - . Parent=A2M.cAug10 +12 AceView exon 9229352 9229532 . - . Parent=A2M.cAug10 +12 AceView exon 9229942 9230016 . - . Parent=A2M.cAug10 +12 AceView exon 9230297 9230453 . - . Parent=A2M.cAug10 +12 AceView exon 9231840 9231927 . - . Parent=A2M.cAug10 +12 AceView exon 9232235 9232411 . - . Parent=A2M.cAug10 +12 AceView exon 9232690 9232773 . - . Parent=A2M.cAug10 +12 AceView exon 9241796 9241847 . - . Parent=A2M.cAug10 +12 AceView exon 9242498 9242619 . - . Parent=A2M.cAug10 +12 AceView exon 9242952 9243078 . - . Parent=A2M.cAug10 +12 AceView exon 9243797 9244025 . - . Parent=A2M.cAug10 +12 AceView exon 9246061 9246175 . - . Parent=A2M.cAug10 +12 AceView exon 9247569 9247680 . - . Parent=A2M.cAug10 +12 AceView exon 9248135 9248296 . - . Parent=A2M.cAug10 +12 AceView exon 9251203 9251352 . - . Parent=A2M.cAug10 +12 AceView exon 9251977 9252119 . - . Parent=A2M.cAug10 +12 AceView exon 9253740 9253803 . - . Parent=A2M.cAug10 +12 AceView exon 9254043 9254270 . - . Parent=A2M.cAug10 +12 AceView exon 9256835 9256996 . - . Parent=A2M.cAug10 +12 AceView exon 9258832 9258941 . - . Parent=A2M.cAug10 +12 AceView exon 9259087 9259109 . - . Parent=A2M.cAug10 +12 AceView exon 9267744 9268032 . - . Parent=A2M.cAug10 +12 AceView exon 9268360 9268615 . - . Parent=A2M.cAug10 +12 AceView mRNA 9231967 9243127 . - . ID=A2M.gAug10;Parent=A2M +12 AceView five_prime_UTR 9243127 9243127 . - . Parent=A2M.gAug10 +12 AceView CDS 9232655 9232773 . - 2 Parent=A2M.gAug10 +12 AceView CDS 9241796 9241847 . - 0 Parent=A2M.gAug10 +12 AceView CDS 9242498 9242619 . - 2 Parent=A2M.gAug10 +12 AceView CDS 9242952 9243126 . - 0 Parent=A2M.gAug10 +12 AceView three_prime_UTR 9231967 9232654 . - . Parent=A2M.gAug10 +12 AceView exon 9231967 9232773 . - . Parent=A2M.gAug10 +12 AceView exon 9241796 9241847 . - . Parent=A2M.gAug10 +12 AceView exon 9242498 9242619 . - . Parent=A2M.gAug10 +12 AceView exon 9242952 9243127 . - . Parent=A2M.gAug10 +12 AceView transcript 9220303 9220835 . - . ID=A2M.qAug10-unspliced;Parent=A2M +12 AceView exon 9220303 9220835 . - . Parent=A2M.qAug10-unspliced +12 AceView mRNA 9220308 9221674 . - . ID=A2M.iAug10;Parent=A2M +12 AceView five_prime_UTR 9221354 9221674 . - . Parent=A2M.iAug10 +12 AceView CDS 9220340 9220435 . - 0 Parent=A2M.iAug10 +12 AceView CDS 9220779 9220820 . - 0 Parent=A2M.iAug10 +12 AceView CDS 9221336 9221353 . - 0 Parent=A2M.iAug10 +12 AceView three_prime_UTR 9220308 9220339 . - . Parent=A2M.iAug10 +12 AceView exon 9220308 9220435 . - . Parent=A2M.iAug10 +12 AceView exon 9220779 9220820 . - . Parent=A2M.iAug10 +12 AceView exon 9221336 9221674 . - . Parent=A2M.iAug10 +12 AceView mRNA 9250980 9254152 . - . ID=A2M.eAug10;Parent=A2M +12 AceView five_prime_UTR 9254151 9254152 . - . Parent=A2M.eAug10 +12 AceView CDS 9251137 9251352 . - 0 Parent=A2M.eAug10 +12 AceView CDS 9251977 9252119 . - 2 Parent=A2M.eAug10 +12 AceView CDS 9253740 9253803 . - 0 Parent=A2M.eAug10 +12 AceView CDS 9254043 9254150 . - 0 Parent=A2M.eAug10 +12 AceView three_prime_UTR 9250980 9251136 . - . Parent=A2M.eAug10 +12 AceView exon 9250980 9251352 . - . Parent=A2M.eAug10 +12 AceView exon 9251977 9252119 . - . Parent=A2M.eAug10 +12 AceView exon 9253740 9253803 . - . Parent=A2M.eAug10 +12 AceView exon 9254043 9254152 . - . Parent=A2M.eAug10 +12 AceView transcript 9267168 9268562 . - . ID=A2M.kAug10-unspliced;Parent=A2M +12 AceView exon 9267168 9268562 . - . Parent=A2M.kAug10-unspliced +12 AceView mRNA 9220347 9232424 . - . ID=A2M.dAug10;Parent=A2M +12 AceView CDS 9220419 9220435 . - 2 Parent=A2M.dAug10 +12 AceView CDS 9220779 9220820 . - 2 Parent=A2M.dAug10 +12 AceView CDS 9221336 9221438 . - 0 Parent=A2M.dAug10 +12 AceView CDS 9222341 9222409 . - 0 Parent=A2M.dAug10 +12 AceView CDS 9223084 9223174 . - 1 Parent=A2M.dAug10 +12 AceView CDS 9224955 9225082 . - 0 Parent=A2M.dAug10 +12 AceView CDS 9225249 9225467 . - 0 Parent=A2M.dAug10 +12 AceView CDS 9227156 9227379 . - 2 Parent=A2M.dAug10 +12 AceView CDS 9229352 9229532 . - 0 Parent=A2M.dAug10 +12 AceView CDS 9229942 9230016 . - 0 Parent=A2M.dAug10 +12 AceView CDS 9230297 9230453 . - 1 Parent=A2M.dAug10 +12 AceView CDS 9231840 9231927 . - 2 Parent=A2M.dAug10 +12 AceView CDS 9232235 9232424 . - 0 Parent=A2M.dAug10 +12 AceView three_prime_UTR 9220347 9220418 . - . Parent=A2M.dAug10 +12 AceView exon 9220347 9220435 . - . Parent=A2M.dAug10 +12 AceView exon 9220779 9220820 . - . Parent=A2M.dAug10 +12 AceView exon 9221336 9221438 . - . Parent=A2M.dAug10 +12 AceView exon 9222341 9222409 . - . Parent=A2M.dAug10 +12 AceView exon 9223084 9223174 . - . Parent=A2M.dAug10 +12 AceView exon 9224955 9225082 . - . Parent=A2M.dAug10 +12 AceView exon 9225249 9225467 . - . Parent=A2M.dAug10 +12 AceView exon 9227156 9227379 . - . Parent=A2M.dAug10 +12 AceView exon 9229352 9229532 . - . Parent=A2M.dAug10 +12 AceView exon 9229942 9230016 . - . Parent=A2M.dAug10 +12 AceView exon 9230297 9230453 . - . Parent=A2M.dAug10 +12 AceView exon 9231840 9231927 . - . Parent=A2M.dAug10 +12 AceView exon 9232235 9232424 . - . Parent=A2M.dAug10 +12 AceView mRNA 9220302 9268798 . - . ID=A2M.aAug10;Parent=A2M +12 AceView five_prime_UTR 9268446 9268798 . - . Parent=A2M.aAug10 +12 AceView CDS 9220419 9220435 . - 2 Parent=A2M.aAug10 +12 AceView CDS 9220779 9220820 . - 2 Parent=A2M.aAug10 +12 AceView CDS 9221336 9221438 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9222341 9222409 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9223084 9223174 . - 1 Parent=A2M.aAug10 +12 AceView CDS 9224955 9225082 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9225249 9225467 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9227156 9227379 . - 2 Parent=A2M.aAug10 +12 AceView CDS 9229352 9229532 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9229942 9230016 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9230297 9230453 . - 1 Parent=A2M.aAug10 +12 AceView CDS 9231840 9231927 . - 2 Parent=A2M.aAug10 +12 AceView CDS 9232235 9232411 . - 2 Parent=A2M.aAug10 +12 AceView CDS 9232690 9232773 . - 2 Parent=A2M.aAug10 +12 AceView CDS 9241796 9241847 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9242498 9242619 . - 2 Parent=A2M.aAug10 +12 AceView CDS 9242952 9243078 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9243797 9244025 . - 1 Parent=A2M.aAug10 +12 AceView CDS 9246061 9246175 . - 2 Parent=A2M.aAug10 +12 AceView CDS 9247569 9247680 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9248135 9248296 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9251203 9251352 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9251977 9252119 . - 2 Parent=A2M.aAug10 +12 AceView CDS 9253740 9253803 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9254043 9254270 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9256835 9256996 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9258832 9258941 . - 2 Parent=A2M.aAug10 +12 AceView CDS 9259087 9259201 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9260120 9260240 . - 1 Parent=A2M.aAug10 +12 AceView CDS 9261917 9262001 . - 2 Parent=A2M.aAug10 +12 AceView CDS 9262463 9262631 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9262910 9262930 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9264755 9264807 . - 2 Parent=A2M.aAug10 +12 AceView CDS 9264973 9265132 . - 0 Parent=A2M.aAug10 +12 AceView CDS 9265956 9266139 . - 1 Parent=A2M.aAug10 +12 AceView CDS 9268360 9268445 . - 0 Parent=A2M.aAug10 +12 AceView three_prime_UTR 9220302 9220418 . - . Parent=A2M.aAug10 +12 AceView exon 9220302 9220435 . - . Parent=A2M.aAug10 +12 AceView exon 9220779 9220820 . - . Parent=A2M.aAug10 +12 AceView exon 9221336 9221438 . - . Parent=A2M.aAug10 +12 AceView exon 9222341 9222409 . - . Parent=A2M.aAug10 +12 AceView exon 9223084 9223174 . - . Parent=A2M.aAug10 +12 AceView exon 9224955 9225082 . - . Parent=A2M.aAug10 +12 AceView exon 9225249 9225467 . - . Parent=A2M.aAug10 +12 AceView exon 9227156 9227379 . - . Parent=A2M.aAug10 +12 AceView exon 9229352 9229532 . - . Parent=A2M.aAug10 +12 AceView exon 9229942 9230016 . - . Parent=A2M.aAug10 +12 AceView exon 9230297 9230453 . - . Parent=A2M.aAug10 +12 AceView exon 9231840 9231927 . - . Parent=A2M.aAug10 +12 AceView exon 9232235 9232411 . - . Parent=A2M.aAug10 +12 AceView exon 9232690 9232773 . - . Parent=A2M.aAug10 +12 AceView exon 9241796 9241847 . - . Parent=A2M.aAug10 +12 AceView exon 9242498 9242619 . - . Parent=A2M.aAug10 +12 AceView exon 9242952 9243078 . - . Parent=A2M.aAug10 +12 AceView exon 9243797 9244025 . - . Parent=A2M.aAug10 +12 AceView exon 9246061 9246175 . - . Parent=A2M.aAug10 +12 AceView exon 9247569 9247680 . - . Parent=A2M.aAug10 +12 AceView exon 9248135 9248296 . - . Parent=A2M.aAug10 +12 AceView exon 9251203 9251352 . - . Parent=A2M.aAug10 +12 AceView exon 9251977 9252119 . - . Parent=A2M.aAug10 +12 AceView exon 9253740 9253803 . - . Parent=A2M.aAug10 +12 AceView exon 9254043 9254270 . - . Parent=A2M.aAug10 +12 AceView exon 9256835 9256996 . - . Parent=A2M.aAug10 +12 AceView exon 9258832 9258941 . - . Parent=A2M.aAug10 +12 AceView exon 9259087 9259201 . - . Parent=A2M.aAug10 +12 AceView exon 9260120 9260240 . - . Parent=A2M.aAug10 +12 AceView exon 9261917 9262001 . - . Parent=A2M.aAug10 +12 AceView exon 9262463 9262631 . - . Parent=A2M.aAug10 +12 AceView exon 9262910 9262930 . - . Parent=A2M.aAug10 +12 AceView exon 9264755 9264807 . - . Parent=A2M.aAug10 +12 AceView exon 9264973 9265132 . - . Parent=A2M.aAug10 +12 AceView exon 9265956 9266139 . - . Parent=A2M.aAug10 +12 AceView exon 9268360 9268798 . - . Parent=A2M.aAug10 +12 AceView transcript 9266039 9280190 . - . ID=A2M.pAug10;Parent=A2M +12 AceView exon 9266039 9266139 . - . Parent=A2M.pAug10 +12 AceView exon 9277938 9278039 . - . Parent=A2M.pAug10 +12 AceView exon 9279666 9280190 . - . Parent=A2M.pAug10 +12 AceView mRNA 9220311 9221551 . - . ID=A2M.hAug10;Parent=A2M +12 AceView five_prime_UTR 9221424 9221551 . - . Parent=A2M.hAug10 +12 AceView CDS 9220648 9220820 . - 2 Parent=A2M.hAug10 +12 AceView CDS 9221336 9221423 . - 0 Parent=A2M.hAug10 +12 AceView three_prime_UTR 9220311 9220647 . - . Parent=A2M.hAug10 +12 AceView exon 9220311 9220820 . - . Parent=A2M.hAug10 +12 AceView exon 9221336 9221551 . - . Parent=A2M.hAug10 +12 AceView mRNA 9220371 9268456 . - . ID=A2M.bAug10;Parent=A2M +12 AceView five_prime_UTR 9264788 9264807 . - . Parent=A2M.bAug10 +12 AceView five_prime_UTR 9265956 9266139 . - . Parent=A2M.bAug10 +12 AceView five_prime_UTR 9268360 9268456 . - . Parent=A2M.bAug10 +12 AceView CDS 9220419 9220435 . - 2 Parent=A2M.bAug10 +12 AceView CDS 9220779 9220820 . - 2 Parent=A2M.bAug10 +12 AceView CDS 9221336 9221438 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9222341 9222409 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9223084 9223174 . - 1 Parent=A2M.bAug10 +12 AceView CDS 9224955 9225082 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9225249 9225467 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9227156 9227379 . - 2 Parent=A2M.bAug10 +12 AceView CDS 9229352 9229532 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9229942 9230016 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9230297 9230453 . - 1 Parent=A2M.bAug10 +12 AceView CDS 9231840 9231927 . - 2 Parent=A2M.bAug10 +12 AceView CDS 9232235 9232411 . - 2 Parent=A2M.bAug10 +12 AceView CDS 9232690 9232773 . - 2 Parent=A2M.bAug10 +12 AceView CDS 9241796 9241847 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9242498 9242619 . - 2 Parent=A2M.bAug10 +12 AceView CDS 9242952 9243078 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9243797 9244025 . - 1 Parent=A2M.bAug10 +12 AceView CDS 9246061 9246175 . - 2 Parent=A2M.bAug10 +12 AceView CDS 9247569 9247680 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9248135 9248296 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9251203 9251352 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9251977 9252119 . - 2 Parent=A2M.bAug10 +12 AceView CDS 9253740 9253803 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9254043 9254270 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9256835 9256996 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9258832 9258941 . - 2 Parent=A2M.bAug10 +12 AceView CDS 9259087 9259201 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9260120 9260240 . - 1 Parent=A2M.bAug10 +12 AceView CDS 9261917 9262001 . - 2 Parent=A2M.bAug10 +12 AceView CDS 9262463 9262631 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9262910 9262930 . - 0 Parent=A2M.bAug10 +12 AceView CDS 9264755 9264787 . - 0 Parent=A2M.bAug10 +12 AceView three_prime_UTR 9220371 9220418 . - . Parent=A2M.bAug10 +12 AceView exon 9220371 9220435 . - . Parent=A2M.bAug10 +12 AceView exon 9220779 9220820 . - . Parent=A2M.bAug10 +12 AceView exon 9221336 9221438 . - . Parent=A2M.bAug10 +12 AceView exon 9222341 9222409 . - . Parent=A2M.bAug10 +12 AceView exon 9223084 9223174 . - . Parent=A2M.bAug10 +12 AceView exon 9224955 9225082 . - . Parent=A2M.bAug10 +12 AceView exon 9225249 9225467 . - . Parent=A2M.bAug10 +12 AceView exon 9227156 9227379 . - . Parent=A2M.bAug10 +12 AceView exon 9229352 9229532 . - . Parent=A2M.bAug10 +12 AceView exon 9229942 9230016 . - . Parent=A2M.bAug10 +12 AceView exon 9230297 9230453 . - . Parent=A2M.bAug10 +12 AceView exon 9231840 9231927 . - . Parent=A2M.bAug10 +12 AceView exon 9232235 9232411 . - . Parent=A2M.bAug10 +12 AceView exon 9232690 9232773 . - . Parent=A2M.bAug10 +12 AceView exon 9241796 9241847 . - . Parent=A2M.bAug10 +12 AceView exon 9242498 9242619 . - . Parent=A2M.bAug10 +12 AceView exon 9242952 9243078 . - . Parent=A2M.bAug10 +12 AceView exon 9243797 9244025 . - . Parent=A2M.bAug10 +12 AceView exon 9246061 9246175 . - . Parent=A2M.bAug10 +12 AceView exon 9247569 9247680 . - . Parent=A2M.bAug10 +12 AceView exon 9248135 9248296 . - . Parent=A2M.bAug10 +12 AceView exon 9251203 9251352 . - . Parent=A2M.bAug10 +12 AceView exon 9251977 9252119 . - . Parent=A2M.bAug10 +12 AceView exon 9253740 9253803 . - . Parent=A2M.bAug10 +12 AceView exon 9254043 9254270 . - . Parent=A2M.bAug10 +12 AceView exon 9256835 9256996 . - . Parent=A2M.bAug10 +12 AceView exon 9258832 9258941 . - . Parent=A2M.bAug10 +12 AceView exon 9259087 9259201 . - . Parent=A2M.bAug10 +12 AceView exon 9260120 9260240 . - . Parent=A2M.bAug10 +12 AceView exon 9261917 9262001 . - . Parent=A2M.bAug10 +12 AceView exon 9262463 9262631 . - . Parent=A2M.bAug10 +12 AceView exon 9262910 9262930 . - . Parent=A2M.bAug10 +12 AceView exon 9264755 9264807 . - . Parent=A2M.bAug10 +12 AceView exon 9265956 9266139 . - . Parent=A2M.bAug10 +12 AceView exon 9268360 9268456 . - . Parent=A2M.bAug10 +12 AceView mRNA 9262622 9268825 . - . ID=A2M.fAug10;Parent=A2M +12 AceView five_prime_UTR 9268446 9268462 . - . Parent=A2M.fAug10 +12 AceView five_prime_UTR 9268724 9268825 . - . Parent=A2M.fAug10 +12 AceView CDS 9262623 9262631 . - 0 Parent=A2M.fAug10 +12 AceView CDS 9262910 9262930 . - 0 Parent=A2M.fAug10 +12 AceView CDS 9264755 9264807 . - 2 Parent=A2M.fAug10 +12 AceView CDS 9264973 9265132 . - 0 Parent=A2M.fAug10 +12 AceView CDS 9265956 9266139 . - 1 Parent=A2M.fAug10 +12 AceView CDS 9268360 9268445 . - 0 Parent=A2M.fAug10 +12 AceView three_prime_UTR 9262622 9262622 . - . Parent=A2M.fAug10 +12 AceView exon 9262622 9262631 . - . Parent=A2M.fAug10 +12 AceView exon 9262910 9262930 . - . Parent=A2M.fAug10 +12 AceView exon 9264755 9264807 . - . Parent=A2M.fAug10 +12 AceView exon 9264973 9265132 . - . Parent=A2M.fAug10 +12 AceView exon 9265956 9266139 . - . Parent=A2M.fAug10 +12 AceView exon 9268360 9268462 . - . Parent=A2M.fAug10 +12 AceView exon 9268724 9268825 . - . Parent=A2M.fAug10 +22 AceView gene 43088118 43117306 . - . ID=A4GALT;Name=A4GALT +22 AceView transcript 43089551 43116875 . - . ID=A4GALT.hAug10;Parent=A4GALT +22 AceView exon 43089551 43090003 . - . Parent=A4GALT.hAug10 +22 AceView exon 43091581 43091637 . - . Parent=A4GALT.hAug10 +22 AceView exon 43116803 43116875 . - . Parent=A4GALT.hAug10 +22 AceView mRNA 43088896 43117299 . - . ID=A4GALT.aAug10;Parent=A4GALT +22 AceView five_prime_UTR 43089958 43090003 . - . Parent=A4GALT.aAug10 +22 AceView five_prime_UTR 43091497 43091637 . - . Parent=A4GALT.aAug10 +22 AceView five_prime_UTR 43117171 43117299 . - . Parent=A4GALT.aAug10 +22 AceView CDS 43088896 43089957 . - 0 Parent=A4GALT.aAug10 +22 AceView exon 43088896 43090003 . - . Parent=A4GALT.aAug10 +22 AceView exon 43091497 43091637 . - . Parent=A4GALT.aAug10 +22 AceView exon 43117171 43117299 . - . Parent=A4GALT.aAug10 +22 AceView transcript 43089977 43116875 . - . ID=A4GALT.gAug10;Parent=A4GALT +22 AceView exon 43089977 43090003 . - . Parent=A4GALT.gAug10 +22 AceView exon 43091152 43091637 . - . Parent=A4GALT.gAug10 +22 AceView exon 43116803 43116875 . - . Parent=A4GALT.gAug10 +22 AceView mRNA 43088118 43117306 . - . ID=A4GALT.bAug10;Parent=A4GALT +22 AceView five_prime_UTR 43090712 43091637 . - . Parent=A4GALT.bAug10 +22 AceView five_prime_UTR 43117171 43117306 . - . Parent=A4GALT.bAug10 +22 AceView CDS 43089846 43090003 . - 2 Parent=A4GALT.bAug10 +22 AceView CDS 43090549 43090711 . - 0 Parent=A4GALT.bAug10 +22 AceView three_prime_UTR 43088118 43089845 . - . Parent=A4GALT.bAug10 +22 AceView exon 43088118 43090003 . - . Parent=A4GALT.bAug10 +22 AceView exon 43090549 43091637 . - . Parent=A4GALT.bAug10 +22 AceView exon 43117171 43117306 . - . Parent=A4GALT.bAug10 +22 AceView mRNA 43088128 43116875 . - . ID=A4GALT.cAug10;Parent=A4GALT +22 AceView five_prime_UTR 43089958 43090003 . - . Parent=A4GALT.cAug10 +22 AceView five_prime_UTR 43091497 43091637 . - . Parent=A4GALT.cAug10 +22 AceView five_prime_UTR 43116803 43116875 . - . Parent=A4GALT.cAug10 +22 AceView CDS 43088896 43089957 . - 0 Parent=A4GALT.cAug10 +22 AceView three_prime_UTR 43088128 43088895 . - . Parent=A4GALT.cAug10 +22 AceView exon 43088128 43090003 . - . Parent=A4GALT.cAug10 +22 AceView exon 43091497 43091637 . - . Parent=A4GALT.cAug10 +22 AceView exon 43116803 43116875 . - . Parent=A4GALT.cAug10 +22 AceView mRNA 43089188 43117249 . - . ID=A4GALT.dAug10;Parent=A4GALT +22 AceView five_prime_UTR 43117249 43117249 . - . Parent=A4GALT.dAug10 +22 AceView CDS 43089797 43090003 . - 0 Parent=A4GALT.dAug10 +22 AceView CDS 43117171 43117248 . - 0 Parent=A4GALT.dAug10 +22 AceView three_prime_UTR 43089188 43089796 . - . Parent=A4GALT.dAug10 +22 AceView exon 43089188 43090003 . - . Parent=A4GALT.dAug10 +22 AceView exon 43117171 43117249 . - . Parent=A4GALT.dAug10 +22 AceView transcript 43089851 43116875 . - . ID=A4GALT.jAug10;Parent=A4GALT +22 AceView exon 43089851 43089998 . - . Parent=A4GALT.jAug10 +22 AceView exon 43091497 43091637 . - . Parent=A4GALT.jAug10 +22 AceView exon 43116803 43116875 . - . Parent=A4GALT.jAug10 +22 AceView mRNA 43089598 43117281 . - . ID=A4GALT.fAug10;Parent=A4GALT +22 AceView five_prime_UTR 43117254 43117281 . - . Parent=A4GALT.fAug10 +22 AceView CDS 43089970 43090003 . - 1 Parent=A4GALT.fAug10 +22 AceView CDS 43091581 43091637 . - 1 Parent=A4GALT.fAug10 +22 AceView CDS 43117171 43117253 . - 0 Parent=A4GALT.fAug10 +22 AceView three_prime_UTR 43089598 43089969 . - . Parent=A4GALT.fAug10 +22 AceView exon 43089598 43090003 . - . Parent=A4GALT.fAug10 +22 AceView exon 43091581 43091637 . - . Parent=A4GALT.fAug10 +22 AceView exon 43117171 43117281 . - . Parent=A4GALT.fAug10 +22 AceView mRNA 43089470 43116875 . - . ID=A4GALT.eAug10;Parent=A4GALT +22 AceView five_prime_UTR 43116875 43116875 . - . Parent=A4GALT.eAug10 +22 AceView CDS 43089797 43090003 . - 0 Parent=A4GALT.eAug10 +22 AceView CDS 43116803 43116874 . - 0 Parent=A4GALT.eAug10 +22 AceView three_prime_UTR 43089470 43089796 . - . Parent=A4GALT.eAug10 +22 AceView exon 43089470 43090003 . - . Parent=A4GALT.eAug10 +22 AceView exon 43116803 43116875 . - . Parent=A4GALT.eAug10 +11 AceView gene 111933358 111934981 . - . ID=2-oxoacid_dh;Name=2-oxoacid_dh +11 AceView transcript 111933358 111934981 . - . ID=2-oxoacid_dh.aAug10-unspliced;Parent=2-oxoacid_dh +11 AceView exon 111933358 111934981 . - . Parent=2-oxoacid_dh.aAug10-unspliced +4 AceView gene 170981367 171012849 . - . ID=AADAT;Name=AADAT +4 AceView mRNA 170991770 171010544 . - . ID=AADAT.fAug10;Parent=AADAT +4 AceView five_prime_UTR 171010452 171010544 . - . Parent=AADAT.fAug10 +4 AceView CDS 170991771 170991803 . - 0 Parent=AADAT.fAug10 +4 AceView CDS 170994287 170994496 . - 0 Parent=AADAT.fAug10 +4 AceView CDS 170999660 170999734 . - 0 Parent=AADAT.fAug10 +4 AceView CDS 171008267 171008399 . - 1 Parent=AADAT.fAug10 +4 AceView CDS 171009547 171009715 . - 2 Parent=AADAT.fAug10 +4 AceView CDS 171010412 171010451 . - 0 Parent=AADAT.fAug10 +4 AceView three_prime_UTR 170991770 170991770 . - . Parent=AADAT.fAug10 +4 AceView exon 170991770 170991803 . - . Parent=AADAT.fAug10 +4 AceView exon 170994287 170994496 . - . Parent=AADAT.fAug10 +4 AceView exon 170999660 170999734 . - . Parent=AADAT.fAug10 +4 AceView exon 171008267 171008399 . - . Parent=AADAT.fAug10 +4 AceView exon 171009547 171009715 . - . Parent=AADAT.fAug10 +4 AceView exon 171010412 171010544 . - . Parent=AADAT.fAug10 +4 AceView mRNA 170991636 171012849 . - . ID=AADAT.eAug10;Parent=AADAT +4 AceView five_prime_UTR 171011640 171011682 . - . Parent=AADAT.eAug10 +4 AceView five_prime_UTR 171012745 171012849 . - . Parent=AADAT.eAug10 +4 AceView CDS 170991705 170991803 . - 0 Parent=AADAT.eAug10 +4 AceView CDS 170994287 170994496 . - 0 Parent=AADAT.eAug10 +4 AceView CDS 170999660 170999734 . - 0 Parent=AADAT.eAug10 +4 AceView CDS 171008267 171008399 . - 1 Parent=AADAT.eAug10 +4 AceView CDS 171009547 171009715 . - 2 Parent=AADAT.eAug10 +4 AceView CDS 171010775 171010887 . - 1 Parent=AADAT.eAug10 +4 AceView CDS 171011569 171011639 . - 0 Parent=AADAT.eAug10 +4 AceView three_prime_UTR 170991636 170991704 . - . Parent=AADAT.eAug10 +4 AceView exon 170991636 170991803 . - . Parent=AADAT.eAug10 +4 AceView exon 170994287 170994496 . - . Parent=AADAT.eAug10 +4 AceView exon 170999660 170999734 . - . Parent=AADAT.eAug10 +4 AceView exon 171008267 171008399 . - . Parent=AADAT.eAug10 +4 AceView exon 171009547 171009715 . - . Parent=AADAT.eAug10 +4 AceView exon 171010775 171010887 . - . Parent=AADAT.eAug10 +4 AceView exon 171011569 171011682 . - . Parent=AADAT.eAug10 +4 AceView exon 171012745 171012849 . - . Parent=AADAT.eAug10 +4 AceView mRNA 170982079 171011538 . - . ID=AADAT.bAug10;Parent=AADAT +4 AceView five_prime_UTR 171010842 171010887 . - . Parent=AADAT.bAug10 +4 AceView five_prime_UTR 171011376 171011538 . - . Parent=AADAT.bAug10 +4 AceView CDS 170982079 170982120 . - 0 Parent=AADAT.bAug10 +4 AceView CDS 170983043 170983144 . - 0 Parent=AADAT.bAug10 +4 AceView CDS 170985870 170985976 . - 2 Parent=AADAT.bAug10 +4 AceView CDS 170987565 170987629 . - 1 Parent=AADAT.bAug10 +4 AceView CDS 170988478 170988539 . - 0 Parent=AADAT.bAug10 +4 AceView CDS 170989742 170989838 . - 1 Parent=AADAT.bAug10 +4 AceView CDS 170990299 170990381 . - 0 Parent=AADAT.bAug10 +4 AceView CDS 170991738 170991803 . - 0 Parent=AADAT.bAug10 +4 AceView CDS 170994287 170994496 . - 0 Parent=AADAT.bAug10 +4 AceView CDS 170999660 170999734 . - 0 Parent=AADAT.bAug10 +4 AceView CDS 171008267 171008399 . - 1 Parent=AADAT.bAug10 +4 AceView CDS 171009547 171009715 . - 2 Parent=AADAT.bAug10 +4 AceView CDS 171010775 171010841 . - 0 Parent=AADAT.bAug10 +4 AceView exon 170982079 170982120 . - . Parent=AADAT.bAug10 +4 AceView exon 170983043 170983144 . - . Parent=AADAT.bAug10 +4 AceView exon 170985870 170985976 . - . Parent=AADAT.bAug10 +4 AceView exon 170987565 170987629 . - . Parent=AADAT.bAug10 +4 AceView exon 170988478 170988539 . - . Parent=AADAT.bAug10 +4 AceView exon 170989742 170989838 . - . Parent=AADAT.bAug10 +4 AceView exon 170990299 170990381 . - . Parent=AADAT.bAug10 +4 AceView exon 170991738 170991803 . - . Parent=AADAT.bAug10 +4 AceView exon 170994287 170994496 . - . Parent=AADAT.bAug10 +4 AceView exon 170999660 170999734 . - . Parent=AADAT.bAug10 +4 AceView exon 171008267 171008399 . - . Parent=AADAT.bAug10 +4 AceView exon 171009547 171009715 . - . Parent=AADAT.bAug10 +4 AceView exon 171010775 171010887 . - . Parent=AADAT.bAug10 +4 AceView exon 171011376 171011538 . - . Parent=AADAT.bAug10 +4 AceView mRNA 170981373 171011372 . - . ID=AADAT.dAug10;Parent=AADAT +4 AceView five_prime_UTR 171010842 171010887 . - . Parent=AADAT.dAug10 +4 AceView five_prime_UTR 171011295 171011372 . - . Parent=AADAT.dAug10 +4 AceView CDS 170982079 170982120 . - 0 Parent=AADAT.dAug10 +4 AceView CDS 170983043 170983144 . - 0 Parent=AADAT.dAug10 +4 AceView CDS 170985870 170985976 . - 2 Parent=AADAT.dAug10 +4 AceView CDS 170987565 170987629 . - 1 Parent=AADAT.dAug10 +4 AceView CDS 170988478 170988539 . - 0 Parent=AADAT.dAug10 +4 AceView CDS 170989742 170989838 . - 1 Parent=AADAT.dAug10 +4 AceView CDS 170990299 170990381 . - 0 Parent=AADAT.dAug10 +4 AceView CDS 170991738 170991803 . - 0 Parent=AADAT.dAug10 +4 AceView CDS 170994287 170994496 . - 0 Parent=AADAT.dAug10 +4 AceView CDS 170999660 170999734 . - 0 Parent=AADAT.dAug10 +4 AceView CDS 171008267 171008399 . - 1 Parent=AADAT.dAug10 +4 AceView CDS 171009547 171009715 . - 2 Parent=AADAT.dAug10 +4 AceView CDS 171010775 171010841 . - 0 Parent=AADAT.dAug10 +4 AceView three_prime_UTR 170981373 170982078 . - . Parent=AADAT.dAug10 +4 AceView exon 170981373 170982120 . - . Parent=AADAT.dAug10 +4 AceView exon 170983043 170983144 . - . Parent=AADAT.dAug10 +4 AceView exon 170985870 170985976 . - . Parent=AADAT.dAug10 +4 AceView exon 170987565 170987629 . - . Parent=AADAT.dAug10 +4 AceView exon 170988478 170988539 . - . Parent=AADAT.dAug10 +4 AceView exon 170989742 170989838 . - . Parent=AADAT.dAug10 +4 AceView exon 170990299 170990381 . - . Parent=AADAT.dAug10 +4 AceView exon 170991738 170991803 . - . Parent=AADAT.dAug10 +4 AceView exon 170994287 170994496 . - . Parent=AADAT.dAug10 +4 AceView exon 170999660 170999734 . - . Parent=AADAT.dAug10 +4 AceView exon 171008267 171008399 . - . Parent=AADAT.dAug10 +4 AceView exon 171009547 171009715 . - . Parent=AADAT.dAug10 +4 AceView exon 171010775 171010887 . - . Parent=AADAT.dAug10 +4 AceView exon 171011295 171011372 . - . Parent=AADAT.dAug10 +4 AceView transcript 170981457 170983752 . - . ID=AADAT.hAug10;Parent=AADAT +4 AceView exon 170981457 170982120 . - . Parent=AADAT.hAug10 +4 AceView exon 170983043 170983752 . - . Parent=AADAT.hAug10 +4 AceView transcript 170996424 171000175 . - . ID=AADAT.iAug10;Parent=AADAT +4 AceView exon 170996424 170996612 . - . Parent=AADAT.iAug10 +4 AceView exon 170999660 171000175 . - . Parent=AADAT.iAug10 +4 AceView mRNA 170981367 171011507 . - . ID=AADAT.cAug10;Parent=AADAT +4 AceView five_prime_UTR 171010842 171011507 . - . Parent=AADAT.cAug10 +4 AceView CDS 170982079 170982120 . - 0 Parent=AADAT.cAug10 +4 AceView CDS 170983043 170983144 . - 0 Parent=AADAT.cAug10 +4 AceView CDS 170985870 170985976 . - 2 Parent=AADAT.cAug10 +4 AceView CDS 170987565 170987629 . - 1 Parent=AADAT.cAug10 +4 AceView CDS 170988478 170988539 . - 0 Parent=AADAT.cAug10 +4 AceView CDS 170989742 170989838 . - 1 Parent=AADAT.cAug10 +4 AceView CDS 170990299 170990381 . - 0 Parent=AADAT.cAug10 +4 AceView CDS 170991738 170991803 . - 0 Parent=AADAT.cAug10 +4 AceView CDS 170994287 170994496 . - 0 Parent=AADAT.cAug10 +4 AceView CDS 170999660 170999734 . - 0 Parent=AADAT.cAug10 +4 AceView CDS 171008267 171008399 . - 1 Parent=AADAT.cAug10 +4 AceView CDS 171009547 171009715 . - 2 Parent=AADAT.cAug10 +4 AceView CDS 171010775 171010841 . - 0 Parent=AADAT.cAug10 +4 AceView three_prime_UTR 170981367 170982078 . - . Parent=AADAT.cAug10 +4 AceView exon 170981367 170982120 . - . Parent=AADAT.cAug10 +4 AceView exon 170983043 170983144 . - . Parent=AADAT.cAug10 +4 AceView exon 170985870 170985976 . - . Parent=AADAT.cAug10 +4 AceView exon 170987565 170987629 . - . Parent=AADAT.cAug10 +4 AceView exon 170988478 170988539 . - . Parent=AADAT.cAug10 +4 AceView exon 170989742 170989838 . - . Parent=AADAT.cAug10 +4 AceView exon 170990299 170990381 . - . Parent=AADAT.cAug10 +4 AceView exon 170991738 170991803 . - . Parent=AADAT.cAug10 +4 AceView exon 170994287 170994496 . - . Parent=AADAT.cAug10 +4 AceView exon 170999660 170999734 . - . Parent=AADAT.cAug10 +4 AceView exon 171008267 171008399 . - . Parent=AADAT.cAug10 +4 AceView exon 171009547 171009715 . - . Parent=AADAT.cAug10 +4 AceView exon 171010775 171011507 . - . Parent=AADAT.cAug10 +4 AceView mRNA 170994312 171011447 . - . ID=AADAT.gAug10;Parent=AADAT +4 AceView five_prime_UTR 171010842 171010887 . - . Parent=AADAT.gAug10 +4 AceView five_prime_UTR 171011313 171011447 . - . Parent=AADAT.gAug10 +4 AceView CDS 170994314 170994496 . - 0 Parent=AADAT.gAug10 +4 AceView CDS 170999660 170999734 . - 0 Parent=AADAT.gAug10 +4 AceView CDS 171008267 171008399 . - 1 Parent=AADAT.gAug10 +4 AceView CDS 171009547 171009715 . - 2 Parent=AADAT.gAug10 +4 AceView CDS 171010775 171010841 . - 0 Parent=AADAT.gAug10 +4 AceView three_prime_UTR 170994312 170994313 . - . Parent=AADAT.gAug10 +4 AceView exon 170994312 170994496 . - . Parent=AADAT.gAug10 +4 AceView exon 170999660 170999734 . - . Parent=AADAT.gAug10 +4 AceView exon 171008267 171008399 . - . Parent=AADAT.gAug10 +4 AceView exon 171009547 171009715 . - . Parent=AADAT.gAug10 +4 AceView exon 171010775 171010887 . - . Parent=AADAT.gAug10 +4 AceView exon 171011313 171011447 . - . Parent=AADAT.gAug10 +4 AceView mRNA 170981374 171012823 . - . ID=AADAT.aAug10;Parent=AADAT +4 AceView five_prime_UTR 171010842 171010887 . - . Parent=AADAT.aAug10 +4 AceView five_prime_UTR 171011295 171011682 . - . Parent=AADAT.aAug10 +4 AceView five_prime_UTR 171012745 171012823 . - . Parent=AADAT.aAug10 +4 AceView CDS 170982079 170982120 . - 0 Parent=AADAT.aAug10 +4 AceView CDS 170983043 170983144 . - 0 Parent=AADAT.aAug10 +4 AceView CDS 170985870 170985976 . - 2 Parent=AADAT.aAug10 +4 AceView CDS 170987565 170987629 . - 1 Parent=AADAT.aAug10 +4 AceView CDS 170988478 170988539 . - 0 Parent=AADAT.aAug10 +4 AceView CDS 170989742 170989838 . - 1 Parent=AADAT.aAug10 +4 AceView CDS 170990299 170990381 . - 0 Parent=AADAT.aAug10 +4 AceView CDS 170991738 170991803 . - 0 Parent=AADAT.aAug10 +4 AceView CDS 170994287 170994496 . - 0 Parent=AADAT.aAug10 +4 AceView CDS 170999660 170999734 . - 0 Parent=AADAT.aAug10 +4 AceView CDS 171008267 171008399 . - 1 Parent=AADAT.aAug10 +4 AceView CDS 171009547 171009715 . - 2 Parent=AADAT.aAug10 +4 AceView CDS 171010763 171010841 . - 0 Parent=AADAT.aAug10 +4 AceView three_prime_UTR 170981374 170982078 . - . Parent=AADAT.aAug10 +4 AceView exon 170981374 170982120 . - . Parent=AADAT.aAug10 +4 AceView exon 170983043 170983144 . - . Parent=AADAT.aAug10 +4 AceView exon 170985870 170985976 . - . Parent=AADAT.aAug10 +4 AceView exon 170987565 170987629 . - . Parent=AADAT.aAug10 +4 AceView exon 170988478 170988539 . - . Parent=AADAT.aAug10 +4 AceView exon 170989742 170989838 . - . Parent=AADAT.aAug10 +4 AceView exon 170990299 170990381 . - . Parent=AADAT.aAug10 +4 AceView exon 170991738 170991803 . - . Parent=AADAT.aAug10 +4 AceView exon 170994287 170994496 . - . Parent=AADAT.aAug10 +4 AceView exon 170999660 170999734 . - . Parent=AADAT.aAug10 +4 AceView exon 171008267 171008399 . - . Parent=AADAT.aAug10 +4 AceView exon 171009547 171009715 . - . Parent=AADAT.aAug10 +4 AceView exon 171010763 171010887 . - . Parent=AADAT.aAug10 +4 AceView exon 171011295 171011682 . - . Parent=AADAT.aAug10 +4 AceView exon 171012745 171012823 . - . Parent=AADAT.aAug10 +15 AceView gene 67493250 67547593 . - . ID=AAGAB;Name=AAGAB +15 AceView mRNA 67493250 67547013 . - . ID=AAGAB.dAug10;Parent=AAGAB +15 AceView five_prime_UTR 67528780 67528842 . - . Parent=AAGAB.dAug10 +15 AceView five_prime_UTR 67528968 67529158 . - . Parent=AAGAB.dAug10 +15 AceView five_prime_UTR 67546752 67547013 . - . Parent=AAGAB.dAug10 +15 AceView CDS 67495159 67495236 . - 0 Parent=AAGAB.dAug10 +15 AceView CDS 67495886 67495935 . - 2 Parent=AAGAB.dAug10 +15 AceView CDS 67496382 67496486 . - 2 Parent=AAGAB.dAug10 +15 AceView CDS 67500900 67500996 . - 0 Parent=AAGAB.dAug10 +15 AceView CDS 67501800 67501882 . - 2 Parent=AAGAB.dAug10 +15 AceView CDS 67524152 67524235 . - 2 Parent=AAGAB.dAug10 +15 AceView CDS 67528317 67528406 . - 2 Parent=AAGAB.dAug10 +15 AceView CDS 67528746 67528779 . - 0 Parent=AAGAB.dAug10 +15 AceView three_prime_UTR 67493250 67495158 . - . Parent=AAGAB.dAug10 +15 AceView exon 67493250 67495236 . - . Parent=AAGAB.dAug10 +15 AceView exon 67495886 67495935 . - . Parent=AAGAB.dAug10 +15 AceView exon 67496382 67496486 . - . Parent=AAGAB.dAug10 +15 AceView exon 67500900 67500996 . - . Parent=AAGAB.dAug10 +15 AceView exon 67501800 67501882 . - . Parent=AAGAB.dAug10 +15 AceView exon 67524152 67524235 . - . Parent=AAGAB.dAug10 +15 AceView exon 67528317 67528406 . - . Parent=AAGAB.dAug10 +15 AceView exon 67528746 67528842 . - . Parent=AAGAB.dAug10 +15 AceView exon 67528968 67529158 . - . Parent=AAGAB.dAug10 +15 AceView exon 67546752 67547013 . - . Parent=AAGAB.dAug10 +15 AceView mRNA 67519025 67546991 . - . ID=AAGAB.fAug10;Parent=AAGAB +15 AceView five_prime_UTR 67546970 67546991 . - . Parent=AAGAB.fAug10 +15 AceView CDS 67519239 67519288 . - 2 Parent=AAGAB.fAug10 +15 AceView CDS 67524152 67524235 . - 2 Parent=AAGAB.fAug10 +15 AceView CDS 67528317 67528406 . - 2 Parent=AAGAB.fAug10 +15 AceView CDS 67528746 67528842 . - 0 Parent=AAGAB.fAug10 +15 AceView CDS 67528968 67529158 . - 2 Parent=AAGAB.fAug10 +15 AceView CDS 67546897 67546969 . - 0 Parent=AAGAB.fAug10 +15 AceView three_prime_UTR 67519025 67519238 . - . Parent=AAGAB.fAug10 +15 AceView exon 67519025 67519288 . - . Parent=AAGAB.fAug10 +15 AceView exon 67524152 67524235 . - . Parent=AAGAB.fAug10 +15 AceView exon 67528317 67528406 . - . Parent=AAGAB.fAug10 +15 AceView exon 67528746 67528842 . - . Parent=AAGAB.fAug10 +15 AceView exon 67528968 67529158 . - . Parent=AAGAB.fAug10 +15 AceView exon 67546897 67546991 . - . Parent=AAGAB.fAug10 +15 AceView transcript 67529041 67546977 . - . ID=AAGAB.lAug10;Parent=AAGAB +15 AceView exon 67529041 67529158 . - . Parent=AAGAB.lAug10 +15 AceView exon 67546567 67546977 . - . Parent=AAGAB.lAug10 +15 AceView transcript 67516940 67517402 . - . ID=AAGAB.mAug10-unspliced;Parent=AAGAB +15 AceView exon 67516940 67517402 . - . Parent=AAGAB.mAug10-unspliced +15 AceView mRNA 67494011 67513545 . - . ID=AAGAB.gAug10;Parent=AAGAB +15 AceView five_prime_UTR 67513431 67513545 . - . Parent=AAGAB.gAug10 +15 AceView CDS 67495159 67495236 . - 0 Parent=AAGAB.gAug10 +15 AceView CDS 67495886 67495935 . - 2 Parent=AAGAB.gAug10 +15 AceView CDS 67496382 67496486 . - 2 Parent=AAGAB.gAug10 +15 AceView CDS 67500900 67500996 . - 0 Parent=AAGAB.gAug10 +15 AceView CDS 67501800 67501882 . - 2 Parent=AAGAB.gAug10 +15 AceView CDS 67512827 67512878 . - 0 Parent=AAGAB.gAug10 +15 AceView CDS 67513377 67513430 . - 0 Parent=AAGAB.gAug10 +15 AceView three_prime_UTR 67494011 67495158 . - . Parent=AAGAB.gAug10 +15 AceView exon 67494011 67495236 . - . Parent=AAGAB.gAug10 +15 AceView exon 67495886 67495935 . - . Parent=AAGAB.gAug10 +15 AceView exon 67496382 67496486 . - . Parent=AAGAB.gAug10 +15 AceView exon 67500900 67500996 . - . Parent=AAGAB.gAug10 +15 AceView exon 67501800 67501882 . - . Parent=AAGAB.gAug10 +15 AceView exon 67512827 67512878 . - . Parent=AAGAB.gAug10 +15 AceView exon 67513377 67513545 . - . Parent=AAGAB.gAug10 +15 AceView mRNA 67494029 67546968 . - . ID=AAGAB.aAug10;Parent=AAGAB +15 AceView five_prime_UTR 67546967 67546968 . - . Parent=AAGAB.aAug10 +15 AceView CDS 67495757 67495935 . - 2 Parent=AAGAB.aAug10 +15 AceView CDS 67496382 67496486 . - 2 Parent=AAGAB.aAug10 +15 AceView CDS 67500900 67500996 . - 0 Parent=AAGAB.aAug10 +15 AceView CDS 67501800 67501882 . - 2 Parent=AAGAB.aAug10 +15 AceView CDS 67524152 67524235 . - 2 Parent=AAGAB.aAug10 +15 AceView CDS 67528317 67528406 . - 2 Parent=AAGAB.aAug10 +15 AceView CDS 67528746 67528842 . - 0 Parent=AAGAB.aAug10 +15 AceView CDS 67528968 67529158 . - 2 Parent=AAGAB.aAug10 +15 AceView CDS 67546897 67546966 . - 0 Parent=AAGAB.aAug10 +15 AceView three_prime_UTR 67494029 67495756 . - . Parent=AAGAB.aAug10 +15 AceView exon 67494029 67495935 . - . Parent=AAGAB.aAug10 +15 AceView exon 67496382 67496486 . - . Parent=AAGAB.aAug10 +15 AceView exon 67500900 67500996 . - . Parent=AAGAB.aAug10 +15 AceView exon 67501800 67501882 . - . Parent=AAGAB.aAug10 +15 AceView exon 67524152 67524235 . - . Parent=AAGAB.aAug10 +15 AceView exon 67528317 67528406 . - . Parent=AAGAB.aAug10 +15 AceView exon 67528746 67528842 . - . Parent=AAGAB.aAug10 +15 AceView exon 67528968 67529158 . - . Parent=AAGAB.aAug10 +15 AceView exon 67546897 67546968 . - . Parent=AAGAB.aAug10 +15 AceView mRNA 67494011 67546991 . - . ID=AAGAB.cAug10;Parent=AAGAB +15 AceView five_prime_UTR 67528780 67528842 . - . Parent=AAGAB.cAug10 +15 AceView five_prime_UTR 67528968 67529158 . - . Parent=AAGAB.cAug10 +15 AceView five_prime_UTR 67546562 67546991 . - . Parent=AAGAB.cAug10 +15 AceView CDS 67495159 67495236 . - 0 Parent=AAGAB.cAug10 +15 AceView CDS 67495886 67495935 . - 2 Parent=AAGAB.cAug10 +15 AceView CDS 67496382 67496486 . - 2 Parent=AAGAB.cAug10 +15 AceView CDS 67500900 67500996 . - 0 Parent=AAGAB.cAug10 +15 AceView CDS 67501800 67501882 . - 2 Parent=AAGAB.cAug10 +15 AceView CDS 67524152 67524235 . - 2 Parent=AAGAB.cAug10 +15 AceView CDS 67528317 67528406 . - 2 Parent=AAGAB.cAug10 +15 AceView CDS 67528746 67528779 . - 0 Parent=AAGAB.cAug10 +15 AceView three_prime_UTR 67494011 67495158 . - . Parent=AAGAB.cAug10 +15 AceView exon 67494011 67495236 . - . Parent=AAGAB.cAug10 +15 AceView exon 67495886 67495935 . - . Parent=AAGAB.cAug10 +15 AceView exon 67496382 67496486 . - . Parent=AAGAB.cAug10 +15 AceView exon 67500900 67500996 . - . Parent=AAGAB.cAug10 +15 AceView exon 67501800 67501882 . - . Parent=AAGAB.cAug10 +15 AceView exon 67524152 67524235 . - . Parent=AAGAB.cAug10 +15 AceView exon 67528317 67528406 . - . Parent=AAGAB.cAug10 +15 AceView exon 67528746 67528842 . - . Parent=AAGAB.cAug10 +15 AceView exon 67528968 67529158 . - . Parent=AAGAB.cAug10 +15 AceView exon 67546562 67546991 . - . Parent=AAGAB.cAug10 +15 AceView mRNA 67493369 67547073 . - . ID=AAGAB.bAug10;Parent=AAGAB +15 AceView five_prime_UTR 67546970 67547073 . - . Parent=AAGAB.bAug10 +15 AceView CDS 67495159 67495236 . - 0 Parent=AAGAB.bAug10 +15 AceView CDS 67495886 67495935 . - 2 Parent=AAGAB.bAug10 +15 AceView CDS 67496382 67496486 . - 2 Parent=AAGAB.bAug10 +15 AceView CDS 67500900 67500996 . - 0 Parent=AAGAB.bAug10 +15 AceView CDS 67501800 67501882 . - 2 Parent=AAGAB.bAug10 +15 AceView CDS 67524152 67524235 . - 2 Parent=AAGAB.bAug10 +15 AceView CDS 67528317 67528406 . - 2 Parent=AAGAB.bAug10 +15 AceView CDS 67528746 67528842 . - 0 Parent=AAGAB.bAug10 +15 AceView CDS 67528968 67529158 . - 2 Parent=AAGAB.bAug10 +15 AceView CDS 67546897 67546969 . - 0 Parent=AAGAB.bAug10 +15 AceView three_prime_UTR 67493369 67495158 . - . Parent=AAGAB.bAug10 +15 AceView exon 67493369 67495236 . - . Parent=AAGAB.bAug10 +15 AceView exon 67495886 67495935 . - . Parent=AAGAB.bAug10 +15 AceView exon 67496382 67496486 . - . Parent=AAGAB.bAug10 +15 AceView exon 67500900 67500996 . - . Parent=AAGAB.bAug10 +15 AceView exon 67501800 67501882 . - . Parent=AAGAB.bAug10 +15 AceView exon 67524152 67524235 . - . Parent=AAGAB.bAug10 +15 AceView exon 67528317 67528406 . - . Parent=AAGAB.bAug10 +15 AceView exon 67528746 67528842 . - . Parent=AAGAB.bAug10 +15 AceView exon 67528968 67529158 . - . Parent=AAGAB.bAug10 +15 AceView exon 67546897 67547073 . - . Parent=AAGAB.bAug10 +15 AceView mRNA 67493369 67500195 . - . ID=AAGAB.hAug10-unspliced;Parent=AAGAB +15 AceView five_prime_UTR 67499525 67500195 . - . Parent=AAGAB.hAug10-unspliced +15 AceView CDS 67499222 67499524 . - 0 Parent=AAGAB.hAug10-unspliced +15 AceView three_prime_UTR 67493369 67499221 . - . Parent=AAGAB.hAug10-unspliced +15 AceView exon 67493369 67500195 . - . Parent=AAGAB.hAug10-unspliced +15 AceView transcript 67524186 67535208 . - . ID=AAGAB.kAug10;Parent=AAGAB +15 AceView exon 67524186 67524235 . - . Parent=AAGAB.kAug10 +15 AceView exon 67528317 67528406 . - . Parent=AAGAB.kAug10 +15 AceView exon 67528746 67528842 . - . Parent=AAGAB.kAug10 +15 AceView exon 67528968 67529158 . - . Parent=AAGAB.kAug10 +15 AceView exon 67535075 67535208 . - . Parent=AAGAB.kAug10 +15 AceView mRNA 67495078 67547593 . - . ID=AAGAB.eAug10;Parent=AAGAB +15 AceView five_prime_UTR 67528780 67528842 . - . Parent=AAGAB.eAug10 +15 AceView five_prime_UTR 67528968 67529158 . - . Parent=AAGAB.eAug10 +15 AceView five_prime_UTR 67547475 67547593 . - . Parent=AAGAB.eAug10 +15 AceView CDS 67495159 67495236 . - 0 Parent=AAGAB.eAug10 +15 AceView CDS 67495886 67495935 . - 2 Parent=AAGAB.eAug10 +15 AceView CDS 67496382 67496486 . - 2 Parent=AAGAB.eAug10 +15 AceView CDS 67500900 67500996 . - 0 Parent=AAGAB.eAug10 +15 AceView CDS 67501800 67501882 . - 2 Parent=AAGAB.eAug10 +15 AceView CDS 67524152 67524235 . - 2 Parent=AAGAB.eAug10 +15 AceView CDS 67528317 67528406 . - 2 Parent=AAGAB.eAug10 +15 AceView CDS 67528746 67528779 . - 0 Parent=AAGAB.eAug10 +15 AceView three_prime_UTR 67495078 67495158 . - . Parent=AAGAB.eAug10 +15 AceView exon 67495078 67495236 . - . Parent=AAGAB.eAug10 +15 AceView exon 67495886 67495935 . - . Parent=AAGAB.eAug10 +15 AceView exon 67496382 67496486 . - . Parent=AAGAB.eAug10 +15 AceView exon 67500900 67500996 . - . Parent=AAGAB.eAug10 +15 AceView exon 67501800 67501882 . - . Parent=AAGAB.eAug10 +15 AceView exon 67524152 67524235 . - . Parent=AAGAB.eAug10 +15 AceView exon 67528317 67528406 . - . Parent=AAGAB.eAug10 +15 AceView exon 67528746 67528842 . - . Parent=AAGAB.eAug10 +15 AceView exon 67528968 67529158 . - . Parent=AAGAB.eAug10 +15 AceView exon 67547475 67547593 . - . Parent=AAGAB.eAug10 +1 AceView gene 12704566 12727097 . + . ID=AADACL4;Name=AADACL4 +1 AceView mRNA 12704566 12727097 . + . ID=AADACL4.aAug10;Parent=AADACL4 +1 AceView CDS 12704566 12704733 . + 0 Parent=AADACL4.aAug10 +1 AceView CDS 12711142 12711358 . + 0 Parent=AADACL4.aAug10 +1 AceView CDS 12721802 12721865 . + 2 Parent=AADACL4.aAug10 +1 AceView CDS 12725972 12726746 . + 1 Parent=AADACL4.aAug10 +1 AceView three_prime_UTR 12726747 12727097 . + . Parent=AADACL4.aAug10 +1 AceView exon 12704566 12704733 . + . Parent=AADACL4.aAug10 +1 AceView exon 12711142 12711358 . + . Parent=AADACL4.aAug10 +1 AceView exon 12721802 12721865 . + . Parent=AADACL4.aAug10 +1 AceView exon 12725972 12727097 . + . Parent=AADACL4.aAug10 +16 AceView gene 6068990 7763341 . + . ID=A2BP1;Name=A2BP1 +16 AceView mRNA 6069095 7703848 . + . ID=A2BP1.jAug10;Parent=A2BP1 +16 AceView five_prime_UTR 6069095 6069993 . + . Parent=A2BP1.jAug10 +16 AceView five_prime_UTR 6366996 6367058 . + . Parent=A2BP1.jAug10 +16 AceView five_prime_UTR 6704604 6704651 . + . Parent=A2BP1.jAug10 +16 AceView five_prime_UTR 7102058 7102072 . + . Parent=A2BP1.jAug10 +16 AceView CDS 7102073 7102099 . + 0 Parent=A2BP1.jAug10 +16 AceView CDS 7568149 7568391 . + 0 Parent=A2BP1.jAug10 +16 AceView CDS 7629782 7629922 . + 0 Parent=A2BP1.jAug10 +16 AceView CDS 7637249 7637302 . + 0 Parent=A2BP1.jAug10 +16 AceView CDS 7645551 7645643 . + 0 Parent=A2BP1.jAug10 +16 AceView CDS 7647373 7647433 . + 0 Parent=A2BP1.jAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.jAug10 +16 AceView CDS 7680605 7680685 . + 2 Parent=A2BP1.jAug10 +16 AceView CDS 7703817 7703848 . + 2 Parent=A2BP1.jAug10 +16 AceView exon 6069095 6069993 . + . Parent=A2BP1.jAug10 +16 AceView exon 6366996 6367058 . + . Parent=A2BP1.jAug10 +16 AceView exon 6704604 6704651 . + . Parent=A2BP1.jAug10 +16 AceView exon 7102058 7102099 . + . Parent=A2BP1.jAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.jAug10 +16 AceView exon 7629782 7629922 . + . Parent=A2BP1.jAug10 +16 AceView exon 7637249 7637302 . + . Parent=A2BP1.jAug10 +16 AceView exon 7645551 7645643 . + . Parent=A2BP1.jAug10 +16 AceView exon 7647373 7647433 . + . Parent=A2BP1.jAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.jAug10 +16 AceView exon 7680605 7680685 . + . Parent=A2BP1.jAug10 +16 AceView exon 7703817 7703848 . + . Parent=A2BP1.jAug10 +16 AceView transcript 6521045 6521580 . + . ID=A2BP1.tAug10-unspliced;Parent=A2BP1 +16 AceView exon 6521045 6521580 . + . Parent=A2BP1.tAug10-unspliced +16 AceView mRNA 7647219 7680628 . + . ID=A2BP1.oAug10;Parent=A2BP1 +16 AceView five_prime_UTR 7647219 7647396 . + . Parent=A2BP1.oAug10 +16 AceView CDS 7647397 7647433 . + 0 Parent=A2BP1.oAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.oAug10 +16 AceView CDS 7680605 7680627 . + 2 Parent=A2BP1.oAug10 +16 AceView three_prime_UTR 7680628 7680628 . + . Parent=A2BP1.oAug10 +16 AceView exon 7647219 7647433 . + . Parent=A2BP1.oAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.oAug10 +16 AceView exon 7680605 7680628 . + . Parent=A2BP1.oAug10 +16 AceView transcript 6519209 6519991 . + . ID=A2BP1.qAug10-unspliced;Parent=A2BP1 +16 AceView exon 6519209 6519991 . + . Parent=A2BP1.qAug10-unspliced +16 AceView mRNA 7353253 7759778 . + . ID=A2BP1.iAug10;Parent=A2BP1 +16 AceView five_prime_UTR 7353253 7353549 . + . Parent=A2BP1.iAug10 +16 AceView five_prime_UTR 7568149 7568181 . + . Parent=A2BP1.iAug10 +16 AceView CDS 7568182 7568391 . + 0 Parent=A2BP1.iAug10 +16 AceView CDS 7637249 7637302 . + 0 Parent=A2BP1.iAug10 +16 AceView CDS 7647373 7647433 . + 0 Parent=A2BP1.iAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.iAug10 +16 AceView CDS 7680605 7680685 . + 2 Parent=A2BP1.iAug10 +16 AceView CDS 7703817 7703949 . + 2 Parent=A2BP1.iAug10 +16 AceView CDS 7714931 7714970 . + 1 Parent=A2BP1.iAug10 +16 AceView CDS 7726776 7726840 . + 0 Parent=A2BP1.iAug10 +16 AceView CDS 7743317 7743369 . + 1 Parent=A2BP1.iAug10 +16 AceView CDS 7759058 7759133 . + 2 Parent=A2BP1.iAug10 +16 AceView CDS 7759496 7759643 . + 1 Parent=A2BP1.iAug10 +16 AceView three_prime_UTR 7759644 7759778 . + . Parent=A2BP1.iAug10 +16 AceView exon 7353253 7353549 . + . Parent=A2BP1.iAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.iAug10 +16 AceView exon 7637249 7637302 . + . Parent=A2BP1.iAug10 +16 AceView exon 7647373 7647433 . + . Parent=A2BP1.iAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.iAug10 +16 AceView exon 7680605 7680685 . + . Parent=A2BP1.iAug10 +16 AceView exon 7703817 7703949 . + . Parent=A2BP1.iAug10 +16 AceView exon 7714931 7714970 . + . Parent=A2BP1.iAug10 +16 AceView exon 7726776 7726840 . + . Parent=A2BP1.iAug10 +16 AceView exon 7743317 7743369 . + . Parent=A2BP1.iAug10 +16 AceView exon 7759058 7759133 . + . Parent=A2BP1.iAug10 +16 AceView exon 7759496 7759778 . + . Parent=A2BP1.iAug10 +16 AceView mRNA 7382750 7763340 . + . ID=A2BP1.eAug10;Parent=A2BP1 +16 AceView five_prime_UTR 7382750 7383002 . + . Parent=A2BP1.eAug10 +16 AceView CDS 7383003 7383089 . + 0 Parent=A2BP1.eAug10 +16 AceView CDS 7568149 7568391 . + 0 Parent=A2BP1.eAug10 +16 AceView CDS 7629779 7629922 . + 0 Parent=A2BP1.eAug10 +16 AceView CDS 7637249 7637302 . + 0 Parent=A2BP1.eAug10 +16 AceView CDS 7645551 7645643 . + 0 Parent=A2BP1.eAug10 +16 AceView CDS 7647373 7647433 . + 0 Parent=A2BP1.eAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.eAug10 +16 AceView CDS 7680605 7680685 . + 2 Parent=A2BP1.eAug10 +16 AceView CDS 7703817 7703949 . + 2 Parent=A2BP1.eAug10 +16 AceView CDS 7721559 7721601 . + 1 Parent=A2BP1.eAug10 +16 AceView CDS 7726776 7726840 . + 0 Parent=A2BP1.eAug10 +16 AceView CDS 7759058 7759133 . + 1 Parent=A2BP1.eAug10 +16 AceView CDS 7760703 7760747 . + 0 Parent=A2BP1.eAug10 +16 AceView three_prime_UTR 7760748 7763340 . + . Parent=A2BP1.eAug10 +16 AceView exon 7382750 7383089 . + . Parent=A2BP1.eAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.eAug10 +16 AceView exon 7629779 7629922 . + . Parent=A2BP1.eAug10 +16 AceView exon 7637249 7637302 . + . Parent=A2BP1.eAug10 +16 AceView exon 7645551 7645643 . + . Parent=A2BP1.eAug10 +16 AceView exon 7647373 7647433 . + . Parent=A2BP1.eAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.eAug10 +16 AceView exon 7680605 7680685 . + . Parent=A2BP1.eAug10 +16 AceView exon 7703817 7703949 . + . Parent=A2BP1.eAug10 +16 AceView exon 7721559 7721601 . + . Parent=A2BP1.eAug10 +16 AceView exon 7726776 7726840 . + . Parent=A2BP1.eAug10 +16 AceView exon 7759058 7759133 . + . Parent=A2BP1.eAug10 +16 AceView exon 7760703 7763340 . + . Parent=A2BP1.eAug10 +16 AceView mRNA 7382748 7763340 . + . ID=A2BP1.aAug10;Parent=A2BP1 +16 AceView five_prime_UTR 7382748 7383002 . + . Parent=A2BP1.aAug10 +16 AceView CDS 7383003 7383089 . + 0 Parent=A2BP1.aAug10 +16 AceView CDS 7568149 7568391 . + 0 Parent=A2BP1.aAug10 +16 AceView CDS 7629779 7629922 . + 0 Parent=A2BP1.aAug10 +16 AceView CDS 7637249 7637302 . + 0 Parent=A2BP1.aAug10 +16 AceView CDS 7645551 7645643 . + 0 Parent=A2BP1.aAug10 +16 AceView CDS 7647373 7647433 . + 0 Parent=A2BP1.aAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.aAug10 +16 AceView CDS 7680605 7680685 . + 2 Parent=A2BP1.aAug10 +16 AceView CDS 7703817 7703949 . + 2 Parent=A2BP1.aAug10 +16 AceView CDS 7721559 7721601 . + 1 Parent=A2BP1.aAug10 +16 AceView CDS 7726776 7726840 . + 0 Parent=A2BP1.aAug10 +16 AceView CDS 7759058 7759133 . + 1 Parent=A2BP1.aAug10 +16 AceView CDS 7760625 7760747 . + 0 Parent=A2BP1.aAug10 +16 AceView three_prime_UTR 7760748 7763340 . + . Parent=A2BP1.aAug10 +16 AceView exon 7382748 7383089 . + . Parent=A2BP1.aAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.aAug10 +16 AceView exon 7629779 7629922 . + . Parent=A2BP1.aAug10 +16 AceView exon 7637249 7637302 . + . Parent=A2BP1.aAug10 +16 AceView exon 7645551 7645643 . + . Parent=A2BP1.aAug10 +16 AceView exon 7647373 7647433 . + . Parent=A2BP1.aAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.aAug10 +16 AceView exon 7680605 7680685 . + . Parent=A2BP1.aAug10 +16 AceView exon 7703817 7703949 . + . Parent=A2BP1.aAug10 +16 AceView exon 7721559 7721601 . + . Parent=A2BP1.aAug10 +16 AceView exon 7726776 7726840 . + . Parent=A2BP1.aAug10 +16 AceView exon 7759058 7759133 . + . Parent=A2BP1.aAug10 +16 AceView exon 7760625 7763340 . + . Parent=A2BP1.aAug10 +16 AceView mRNA 7714766 7760841 . + . ID=A2BP1.nAug10;Parent=A2BP1 +16 AceView five_prime_UTR 7714766 7714896 . + . Parent=A2BP1.nAug10 +16 AceView CDS 7714897 7714970 . + 0 Parent=A2BP1.nAug10 +16 AceView CDS 7726776 7726840 . + 1 Parent=A2BP1.nAug10 +16 AceView CDS 7759058 7759131 . + 2 Parent=A2BP1.nAug10 +16 AceView CDS 7760623 7760625 . + 0 Parent=A2BP1.nAug10 +16 AceView three_prime_UTR 7760626 7760841 . + . Parent=A2BP1.nAug10 +16 AceView exon 7714766 7714970 . + . Parent=A2BP1.nAug10 +16 AceView exon 7726776 7726840 . + . Parent=A2BP1.nAug10 +16 AceView exon 7759058 7759133 . + . Parent=A2BP1.nAug10 +16 AceView exon 7760625 7760841 . + . Parent=A2BP1.nAug10 +16 AceView mRNA 6069132 7763340 . + . ID=A2BP1.hAug10;Parent=A2BP1 +16 AceView five_prime_UTR 6069132 6069993 . + . Parent=A2BP1.hAug10 +16 AceView five_prime_UTR 6366996 6367058 . + . Parent=A2BP1.hAug10 +16 AceView five_prime_UTR 6704604 6704651 . + . Parent=A2BP1.hAug10 +16 AceView five_prime_UTR 7102058 7102072 . + . Parent=A2BP1.hAug10 +16 AceView CDS 7102073 7102099 . + 0 Parent=A2BP1.hAug10 +16 AceView CDS 7568149 7568391 . + 0 Parent=A2BP1.hAug10 +16 AceView CDS 7629779 7629922 . + 0 Parent=A2BP1.hAug10 +16 AceView CDS 7637249 7637302 . + 0 Parent=A2BP1.hAug10 +16 AceView CDS 7645551 7645643 . + 0 Parent=A2BP1.hAug10 +16 AceView CDS 7647373 7647433 . + 0 Parent=A2BP1.hAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.hAug10 +16 AceView CDS 7703817 7703949 . + 2 Parent=A2BP1.hAug10 +16 AceView CDS 7714931 7714970 . + 1 Parent=A2BP1.hAug10 +16 AceView CDS 7726776 7726840 . + 0 Parent=A2BP1.hAug10 +16 AceView CDS 7759058 7759133 . + 1 Parent=A2BP1.hAug10 +16 AceView CDS 7760625 7760747 . + 0 Parent=A2BP1.hAug10 +16 AceView three_prime_UTR 7760748 7763340 . + . Parent=A2BP1.hAug10 +16 AceView exon 6069132 6069993 . + . Parent=A2BP1.hAug10 +16 AceView exon 6366996 6367058 . + . Parent=A2BP1.hAug10 +16 AceView exon 6704604 6704651 . + . Parent=A2BP1.hAug10 +16 AceView exon 7102058 7102099 . + . Parent=A2BP1.hAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.hAug10 +16 AceView exon 7629779 7629922 . + . Parent=A2BP1.hAug10 +16 AceView exon 7637249 7637302 . + . Parent=A2BP1.hAug10 +16 AceView exon 7645551 7645643 . + . Parent=A2BP1.hAug10 +16 AceView exon 7647373 7647433 . + . Parent=A2BP1.hAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.hAug10 +16 AceView exon 7703817 7703949 . + . Parent=A2BP1.hAug10 +16 AceView exon 7714931 7714970 . + . Parent=A2BP1.hAug10 +16 AceView exon 7726776 7726840 . + . Parent=A2BP1.hAug10 +16 AceView exon 7759058 7759133 . + . Parent=A2BP1.hAug10 +16 AceView exon 7760625 7763340 . + . Parent=A2BP1.hAug10 +16 AceView transcript 7472779 7629787 . + . ID=A2BP1.uAug10;Parent=A2BP1 +16 AceView exon 7472779 7473029 . + . Parent=A2BP1.uAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.uAug10 +16 AceView exon 7629779 7629787 . + . Parent=A2BP1.uAug10 +16 AceView mRNA 6823811 7763340 . + . ID=A2BP1.bAug10;Parent=A2BP1 +16 AceView five_prime_UTR 6823811 6824014 . + . Parent=A2BP1.bAug10 +16 AceView five_prime_UTR 7102058 7102072 . + . Parent=A2BP1.bAug10 +16 AceView CDS 7102073 7102099 . + 0 Parent=A2BP1.bAug10 +16 AceView CDS 7568149 7568391 . + 0 Parent=A2BP1.bAug10 +16 AceView CDS 7629779 7629922 . + 0 Parent=A2BP1.bAug10 +16 AceView CDS 7637249 7637302 . + 0 Parent=A2BP1.bAug10 +16 AceView CDS 7645551 7645643 . + 0 Parent=A2BP1.bAug10 +16 AceView CDS 7647373 7647433 . + 0 Parent=A2BP1.bAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.bAug10 +16 AceView CDS 7680605 7680685 . + 2 Parent=A2BP1.bAug10 +16 AceView CDS 7703817 7703949 . + 2 Parent=A2BP1.bAug10 +16 AceView CDS 7714931 7714970 . + 1 Parent=A2BP1.bAug10 +16 AceView CDS 7726776 7726840 . + 0 Parent=A2BP1.bAug10 +16 AceView CDS 7759058 7759133 . + 1 Parent=A2BP1.bAug10 +16 AceView CDS 7760625 7760747 . + 0 Parent=A2BP1.bAug10 +16 AceView three_prime_UTR 7760748 7763340 . + . Parent=A2BP1.bAug10 +16 AceView exon 6823811 6824014 . + . Parent=A2BP1.bAug10 +16 AceView exon 7102058 7102099 . + . Parent=A2BP1.bAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.bAug10 +16 AceView exon 7629779 7629922 . + . Parent=A2BP1.bAug10 +16 AceView exon 7637249 7637302 . + . Parent=A2BP1.bAug10 +16 AceView exon 7645551 7645643 . + . Parent=A2BP1.bAug10 +16 AceView exon 7647373 7647433 . + . Parent=A2BP1.bAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.bAug10 +16 AceView exon 7680605 7680685 . + . Parent=A2BP1.bAug10 +16 AceView exon 7703817 7703949 . + . Parent=A2BP1.bAug10 +16 AceView exon 7714931 7714970 . + . Parent=A2BP1.bAug10 +16 AceView exon 7726776 7726840 . + . Parent=A2BP1.bAug10 +16 AceView exon 7759058 7759133 . + . Parent=A2BP1.bAug10 +16 AceView exon 7760625 7763340 . + . Parent=A2BP1.bAug10 +16 AceView mRNA 7382954 7760683 . + . ID=A2BP1.gAug10;Parent=A2BP1 +16 AceView five_prime_UTR 7382954 7383002 . + . Parent=A2BP1.gAug10 +16 AceView CDS 7383003 7383089 . + 0 Parent=A2BP1.gAug10 +16 AceView CDS 7568149 7568391 . + 0 Parent=A2BP1.gAug10 +16 AceView CDS 7629779 7629922 . + 0 Parent=A2BP1.gAug10 +16 AceView CDS 7637249 7637302 . + 0 Parent=A2BP1.gAug10 +16 AceView CDS 7645551 7645643 . + 0 Parent=A2BP1.gAug10 +16 AceView CDS 7647373 7647433 . + 0 Parent=A2BP1.gAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.gAug10 +16 AceView CDS 7703817 7703949 . + 2 Parent=A2BP1.gAug10 +16 AceView CDS 7721559 7721601 . + 1 Parent=A2BP1.gAug10 +16 AceView CDS 7726776 7726840 . + 0 Parent=A2BP1.gAug10 +16 AceView CDS 7759058 7759133 . + 1 Parent=A2BP1.gAug10 +16 AceView CDS 7760625 7760681 . + 0 Parent=A2BP1.gAug10 +16 AceView three_prime_UTR 7760682 7760683 . + . Parent=A2BP1.gAug10 +16 AceView exon 7382954 7383089 . + . Parent=A2BP1.gAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.gAug10 +16 AceView exon 7629779 7629922 . + . Parent=A2BP1.gAug10 +16 AceView exon 7637249 7637302 . + . Parent=A2BP1.gAug10 +16 AceView exon 7645551 7645643 . + . Parent=A2BP1.gAug10 +16 AceView exon 7647373 7647433 . + . Parent=A2BP1.gAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.gAug10 +16 AceView exon 7703817 7703949 . + . Parent=A2BP1.gAug10 +16 AceView exon 7721559 7721601 . + . Parent=A2BP1.gAug10 +16 AceView exon 7726776 7726840 . + . Parent=A2BP1.gAug10 +16 AceView exon 7759058 7759133 . + . Parent=A2BP1.gAug10 +16 AceView exon 7760625 7760683 . + . Parent=A2BP1.gAug10 +16 AceView mRNA 6069222 7759783 . + . ID=A2BP1.fAug10;Parent=A2BP1 +16 AceView five_prime_UTR 6069222 6069993 . + . Parent=A2BP1.fAug10 +16 AceView five_prime_UTR 6704604 6704651 . + . Parent=A2BP1.fAug10 +16 AceView five_prime_UTR 7102058 7102072 . + . Parent=A2BP1.fAug10 +16 AceView CDS 7102073 7102099 . + 0 Parent=A2BP1.fAug10 +16 AceView CDS 7568149 7568391 . + 0 Parent=A2BP1.fAug10 +16 AceView CDS 7629779 7629922 . + 0 Parent=A2BP1.fAug10 +16 AceView CDS 7637249 7637302 . + 0 Parent=A2BP1.fAug10 +16 AceView CDS 7645551 7645643 . + 0 Parent=A2BP1.fAug10 +16 AceView CDS 7647373 7647433 . + 0 Parent=A2BP1.fAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.fAug10 +16 AceView CDS 7680605 7680685 . + 2 Parent=A2BP1.fAug10 +16 AceView CDS 7703817 7703949 . + 2 Parent=A2BP1.fAug10 +16 AceView CDS 7714931 7714970 . + 1 Parent=A2BP1.fAug10 +16 AceView CDS 7726776 7726840 . + 0 Parent=A2BP1.fAug10 +16 AceView CDS 7759058 7759133 . + 1 Parent=A2BP1.fAug10 +16 AceView CDS 7759496 7759573 . + 0 Parent=A2BP1.fAug10 +16 AceView three_prime_UTR 7759574 7759783 . + . Parent=A2BP1.fAug10 +16 AceView exon 6069222 6069993 . + . Parent=A2BP1.fAug10 +16 AceView exon 6704604 6704651 . + . Parent=A2BP1.fAug10 +16 AceView exon 7102058 7102099 . + . Parent=A2BP1.fAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.fAug10 +16 AceView exon 7629779 7629922 . + . Parent=A2BP1.fAug10 +16 AceView exon 7637249 7637302 . + . Parent=A2BP1.fAug10 +16 AceView exon 7645551 7645643 . + . Parent=A2BP1.fAug10 +16 AceView exon 7647373 7647433 . + . Parent=A2BP1.fAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.fAug10 +16 AceView exon 7680605 7680685 . + . Parent=A2BP1.fAug10 +16 AceView exon 7703817 7703949 . + . Parent=A2BP1.fAug10 +16 AceView exon 7714931 7714970 . + . Parent=A2BP1.fAug10 +16 AceView exon 7726776 7726840 . + . Parent=A2BP1.fAug10 +16 AceView exon 7759058 7759133 . + . Parent=A2BP1.fAug10 +16 AceView exon 7759496 7759783 . + . Parent=A2BP1.fAug10 +16 AceView mRNA 7354223 7703848 . + . ID=A2BP1.kAug10;Parent=A2BP1 +16 AceView five_prime_UTR 7354223 7354384 . + . Parent=A2BP1.kAug10 +16 AceView CDS 7354385 7354486 . + 0 Parent=A2BP1.kAug10 +16 AceView CDS 7568149 7568391 . + 0 Parent=A2BP1.kAug10 +16 AceView CDS 7629779 7629922 . + 0 Parent=A2BP1.kAug10 +16 AceView CDS 7637249 7637302 . + 0 Parent=A2BP1.kAug10 +16 AceView CDS 7647373 7647433 . + 0 Parent=A2BP1.kAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.kAug10 +16 AceView CDS 7680605 7680685 . + 2 Parent=A2BP1.kAug10 +16 AceView CDS 7703817 7703848 . + 2 Parent=A2BP1.kAug10 +16 AceView exon 7354223 7354486 . + . Parent=A2BP1.kAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.kAug10 +16 AceView exon 7629779 7629922 . + . Parent=A2BP1.kAug10 +16 AceView exon 7637249 7637302 . + . Parent=A2BP1.kAug10 +16 AceView exon 7647373 7647433 . + . Parent=A2BP1.kAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.kAug10 +16 AceView exon 7680605 7680685 . + . Parent=A2BP1.kAug10 +16 AceView exon 7703817 7703848 . + . Parent=A2BP1.kAug10 +16 AceView mRNA 7382750 7763340 . + . ID=A2BP1.dAug10;Parent=A2BP1 +16 AceView five_prime_UTR 7382750 7383002 . + . Parent=A2BP1.dAug10 +16 AceView CDS 7383003 7383089 . + 0 Parent=A2BP1.dAug10 +16 AceView CDS 7568149 7568391 . + 0 Parent=A2BP1.dAug10 +16 AceView CDS 7629779 7629922 . + 0 Parent=A2BP1.dAug10 +16 AceView CDS 7637249 7637302 . + 0 Parent=A2BP1.dAug10 +16 AceView CDS 7645551 7645643 . + 0 Parent=A2BP1.dAug10 +16 AceView CDS 7647373 7647433 . + 0 Parent=A2BP1.dAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.dAug10 +16 AceView CDS 7680605 7680685 . + 2 Parent=A2BP1.dAug10 +16 AceView CDS 7703817 7703949 . + 2 Parent=A2BP1.dAug10 +16 AceView CDS 7721559 7721601 . + 1 Parent=A2BP1.dAug10 +16 AceView CDS 7726776 7726840 . + 0 Parent=A2BP1.dAug10 +16 AceView CDS 7743317 7743369 . + 1 Parent=A2BP1.dAug10 +16 AceView CDS 7759058 7759131 . + 2 Parent=A2BP1.dAug10 +16 AceView CDS 7760623 7760625 . + 0 Parent=A2BP1.dAug10 +16 AceView three_prime_UTR 7760626 7763340 . + . Parent=A2BP1.dAug10 +16 AceView exon 7382750 7383089 . + . Parent=A2BP1.dAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.dAug10 +16 AceView exon 7629779 7629922 . + . Parent=A2BP1.dAug10 +16 AceView exon 7637249 7637302 . + . Parent=A2BP1.dAug10 +16 AceView exon 7645551 7645643 . + . Parent=A2BP1.dAug10 +16 AceView exon 7647373 7647433 . + . Parent=A2BP1.dAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.dAug10 +16 AceView exon 7680605 7680685 . + . Parent=A2BP1.dAug10 +16 AceView exon 7703817 7703949 . + . Parent=A2BP1.dAug10 +16 AceView exon 7721559 7721601 . + . Parent=A2BP1.dAug10 +16 AceView exon 7726776 7726840 . + . Parent=A2BP1.dAug10 +16 AceView exon 7743317 7743369 . + . Parent=A2BP1.dAug10 +16 AceView exon 7759058 7759133 . + . Parent=A2BP1.dAug10 +16 AceView exon 7760625 7763340 . + . Parent=A2BP1.dAug10 +16 AceView mRNA 7532642 7703837 . + . ID=A2BP1.lAug10;Parent=A2BP1 +16 AceView five_prime_UTR 7532642 7532749 . + . Parent=A2BP1.lAug10 +16 AceView CDS 7532750 7532767 . + 0 Parent=A2BP1.lAug10 +16 AceView CDS 7568149 7568391 . + 0 Parent=A2BP1.lAug10 +16 AceView CDS 7629779 7629922 . + 0 Parent=A2BP1.lAug10 +16 AceView CDS 7637249 7637302 . + 0 Parent=A2BP1.lAug10 +16 AceView CDS 7645551 7645643 . + 0 Parent=A2BP1.lAug10 +16 AceView CDS 7647373 7647433 . + 0 Parent=A2BP1.lAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.lAug10 +16 AceView CDS 7703817 7703836 . + 2 Parent=A2BP1.lAug10 +16 AceView three_prime_UTR 7703837 7703837 . + . Parent=A2BP1.lAug10 +16 AceView exon 7532642 7532767 . + . Parent=A2BP1.lAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.lAug10 +16 AceView exon 7629779 7629922 . + . Parent=A2BP1.lAug10 +16 AceView exon 7637249 7637302 . + . Parent=A2BP1.lAug10 +16 AceView exon 7645551 7645643 . + . Parent=A2BP1.lAug10 +16 AceView exon 7647373 7647433 . + . Parent=A2BP1.lAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.lAug10 +16 AceView exon 7703817 7703837 . + . Parent=A2BP1.lAug10 +16 AceView mRNA 7703849 7760821 . + . ID=A2BP1.mAug10;Parent=A2BP1 +16 AceView five_prime_UTR 7703849 7703850 . + . Parent=A2BP1.mAug10 +16 AceView CDS 7703851 7703949 . + 0 Parent=A2BP1.mAug10 +16 AceView CDS 7726776 7726840 . + 0 Parent=A2BP1.mAug10 +16 AceView CDS 7759058 7759133 . + 1 Parent=A2BP1.mAug10 +16 AceView CDS 7760625 7760747 . + 0 Parent=A2BP1.mAug10 +16 AceView three_prime_UTR 7760748 7760821 . + . Parent=A2BP1.mAug10 +16 AceView exon 7703849 7703949 . + . Parent=A2BP1.mAug10 +16 AceView exon 7726776 7726840 . + . Parent=A2BP1.mAug10 +16 AceView exon 7759058 7759133 . + . Parent=A2BP1.mAug10 +16 AceView exon 7760625 7760821 . + . Parent=A2BP1.mAug10 +16 AceView mRNA 6068990 7763341 . + . ID=A2BP1.cAug10;Parent=A2BP1 +16 AceView five_prime_UTR 6068990 6069993 . + . Parent=A2BP1.cAug10 +16 AceView five_prime_UTR 6366996 6367058 . + . Parent=A2BP1.cAug10 +16 AceView five_prime_UTR 6704604 6704651 . + . Parent=A2BP1.cAug10 +16 AceView five_prime_UTR 7102058 7102072 . + . Parent=A2BP1.cAug10 +16 AceView CDS 7102073 7102099 . + 0 Parent=A2BP1.cAug10 +16 AceView CDS 7568149 7568391 . + 0 Parent=A2BP1.cAug10 +16 AceView CDS 7629779 7629922 . + 0 Parent=A2BP1.cAug10 +16 AceView CDS 7637249 7637302 . + 0 Parent=A2BP1.cAug10 +16 AceView CDS 7645551 7645643 . + 0 Parent=A2BP1.cAug10 +16 AceView CDS 7647373 7647433 . + 0 Parent=A2BP1.cAug10 +16 AceView CDS 7657287 7657340 . + 2 Parent=A2BP1.cAug10 +16 AceView CDS 7680605 7680685 . + 2 Parent=A2BP1.cAug10 +16 AceView CDS 7703817 7703949 . + 2 Parent=A2BP1.cAug10 +16 AceView CDS 7714931 7714970 . + 1 Parent=A2BP1.cAug10 +16 AceView CDS 7726776 7726840 . + 0 Parent=A2BP1.cAug10 +16 AceView CDS 7759058 7759133 . + 1 Parent=A2BP1.cAug10 +16 AceView CDS 7760625 7760747 . + 0 Parent=A2BP1.cAug10 +16 AceView three_prime_UTR 7760748 7763341 . + . Parent=A2BP1.cAug10 +16 AceView exon 6068990 6069993 . + . Parent=A2BP1.cAug10 +16 AceView exon 6366996 6367058 . + . Parent=A2BP1.cAug10 +16 AceView exon 6704604 6704651 . + . Parent=A2BP1.cAug10 +16 AceView exon 7102058 7102099 . + . Parent=A2BP1.cAug10 +16 AceView exon 7568149 7568391 . + . Parent=A2BP1.cAug10 +16 AceView exon 7629779 7629922 . + . Parent=A2BP1.cAug10 +16 AceView exon 7637249 7637302 . + . Parent=A2BP1.cAug10 +16 AceView exon 7645551 7645643 . + . Parent=A2BP1.cAug10 +16 AceView exon 7647373 7647433 . + . Parent=A2BP1.cAug10 +16 AceView exon 7657287 7657340 . + . Parent=A2BP1.cAug10 +16 AceView exon 7680605 7680685 . + . Parent=A2BP1.cAug10 +16 AceView exon 7703817 7703949 . + . Parent=A2BP1.cAug10 +16 AceView exon 7714931 7714970 . + . Parent=A2BP1.cAug10 +16 AceView exon 7726776 7726840 . + . Parent=A2BP1.cAug10 +16 AceView exon 7759058 7759133 . + . Parent=A2BP1.cAug10 +16 AceView exon 7760625 7763341 . + . Parent=A2BP1.cAug10 +16 AceView transcript 7725433 7760841 . + . ID=A2BP1.pAug10;Parent=A2BP1 +16 AceView exon 7725433 7725858 . + . Parent=A2BP1.pAug10 +16 AceView exon 7726776 7726840 . + . Parent=A2BP1.pAug10 +16 AceView exon 7759058 7759133 . + . Parent=A2BP1.pAug10 +16 AceView exon 7760625 7760841 . + . Parent=A2BP1.pAug10 +16 AceView transcript 7711158 7711733 . + . ID=A2BP1.sAug10-unspliced;Parent=A2BP1 +16 AceView exon 7711158 7711733 . + . Parent=A2BP1.sAug10-unspliced +12 AceView gene 8975069 9039597 . + . ID=A2ML1;Name=A2ML1 +12 AceView mRNA 8975175 9028414 . + . ID=A2ML1.aAug10;Parent=A2ML1 +12 AceView five_prime_UTR 8975175 8975247 . + . Parent=A2ML1.aAug10 +12 AceView CDS 8975248 8975309 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 8975778 8975961 . + 1 Parent=A2ML1.aAug10 +12 AceView CDS 8976316 8976478 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 8982323 8982375 . + 2 Parent=A2ML1.aAug10 +12 AceView CDS 8987258 8987278 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 8988103 8988262 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 8988851 8988935 . + 2 Parent=A2ML1.aAug10 +12 AceView CDS 8990036 8990162 . + 1 Parent=A2ML1.aAug10 +12 AceView CDS 8990932 8991046 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 8991709 8991818 . + 2 Parent=A2ML1.aAug10 +12 AceView CDS 8993965 8994132 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 8995730 8995957 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 8998038 8998098 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 8998673 8998818 . + 2 Parent=A2ML1.aAug10 +12 AceView CDS 9000145 9000294 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 9001316 9001510 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 9002265 9002355 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 9002756 9002870 . + 2 Parent=A2ML1.aAug10 +12 AceView CDS 9004380 9004608 . + 1 Parent=A2ML1.aAug10 +12 AceView CDS 9004806 9004932 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 9006724 9006845 . + 2 Parent=A2ML1.aAug10 +12 AceView CDS 9007376 9007427 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 9008105 9008188 . + 2 Parent=A2ML1.aAug10 +12 AceView CDS 9009760 9009936 . + 2 Parent=A2ML1.aAug10 +12 AceView CDS 9010103 9010184 . + 2 Parent=A2ML1.aAug10 +12 AceView CDS 9010542 9010698 . + 1 Parent=A2ML1.aAug10 +12 AceView CDS 9013477 9013551 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 9013731 9013893 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 9016390 9016604 . + 2 Parent=A2ML1.aAug10 +12 AceView CDS 9020438 9020653 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 9020826 9020953 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 9021133 9021223 . + 1 Parent=A2ML1.aAug10 +12 AceView CDS 9021731 9021799 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 9027021 9027123 . + 0 Parent=A2ML1.aAug10 +12 AceView CDS 9027567 9027607 . + 2 Parent=A2ML1.aAug10 +12 AceView three_prime_UTR 9027608 9027608 . + . Parent=A2ML1.aAug10 +12 AceView three_prime_UTR 9028057 9028414 . + . Parent=A2ML1.aAug10 +12 AceView exon 8975175 8975309 . + . Parent=A2ML1.aAug10 +12 AceView exon 8975778 8975961 . + . Parent=A2ML1.aAug10 +12 AceView exon 8976316 8976478 . + . Parent=A2ML1.aAug10 +12 AceView exon 8982323 8982375 . + . Parent=A2ML1.aAug10 +12 AceView exon 8987258 8987278 . + . Parent=A2ML1.aAug10 +12 AceView exon 8988103 8988262 . + . Parent=A2ML1.aAug10 +12 AceView exon 8988851 8988935 . + . Parent=A2ML1.aAug10 +12 AceView exon 8990036 8990162 . + . Parent=A2ML1.aAug10 +12 AceView exon 8990932 8991046 . + . Parent=A2ML1.aAug10 +12 AceView exon 8991709 8991818 . + . Parent=A2ML1.aAug10 +12 AceView exon 8993965 8994132 . + . Parent=A2ML1.aAug10 +12 AceView exon 8995730 8995957 . + . Parent=A2ML1.aAug10 +12 AceView exon 8998038 8998098 . + . Parent=A2ML1.aAug10 +12 AceView exon 8998673 8998818 . + . Parent=A2ML1.aAug10 +12 AceView exon 9000145 9000294 . + . Parent=A2ML1.aAug10 +12 AceView exon 9001316 9001510 . + . Parent=A2ML1.aAug10 +12 AceView exon 9002265 9002355 . + . Parent=A2ML1.aAug10 +12 AceView exon 9002756 9002870 . + . Parent=A2ML1.aAug10 +12 AceView exon 9004380 9004608 . + . Parent=A2ML1.aAug10 +12 AceView exon 9004806 9004932 . + . Parent=A2ML1.aAug10 +12 AceView exon 9006724 9006845 . + . Parent=A2ML1.aAug10 +12 AceView exon 9007376 9007427 . + . Parent=A2ML1.aAug10 +12 AceView exon 9008105 9008188 . + . Parent=A2ML1.aAug10 +12 AceView exon 9009760 9009936 . + . Parent=A2ML1.aAug10 +12 AceView exon 9010103 9010184 . + . Parent=A2ML1.aAug10 +12 AceView exon 9010542 9010698 . + . Parent=A2ML1.aAug10 +12 AceView exon 9013477 9013551 . + . Parent=A2ML1.aAug10 +12 AceView exon 9013731 9013893 . + . Parent=A2ML1.aAug10 +12 AceView exon 9016390 9016604 . + . Parent=A2ML1.aAug10 +12 AceView exon 9020438 9020653 . + . Parent=A2ML1.aAug10 +12 AceView exon 9020826 9020953 . + . Parent=A2ML1.aAug10 +12 AceView exon 9021133 9021223 . + . Parent=A2ML1.aAug10 +12 AceView exon 9021731 9021799 . + . Parent=A2ML1.aAug10 +12 AceView exon 9027021 9027123 . + . Parent=A2ML1.aAug10 +12 AceView exon 9027567 9027608 . + . Parent=A2ML1.aAug10 +12 AceView exon 9028057 9028414 . + . Parent=A2ML1.aAug10 +12 AceView mRNA 9009831 9010460 . + . ID=A2ML1.iAug10;Parent=A2ML1 +12 AceView five_prime_UTR 9009831 9009832 . + . Parent=A2ML1.iAug10 +12 AceView CDS 9009833 9009936 . + 0 Parent=A2ML1.iAug10 +12 AceView CDS 9010103 9010208 . + 1 Parent=A2ML1.iAug10 +12 AceView three_prime_UTR 9010209 9010460 . + . Parent=A2ML1.iAug10 +12 AceView exon 9009831 9009936 . + . Parent=A2ML1.iAug10 +12 AceView exon 9010103 9010460 . + . Parent=A2ML1.iAug10 +12 AceView mRNA 9020539 9039597 . + . ID=A2ML1.eAug10;Parent=A2ML1 +12 AceView five_prime_UTR 9020539 9020539 . + . Parent=A2ML1.eAug10 +12 AceView CDS 9020540 9020653 . + 0 Parent=A2ML1.eAug10 +12 AceView CDS 9020826 9020953 . + 0 Parent=A2ML1.eAug10 +12 AceView CDS 9021133 9021223 . + 1 Parent=A2ML1.eAug10 +12 AceView CDS 9021731 9021799 . + 0 Parent=A2ML1.eAug10 +12 AceView CDS 9027021 9027123 . + 0 Parent=A2ML1.eAug10 +12 AceView CDS 9027567 9027607 . + 2 Parent=A2ML1.eAug10 +12 AceView three_prime_UTR 9027608 9027608 . + . Parent=A2ML1.eAug10 +12 AceView three_prime_UTR 9033120 9033212 . + . Parent=A2ML1.eAug10 +12 AceView three_prime_UTR 9039103 9039597 . + . Parent=A2ML1.eAug10 +12 AceView exon 9020539 9020653 . + . Parent=A2ML1.eAug10 +12 AceView exon 9020826 9020953 . + . Parent=A2ML1.eAug10 +12 AceView exon 9021133 9021223 . + . Parent=A2ML1.eAug10 +12 AceView exon 9021731 9021799 . + . Parent=A2ML1.eAug10 +12 AceView exon 9027021 9027123 . + . Parent=A2ML1.eAug10 +12 AceView exon 9027567 9027608 . + . Parent=A2ML1.eAug10 +12 AceView exon 9033120 9033212 . + . Parent=A2ML1.eAug10 +12 AceView exon 9039103 9039597 . + . Parent=A2ML1.eAug10 +12 AceView transcript 8976109 8987566 . + . ID=A2ML1.jAug10;Parent=A2ML1 +12 AceView exon 8976109 8976178 . + . Parent=A2ML1.jAug10 +12 AceView exon 8976316 8976478 . + . Parent=A2ML1.jAug10 +12 AceView exon 8982323 8982375 . + . Parent=A2ML1.jAug10 +12 AceView exon 8987258 8987566 . + . Parent=A2ML1.jAug10 +12 AceView mRNA 8997879 9001391 . + . ID=A2ML1.fAug10;Parent=A2ML1 +12 AceView five_prime_UTR 8997879 8998061 . + . Parent=A2ML1.fAug10 +12 AceView CDS 8998062 8998098 . + 0 Parent=A2ML1.fAug10 +12 AceView CDS 8998673 8998818 . + 2 Parent=A2ML1.fAug10 +12 AceView CDS 9000145 9000294 . + 0 Parent=A2ML1.fAug10 +12 AceView CDS 9001316 9001390 . + 0 Parent=A2ML1.fAug10 +12 AceView three_prime_UTR 9001391 9001391 . + . Parent=A2ML1.fAug10 +12 AceView exon 8997879 8998098 . + . Parent=A2ML1.fAug10 +12 AceView exon 8998673 8998818 . + . Parent=A2ML1.fAug10 +12 AceView exon 9000145 9000294 . + . Parent=A2ML1.fAug10 +12 AceView exon 9001316 9001391 . + . Parent=A2ML1.fAug10 +12 AceView mRNA 8997550 8998720 . + . ID=A2ML1.hAug10;Parent=A2ML1 +12 AceView five_prime_UTR 8997550 8997767 . + . Parent=A2ML1.hAug10 +12 AceView CDS 8997768 8997902 . + 0 Parent=A2ML1.hAug10 +12 AceView CDS 8998038 8998098 . + 0 Parent=A2ML1.hAug10 +12 AceView CDS 8998673 8998719 . + 2 Parent=A2ML1.hAug10 +12 AceView three_prime_UTR 8998720 8998720 . + . Parent=A2ML1.hAug10 +12 AceView exon 8997550 8997902 . + . Parent=A2ML1.hAug10 +12 AceView exon 8998038 8998098 . + . Parent=A2ML1.hAug10 +12 AceView exon 8998673 8998720 . + . Parent=A2ML1.hAug10 +12 AceView mRNA 8975069 9029381 . + . ID=A2ML1.bAug10;Parent=A2ML1 +12 AceView five_prime_UTR 8975069 8975247 . + . Parent=A2ML1.bAug10 +12 AceView CDS 8975248 8975309 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 8975778 8975961 . + 1 Parent=A2ML1.bAug10 +12 AceView CDS 8976316 8976478 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 8982323 8982375 . + 2 Parent=A2ML1.bAug10 +12 AceView CDS 8987258 8987278 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 8988103 8988262 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 8988851 8988935 . + 2 Parent=A2ML1.bAug10 +12 AceView CDS 8990036 8990162 . + 1 Parent=A2ML1.bAug10 +12 AceView CDS 8990932 8991046 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 8991709 8991818 . + 2 Parent=A2ML1.bAug10 +12 AceView CDS 8993965 8994132 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 8995730 8995957 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 8998038 8998098 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 8998673 8998818 . + 2 Parent=A2ML1.bAug10 +12 AceView CDS 9000145 9000294 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 9001316 9001510 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 9002265 9002355 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 9002756 9002870 . + 2 Parent=A2ML1.bAug10 +12 AceView CDS 9004380 9004608 . + 1 Parent=A2ML1.bAug10 +12 AceView CDS 9004806 9004932 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 9006724 9006845 . + 2 Parent=A2ML1.bAug10 +12 AceView CDS 9007376 9007427 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 9008105 9008188 . + 2 Parent=A2ML1.bAug10 +12 AceView CDS 9009760 9009936 . + 2 Parent=A2ML1.bAug10 +12 AceView CDS 9010103 9010184 . + 2 Parent=A2ML1.bAug10 +12 AceView CDS 9010542 9010698 . + 1 Parent=A2ML1.bAug10 +12 AceView CDS 9013477 9013551 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 9013731 9013893 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 9016390 9016604 . + 2 Parent=A2ML1.bAug10 +12 AceView CDS 9020438 9020653 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 9020826 9020953 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 9021133 9021223 . + 1 Parent=A2ML1.bAug10 +12 AceView CDS 9021731 9021799 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 9027021 9027123 . + 0 Parent=A2ML1.bAug10 +12 AceView CDS 9027567 9027607 . + 2 Parent=A2ML1.bAug10 +12 AceView three_prime_UTR 9027608 9027608 . + . Parent=A2ML1.bAug10 +12 AceView three_prime_UTR 9028654 9029381 . + . Parent=A2ML1.bAug10 +12 AceView exon 8975069 8975309 . + . Parent=A2ML1.bAug10 +12 AceView exon 8975778 8975961 . + . Parent=A2ML1.bAug10 +12 AceView exon 8976316 8976478 . + . Parent=A2ML1.bAug10 +12 AceView exon 8982323 8982375 . + . Parent=A2ML1.bAug10 +12 AceView exon 8987258 8987278 . + . Parent=A2ML1.bAug10 +12 AceView exon 8988103 8988262 . + . Parent=A2ML1.bAug10 +12 AceView exon 8988851 8988935 . + . Parent=A2ML1.bAug10 +12 AceView exon 8990036 8990162 . + . Parent=A2ML1.bAug10 +12 AceView exon 8990932 8991046 . + . Parent=A2ML1.bAug10 +12 AceView exon 8991709 8991818 . + . Parent=A2ML1.bAug10 +12 AceView exon 8993965 8994132 . + . Parent=A2ML1.bAug10 +12 AceView exon 8995730 8995957 . + . Parent=A2ML1.bAug10 +12 AceView exon 8998038 8998098 . + . Parent=A2ML1.bAug10 +12 AceView exon 8998673 8998818 . + . Parent=A2ML1.bAug10 +12 AceView exon 9000145 9000294 . + . Parent=A2ML1.bAug10 +12 AceView exon 9001316 9001510 . + . Parent=A2ML1.bAug10 +12 AceView exon 9002265 9002355 . + . Parent=A2ML1.bAug10 +12 AceView exon 9002756 9002870 . + . Parent=A2ML1.bAug10 +12 AceView exon 9004380 9004608 . + . Parent=A2ML1.bAug10 +12 AceView exon 9004806 9004932 . + . Parent=A2ML1.bAug10 +12 AceView exon 9006724 9006845 . + . Parent=A2ML1.bAug10 +12 AceView exon 9007376 9007427 . + . Parent=A2ML1.bAug10 +12 AceView exon 9008105 9008188 . + . Parent=A2ML1.bAug10 +12 AceView exon 9009760 9009936 . + . Parent=A2ML1.bAug10 +12 AceView exon 9010103 9010184 . + . Parent=A2ML1.bAug10 +12 AceView exon 9010542 9010698 . + . Parent=A2ML1.bAug10 +12 AceView exon 9013477 9013551 . + . Parent=A2ML1.bAug10 +12 AceView exon 9013731 9013893 . + . Parent=A2ML1.bAug10 +12 AceView exon 9016390 9016604 . + . Parent=A2ML1.bAug10 +12 AceView exon 9020438 9020653 . + . Parent=A2ML1.bAug10 +12 AceView exon 9020826 9020953 . + . Parent=A2ML1.bAug10 +12 AceView exon 9021133 9021223 . + . Parent=A2ML1.bAug10 +12 AceView exon 9021731 9021799 . + . Parent=A2ML1.bAug10 +12 AceView exon 9027021 9027123 . + . Parent=A2ML1.bAug10 +12 AceView exon 9027567 9027608 . + . Parent=A2ML1.bAug10 +12 AceView exon 9028654 9029381 . + . Parent=A2ML1.bAug10 +12 AceView mRNA 8997878 9004932 . + . ID=A2ML1.dAug10;Parent=A2ML1 +12 AceView five_prime_UTR 8997878 8997895 . + . Parent=A2ML1.dAug10 +12 AceView CDS 8997896 8997907 . + 0 Parent=A2ML1.dAug10 +12 AceView CDS 8998038 8998098 . + 0 Parent=A2ML1.dAug10 +12 AceView CDS 8998673 8998818 . + 2 Parent=A2ML1.dAug10 +12 AceView CDS 9000145 9000294 . + 0 Parent=A2ML1.dAug10 +12 AceView CDS 9001316 9001510 . + 0 Parent=A2ML1.dAug10 +12 AceView CDS 9002265 9002355 . + 0 Parent=A2ML1.dAug10 +12 AceView CDS 9002759 9002870 . + 2 Parent=A2ML1.dAug10 +12 AceView CDS 9004380 9004608 . + 1 Parent=A2ML1.dAug10 +12 AceView CDS 9004806 9004931 . + 0 Parent=A2ML1.dAug10 +12 AceView three_prime_UTR 9004932 9004932 . + . Parent=A2ML1.dAug10 +12 AceView exon 8997878 8997907 . + . Parent=A2ML1.dAug10 +12 AceView exon 8998038 8998098 . + . Parent=A2ML1.dAug10 +12 AceView exon 8998673 8998818 . + . Parent=A2ML1.dAug10 +12 AceView exon 9000145 9000294 . + . Parent=A2ML1.dAug10 +12 AceView exon 9001316 9001510 . + . Parent=A2ML1.dAug10 +12 AceView exon 9002265 9002355 . + . Parent=A2ML1.dAug10 +12 AceView exon 9002759 9002870 . + . Parent=A2ML1.dAug10 +12 AceView exon 9004380 9004608 . + . Parent=A2ML1.dAug10 +12 AceView exon 9004806 9004932 . + . Parent=A2ML1.dAug10 +12 AceView mRNA 8976251 8976564 . + . ID=A2ML1.gAug10-unspliced;Parent=A2ML1 +12 AceView five_prime_UTR 8976251 8976252 . + . Parent=A2ML1.gAug10-unspliced +12 AceView CDS 8976253 8976564 . + 0 Parent=A2ML1.gAug10-unspliced +12 AceView exon 8976251 8976564 . + . Parent=A2ML1.gAug10-unspliced +12 AceView mRNA 8997600 9029052 . + . ID=A2ML1.cAug10;Parent=A2ML1 +12 AceView five_prime_UTR 8997600 8997767 . + . Parent=A2ML1.cAug10 +12 AceView CDS 8997768 8997770 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 8998038 8998098 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 8998673 8998818 . + 2 Parent=A2ML1.cAug10 +12 AceView CDS 9000145 9000294 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 9001316 9001510 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 9002265 9002355 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 9002756 9002870 . + 2 Parent=A2ML1.cAug10 +12 AceView CDS 9004380 9004608 . + 1 Parent=A2ML1.cAug10 +12 AceView CDS 9004806 9004932 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 9006724 9006845 . + 2 Parent=A2ML1.cAug10 +12 AceView CDS 9007376 9007427 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 9008105 9008188 . + 2 Parent=A2ML1.cAug10 +12 AceView CDS 9009760 9009936 . + 2 Parent=A2ML1.cAug10 +12 AceView CDS 9010103 9010184 . + 2 Parent=A2ML1.cAug10 +12 AceView CDS 9010542 9010698 . + 1 Parent=A2ML1.cAug10 +12 AceView CDS 9013477 9013551 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 9013731 9013893 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 9016390 9016604 . + 2 Parent=A2ML1.cAug10 +12 AceView CDS 9020438 9020653 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 9020826 9020953 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 9021133 9021223 . + 1 Parent=A2ML1.cAug10 +12 AceView CDS 9021731 9021799 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 9027021 9027123 . + 0 Parent=A2ML1.cAug10 +12 AceView CDS 9027567 9027607 . + 2 Parent=A2ML1.cAug10 +12 AceView three_prime_UTR 9027608 9027608 . + . Parent=A2ML1.cAug10 +12 AceView three_prime_UTR 9028654 9029052 . + . Parent=A2ML1.cAug10 +12 AceView exon 8997600 8997770 . + . Parent=A2ML1.cAug10 +12 AceView exon 8998038 8998098 . + . Parent=A2ML1.cAug10 +12 AceView exon 8998673 8998818 . + . Parent=A2ML1.cAug10 +12 AceView exon 9000145 9000294 . + . Parent=A2ML1.cAug10 +12 AceView exon 9001316 9001510 . + . Parent=A2ML1.cAug10 +12 AceView exon 9002265 9002355 . + . Parent=A2ML1.cAug10 +12 AceView exon 9002756 9002870 . + . Parent=A2ML1.cAug10 +12 AceView exon 9004380 9004608 . + . Parent=A2ML1.cAug10 +12 AceView exon 9004806 9004932 . + . Parent=A2ML1.cAug10 +12 AceView exon 9006724 9006845 . + . Parent=A2ML1.cAug10 +12 AceView exon 9007376 9007427 . + . Parent=A2ML1.cAug10 +12 AceView exon 9008105 9008188 . + . Parent=A2ML1.cAug10 +12 AceView exon 9009760 9009936 . + . Parent=A2ML1.cAug10 +12 AceView exon 9010103 9010184 . + . Parent=A2ML1.cAug10 +12 AceView exon 9010542 9010698 . + . Parent=A2ML1.cAug10 +12 AceView exon 9013477 9013551 . + . Parent=A2ML1.cAug10 +12 AceView exon 9013731 9013893 . + . Parent=A2ML1.cAug10 +12 AceView exon 9016390 9016604 . + . Parent=A2ML1.cAug10 +12 AceView exon 9020438 9020653 . + . Parent=A2ML1.cAug10 +12 AceView exon 9020826 9020953 . + . Parent=A2ML1.cAug10 +12 AceView exon 9021133 9021223 . + . Parent=A2ML1.cAug10 +12 AceView exon 9021731 9021799 . + . Parent=A2ML1.cAug10 +12 AceView exon 9027021 9027123 . + . Parent=A2ML1.cAug10 +12 AceView exon 9027567 9027608 . + . Parent=A2ML1.cAug10 +12 AceView exon 9028654 9029052 . + . Parent=A2ML1.cAug10 +12 AceView gene 125549918 125627878 . + . ID=AACS;Name=AACS +12 AceView mRNA 125575559 125626866 . + . ID=AACS.eAug10;Parent=AACS +12 AceView five_prime_UTR 125575559 125575658 . + . Parent=AACS.eAug10 +12 AceView five_prime_UTR 125575972 125576006 . + . Parent=AACS.eAug10 +12 AceView CDS 125576007 125576069 . + 0 Parent=AACS.eAug10 +12 AceView CDS 125587225 125587339 . + 0 Parent=AACS.eAug10 +12 AceView CDS 125587546 125587627 . + 2 Parent=AACS.eAug10 +12 AceView CDS 125591667 125591814 . + 1 Parent=AACS.eAug10 +12 AceView CDS 125599023 125599103 . + 0 Parent=AACS.eAug10 +12 AceView CDS 125618549 125618618 . + 0 Parent=AACS.eAug10 +12 AceView CDS 125619340 125619398 . + 2 Parent=AACS.eAug10 +12 AceView CDS 125626638 125626775 . + 0 Parent=AACS.eAug10 +12 AceView three_prime_UTR 125626776 125626866 . + . Parent=AACS.eAug10 +12 AceView exon 125575559 125575658 . + . Parent=AACS.eAug10 +12 AceView exon 125575972 125576069 . + . Parent=AACS.eAug10 +12 AceView exon 125587225 125587339 . + . Parent=AACS.eAug10 +12 AceView exon 125587546 125587627 . + . Parent=AACS.eAug10 +12 AceView exon 125591667 125591814 . + . Parent=AACS.eAug10 +12 AceView exon 125599023 125599103 . + . Parent=AACS.eAug10 +12 AceView exon 125618549 125618618 . + . Parent=AACS.eAug10 +12 AceView exon 125619340 125619398 . + . Parent=AACS.eAug10 +12 AceView exon 125626638 125626866 . + . Parent=AACS.eAug10 +12 AceView mRNA 125549930 125627860 . + . ID=AACS.bAug10;Parent=AACS +12 AceView CDS 125549930 125550263 . + 0 Parent=AACS.bAug10 +12 AceView CDS 125558422 125558525 . + 2 Parent=AACS.bAug10 +12 AceView CDS 125561037 125561157 . + 0 Parent=AACS.bAug10 +12 AceView CDS 125570876 125570989 . + 2 Parent=AACS.bAug10 +12 AceView CDS 125575972 125576069 . + 2 Parent=AACS.bAug10 +12 AceView CDS 125587225 125587339 . + 0 Parent=AACS.bAug10 +12 AceView CDS 125587546 125587627 . + 2 Parent=AACS.bAug10 +12 AceView CDS 125591667 125591814 . + 1 Parent=AACS.bAug10 +12 AceView CDS 125599023 125599103 . + 0 Parent=AACS.bAug10 +12 AceView CDS 125603187 125603311 . + 0 Parent=AACS.bAug10 +12 AceView CDS 125609251 125609315 . + 1 Parent=AACS.bAug10 +12 AceView CDS 125609448 125609570 . + 2 Parent=AACS.bAug10 +12 AceView CDS 125612707 125612820 . + 2 Parent=AACS.bAug10 +12 AceView CDS 125613881 125614006 . + 2 Parent=AACS.bAug10 +12 AceView CDS 125618549 125618618 . + 2 Parent=AACS.bAug10 +12 AceView CDS 125619340 125619398 . + 1 Parent=AACS.bAug10 +12 AceView CDS 125626638 125626759 . + 2 Parent=AACS.bAug10 +12 AceView three_prime_UTR 125626760 125627860 . + . Parent=AACS.bAug10 +12 AceView exon 125549930 125550263 . + . Parent=AACS.bAug10 +12 AceView exon 125558422 125558525 . + . Parent=AACS.bAug10 +12 AceView exon 125561037 125561157 . + . Parent=AACS.bAug10 +12 AceView exon 125570876 125570989 . + . Parent=AACS.bAug10 +12 AceView exon 125575972 125576069 . + . Parent=AACS.bAug10 +12 AceView exon 125587225 125587339 . + . Parent=AACS.bAug10 +12 AceView exon 125587546 125587627 . + . Parent=AACS.bAug10 +12 AceView exon 125591667 125591814 . + . Parent=AACS.bAug10 +12 AceView exon 125599023 125599103 . + . Parent=AACS.bAug10 +12 AceView exon 125603187 125603311 . + . Parent=AACS.bAug10 +12 AceView exon 125609251 125609315 . + . Parent=AACS.bAug10 +12 AceView exon 125609448 125609570 . + . Parent=AACS.bAug10 +12 AceView exon 125612707 125612820 . + . Parent=AACS.bAug10 +12 AceView exon 125613881 125614006 . + . Parent=AACS.bAug10 +12 AceView exon 125618549 125618618 . + . Parent=AACS.bAug10 +12 AceView exon 125619340 125619398 . + . Parent=AACS.bAug10 +12 AceView exon 125626638 125627860 . + . Parent=AACS.bAug10 +12 AceView mRNA 125549918 125627871 . + . ID=AACS.aAug10;Parent=AACS +12 AceView five_prime_UTR 125549918 125550130 . + . Parent=AACS.aAug10 +12 AceView CDS 125550131 125550263 . + 0 Parent=AACS.aAug10 +12 AceView CDS 125558422 125558525 . + 2 Parent=AACS.aAug10 +12 AceView CDS 125561037 125561157 . + 0 Parent=AACS.aAug10 +12 AceView CDS 125570876 125570989 . + 2 Parent=AACS.aAug10 +12 AceView CDS 125575972 125576069 . + 2 Parent=AACS.aAug10 +12 AceView CDS 125587225 125587339 . + 0 Parent=AACS.aAug10 +12 AceView CDS 125587546 125587627 . + 2 Parent=AACS.aAug10 +12 AceView CDS 125591667 125591814 . + 1 Parent=AACS.aAug10 +12 AceView CDS 125599023 125599103 . + 0 Parent=AACS.aAug10 +12 AceView CDS 125603187 125603311 . + 0 Parent=AACS.aAug10 +12 AceView CDS 125609251 125609315 . + 1 Parent=AACS.aAug10 +12 AceView CDS 125609448 125609570 . + 2 Parent=AACS.aAug10 +12 AceView CDS 125612707 125612820 . + 2 Parent=AACS.aAug10 +12 AceView CDS 125613881 125614006 . + 2 Parent=AACS.aAug10 +12 AceView CDS 125618549 125618618 . + 2 Parent=AACS.aAug10 +12 AceView CDS 125619340 125619398 . + 1 Parent=AACS.aAug10 +12 AceView CDS 125621208 125621410 . + 2 Parent=AACS.aAug10 +12 AceView CDS 125626638 125626775 . + 0 Parent=AACS.aAug10 +12 AceView three_prime_UTR 125626776 125627871 . + . Parent=AACS.aAug10 +12 AceView exon 125549918 125550263 . + . Parent=AACS.aAug10 +12 AceView exon 125558422 125558525 . + . Parent=AACS.aAug10 +12 AceView exon 125561037 125561157 . + . Parent=AACS.aAug10 +12 AceView exon 125570876 125570989 . + . Parent=AACS.aAug10 +12 AceView exon 125575972 125576069 . + . Parent=AACS.aAug10 +12 AceView exon 125587225 125587339 . + . Parent=AACS.aAug10 +12 AceView exon 125587546 125587627 . + . Parent=AACS.aAug10 +12 AceView exon 125591667 125591814 . + . Parent=AACS.aAug10 +12 AceView exon 125599023 125599103 . + . Parent=AACS.aAug10 +12 AceView exon 125603187 125603311 . + . Parent=AACS.aAug10 +12 AceView exon 125609251 125609315 . + . Parent=AACS.aAug10 +12 AceView exon 125609448 125609570 . + . Parent=AACS.aAug10 +12 AceView exon 125612707 125612820 . + . Parent=AACS.aAug10 +12 AceView exon 125613881 125614006 . + . Parent=AACS.aAug10 +12 AceView exon 125618549 125618618 . + . Parent=AACS.aAug10 +12 AceView exon 125619340 125619398 . + . Parent=AACS.aAug10 +12 AceView exon 125621208 125621410 . + . Parent=AACS.aAug10 +12 AceView exon 125626638 125627871 . + . Parent=AACS.aAug10 +12 AceView transcript 125620334 125621286 . + . ID=AACS.nAug10;Parent=AACS +12 AceView exon 125620334 125620738 . + . Parent=AACS.nAug10 +12 AceView exon 125621208 125621286 . + . Parent=AACS.nAug10 +12 AceView mRNA 125577027 125599027 . + . ID=AACS.lAug10;Parent=AACS +12 AceView five_prime_UTR 125577027 125577253 . + . Parent=AACS.lAug10 +12 AceView five_prime_UTR 125587225 125587311 . + . Parent=AACS.lAug10 +12 AceView CDS 125587312 125587339 . + 0 Parent=AACS.lAug10 +12 AceView CDS 125587546 125587627 . + 2 Parent=AACS.lAug10 +12 AceView CDS 125591667 125591814 . + 1 Parent=AACS.lAug10 +12 AceView CDS 125599023 125599025 . + 0 Parent=AACS.lAug10 +12 AceView three_prime_UTR 125599026 125599027 . + . Parent=AACS.lAug10 +12 AceView exon 125577027 125577253 . + . Parent=AACS.lAug10 +12 AceView exon 125587225 125587339 . + . Parent=AACS.lAug10 +12 AceView exon 125587546 125587627 . + . Parent=AACS.lAug10 +12 AceView exon 125591667 125591814 . + . Parent=AACS.lAug10 +12 AceView exon 125599023 125599027 . + . Parent=AACS.lAug10 +12 AceView mRNA 125549980 125591708 . + . ID=AACS.iAug10;Parent=AACS +12 AceView five_prime_UTR 125549980 125550263 . + . Parent=AACS.iAug10 +12 AceView five_prime_UTR 125558422 125558525 . + . Parent=AACS.iAug10 +12 AceView five_prime_UTR 125561037 125561157 . + . Parent=AACS.iAug10 +12 AceView five_prime_UTR 125562642 125562882 . + . Parent=AACS.iAug10 +12 AceView CDS 125562883 125562916 . + 0 Parent=AACS.iAug10 +12 AceView CDS 125570876 125570989 . + 2 Parent=AACS.iAug10 +12 AceView CDS 125575972 125576069 . + 2 Parent=AACS.iAug10 +12 AceView CDS 125587225 125587339 . + 0 Parent=AACS.iAug10 +12 AceView CDS 125587546 125587627 . + 2 Parent=AACS.iAug10 +12 AceView CDS 125591667 125591706 . + 1 Parent=AACS.iAug10 +12 AceView three_prime_UTR 125591707 125591708 . + . Parent=AACS.iAug10 +12 AceView exon 125549980 125550263 . + . Parent=AACS.iAug10 +12 AceView exon 125558422 125558525 . + . Parent=AACS.iAug10 +12 AceView exon 125561037 125561157 . + . Parent=AACS.iAug10 +12 AceView exon 125562642 125562916 . + . Parent=AACS.iAug10 +12 AceView exon 125570876 125570989 . + . Parent=AACS.iAug10 +12 AceView exon 125575972 125576069 . + . Parent=AACS.iAug10 +12 AceView exon 125587225 125587339 . + . Parent=AACS.iAug10 +12 AceView exon 125587546 125587627 . + . Parent=AACS.iAug10 +12 AceView exon 125591667 125591708 . + . Parent=AACS.iAug10 +12 AceView mRNA 125613322 125627865 . + . ID=AACS.kAug10;Parent=AACS +12 AceView five_prime_UTR 125613322 125613958 . + . Parent=AACS.kAug10 +12 AceView CDS 125613959 125614006 . + 0 Parent=AACS.kAug10 +12 AceView CDS 125618549 125618618 . + 0 Parent=AACS.kAug10 +12 AceView CDS 125619340 125619398 . + 2 Parent=AACS.kAug10 +12 AceView CDS 125626638 125626775 . + 0 Parent=AACS.kAug10 +12 AceView three_prime_UTR 125626776 125627865 . + . Parent=AACS.kAug10 +12 AceView exon 125613322 125614006 . + . Parent=AACS.kAug10 +12 AceView exon 125618549 125618618 . + . Parent=AACS.kAug10 +12 AceView exon 125619340 125619398 . + . Parent=AACS.kAug10 +12 AceView exon 125626638 125627865 . + . Parent=AACS.kAug10 +12 AceView mRNA 125589685 125627861 . + . ID=AACS.dAug10;Parent=AACS +12 AceView five_prime_UTR 125589685 125590340 . + . Parent=AACS.dAug10 +12 AceView five_prime_UTR 125591667 125591814 . + . Parent=AACS.dAug10 +12 AceView five_prime_UTR 125599023 125599103 . + . Parent=AACS.dAug10 +12 AceView five_prime_UTR 125603187 125603311 . + . Parent=AACS.dAug10 +12 AceView five_prime_UTR 125609251 125609467 . + . Parent=AACS.dAug10 +12 AceView CDS 125609468 125609570 . + 0 Parent=AACS.dAug10 +12 AceView CDS 125612707 125612820 . + 2 Parent=AACS.dAug10 +12 AceView CDS 125613881 125614006 . + 2 Parent=AACS.dAug10 +12 AceView CDS 125618549 125618618 . + 2 Parent=AACS.dAug10 +12 AceView CDS 125619340 125619398 . + 1 Parent=AACS.dAug10 +12 AceView CDS 125621208 125621410 . + 2 Parent=AACS.dAug10 +12 AceView CDS 125626638 125626775 . + 0 Parent=AACS.dAug10 +12 AceView three_prime_UTR 125626776 125627861 . + . Parent=AACS.dAug10 +12 AceView exon 125589685 125590340 . + . Parent=AACS.dAug10 +12 AceView exon 125591667 125591814 . + . Parent=AACS.dAug10 +12 AceView exon 125599023 125599103 . + . Parent=AACS.dAug10 +12 AceView exon 125603187 125603311 . + . Parent=AACS.dAug10 +12 AceView exon 125609251 125609570 . + . Parent=AACS.dAug10 +12 AceView exon 125612707 125612820 . + . Parent=AACS.dAug10 +12 AceView exon 125613881 125614006 . + . Parent=AACS.dAug10 +12 AceView exon 125618549 125618618 . + . Parent=AACS.dAug10 +12 AceView exon 125619340 125619398 . + . Parent=AACS.dAug10 +12 AceView exon 125621208 125621410 . + . Parent=AACS.dAug10 +12 AceView exon 125626638 125627861 . + . Parent=AACS.dAug10 +12 AceView mRNA 125611984 125627861 . + . ID=AACS.fAug10;Parent=AACS +12 AceView five_prime_UTR 125611984 125612732 . + . Parent=AACS.fAug10 +12 AceView CDS 125612733 125612820 . + 0 Parent=AACS.fAug10 +12 AceView CDS 125613881 125614006 . + 2 Parent=AACS.fAug10 +12 AceView CDS 125618549 125618618 . + 2 Parent=AACS.fAug10 +12 AceView CDS 125619340 125619398 . + 1 Parent=AACS.fAug10 +12 AceView CDS 125621208 125621410 . + 2 Parent=AACS.fAug10 +12 AceView CDS 125626638 125626775 . + 0 Parent=AACS.fAug10 +12 AceView three_prime_UTR 125626776 125627861 . + . Parent=AACS.fAug10 +12 AceView exon 125611984 125612820 . + . Parent=AACS.fAug10 +12 AceView exon 125613881 125614006 . + . Parent=AACS.fAug10 +12 AceView exon 125618549 125618618 . + . Parent=AACS.fAug10 +12 AceView exon 125619340 125619398 . + . Parent=AACS.fAug10 +12 AceView exon 125621208 125621410 . + . Parent=AACS.fAug10 +12 AceView exon 125626638 125627861 . + . Parent=AACS.fAug10 +12 AceView mRNA 125607467 125627878 . + . ID=AACS.hAug10;Parent=AACS +12 AceView five_prime_UTR 125607467 125609305 . + . Parent=AACS.hAug10 +12 AceView CDS 125609306 125609315 . + 0 Parent=AACS.hAug10 +12 AceView CDS 125609448 125609570 . + 2 Parent=AACS.hAug10 +12 AceView CDS 125612707 125612820 . + 2 Parent=AACS.hAug10 +12 AceView CDS 125613881 125614006 . + 2 Parent=AACS.hAug10 +12 AceView CDS 125618549 125618618 . + 2 Parent=AACS.hAug10 +12 AceView CDS 125619340 125619398 . + 1 Parent=AACS.hAug10 +12 AceView CDS 125626638 125626759 . + 2 Parent=AACS.hAug10 +12 AceView three_prime_UTR 125626760 125627878 . + . Parent=AACS.hAug10 +12 AceView exon 125607467 125609315 . + . Parent=AACS.hAug10 +12 AceView exon 125609448 125609570 . + . Parent=AACS.hAug10 +12 AceView exon 125612707 125612820 . + . Parent=AACS.hAug10 +12 AceView exon 125613881 125614006 . + . Parent=AACS.hAug10 +12 AceView exon 125618549 125618618 . + . Parent=AACS.hAug10 +12 AceView exon 125619340 125619398 . + . Parent=AACS.hAug10 +12 AceView exon 125626638 125627878 . + . Parent=AACS.hAug10 +12 AceView mRNA 125561042 125627861 . + . ID=AACS.cAug10;Parent=AACS +12 AceView five_prime_UTR 125561042 125561042 . + . Parent=AACS.cAug10 +12 AceView CDS 125561043 125561157 . + 0 Parent=AACS.cAug10 +12 AceView CDS 125570876 125570989 . + 2 Parent=AACS.cAug10 +12 AceView CDS 125575972 125576069 . + 2 Parent=AACS.cAug10 +12 AceView CDS 125587225 125587339 . + 0 Parent=AACS.cAug10 +12 AceView CDS 125587546 125587627 . + 2 Parent=AACS.cAug10 +12 AceView CDS 125591667 125591814 . + 1 Parent=AACS.cAug10 +12 AceView CDS 125599023 125599103 . + 0 Parent=AACS.cAug10 +12 AceView CDS 125603187 125603311 . + 0 Parent=AACS.cAug10 +12 AceView CDS 125618549 125618618 . + 1 Parent=AACS.cAug10 +12 AceView CDS 125619340 125619342 . + 0 Parent=AACS.cAug10 +12 AceView three_prime_UTR 125619343 125619398 . + . Parent=AACS.cAug10 +12 AceView three_prime_UTR 125621208 125621410 . + . Parent=AACS.cAug10 +12 AceView three_prime_UTR 125626638 125627861 . + . Parent=AACS.cAug10 +12 AceView exon 125561042 125561157 . + . Parent=AACS.cAug10 +12 AceView exon 125570876 125570989 . + . Parent=AACS.cAug10 +12 AceView exon 125575972 125576069 . + . Parent=AACS.cAug10 +12 AceView exon 125587225 125587339 . + . Parent=AACS.cAug10 +12 AceView exon 125587546 125587627 . + . Parent=AACS.cAug10 +12 AceView exon 125591667 125591814 . + . Parent=AACS.cAug10 +12 AceView exon 125599023 125599103 . + . Parent=AACS.cAug10 +12 AceView exon 125603187 125603311 . + . Parent=AACS.cAug10 +12 AceView exon 125618549 125618618 . + . Parent=AACS.cAug10 +12 AceView exon 125619340 125619398 . + . Parent=AACS.cAug10 +12 AceView exon 125621208 125621410 . + . Parent=AACS.cAug10 +12 AceView exon 125626638 125627861 . + . Parent=AACS.cAug10 +12 AceView mRNA 125612527 125626257 . + . ID=AACS.gAug10;Parent=AACS +12 AceView five_prime_UTR 125612527 125612732 . + . Parent=AACS.gAug10 +12 AceView CDS 125612733 125612820 . + 0 Parent=AACS.gAug10 +12 AceView CDS 125613881 125614006 . + 2 Parent=AACS.gAug10 +12 AceView CDS 125618549 125618618 . + 2 Parent=AACS.gAug10 +12 AceView CDS 125619340 125619398 . + 1 Parent=AACS.gAug10 +12 AceView CDS 125621208 125621488 . + 2 Parent=AACS.gAug10 +12 AceView three_prime_UTR 125621489 125626257 . + . Parent=AACS.gAug10 +12 AceView exon 125612527 125612820 . + . Parent=AACS.gAug10 +12 AceView exon 125613881 125614006 . + . Parent=AACS.gAug10 +12 AceView exon 125618549 125618618 . + . Parent=AACS.gAug10 +12 AceView exon 125619340 125619398 . + . Parent=AACS.gAug10 +12 AceView exon 125621208 125626257 . + . Parent=AACS.gAug10 +12 AceView mRNA 125598968 125626723 . + . ID=AACS.jAug10;Parent=AACS +12 AceView five_prime_UTR 125598968 125599103 . + . Parent=AACS.jAug10 +12 AceView five_prime_UTR 125618549 125618604 . + . Parent=AACS.jAug10 +12 AceView CDS 125618605 125618618 . + 0 Parent=AACS.jAug10 +12 AceView CDS 125619340 125619398 . + 1 Parent=AACS.jAug10 +12 AceView CDS 125621208 125621410 . + 2 Parent=AACS.jAug10 +12 AceView CDS 125626638 125626721 . + 0 Parent=AACS.jAug10 +12 AceView three_prime_UTR 125626722 125626723 . + . Parent=AACS.jAug10 +12 AceView exon 125598968 125599103 . + . Parent=AACS.jAug10 +12 AceView exon 125618549 125618618 . + . Parent=AACS.jAug10 +12 AceView exon 125619340 125619398 . + . Parent=AACS.jAug10 +12 AceView exon 125621208 125621410 . + . Parent=AACS.jAug10 +12 AceView exon 125626638 125626723 . + . Parent=AACS.jAug10 +19 AceView gene 58859074 58866549 . + . ID=A1BGAS;Name=A1BGAS +19 AceView mRNA 58859122 58866549 . + . ID=A1BGAS.dAug10;Parent=A1BGAS +19 AceView five_prime_UTR 58859122 58859210 . + . Parent=A1BGAS.dAug10 +19 AceView five_prime_UTR 58864745 58864840 . + . Parent=A1BGAS.dAug10 +19 AceView five_prime_UTR 58865080 58865830 . + . Parent=A1BGAS.dAug10 +19 AceView CDS 58865831 58866547 . + 0 Parent=A1BGAS.dAug10 +19 AceView three_prime_UTR 58866548 58866549 . + . Parent=A1BGAS.dAug10 +19 AceView exon 58859122 58859210 . + . Parent=A1BGAS.dAug10 +19 AceView exon 58864745 58864840 . + . Parent=A1BGAS.dAug10 +19 AceView exon 58865080 58866549 . + . Parent=A1BGAS.dAug10 +19 AceView mRNA 58859122 58866548 . + . ID=A1BGAS.cAug10;Parent=A1BGAS +19 AceView five_prime_UTR 58859122 58859210 . + . Parent=A1BGAS.cAug10 +19 AceView five_prime_UTR 58864687 58864840 . + . Parent=A1BGAS.cAug10 +19 AceView five_prime_UTR 58865080 58865830 . + . Parent=A1BGAS.cAug10 +19 AceView CDS 58865831 58866547 . + 0 Parent=A1BGAS.cAug10 +19 AceView three_prime_UTR 58866548 58866548 . + . Parent=A1BGAS.cAug10 +19 AceView exon 58859122 58859210 . + . Parent=A1BGAS.cAug10 +19 AceView exon 58864687 58864840 . + . Parent=A1BGAS.cAug10 +19 AceView exon 58865080 58866548 . + . Parent=A1BGAS.cAug10 +19 AceView mRNA 58862110 58866548 . + . ID=A1BGAS.bAug10;Parent=A1BGAS +19 AceView five_prime_UTR 58862110 58864403 . + . Parent=A1BGAS.bAug10 +19 AceView CDS 58864404 58864410 . + 0 Parent=A1BGAS.bAug10 +19 AceView CDS 58864745 58864840 . + 2 Parent=A1BGAS.bAug10 +19 AceView CDS 58865080 58865117 . + 2 Parent=A1BGAS.bAug10 +19 AceView three_prime_UTR 58865118 58865223 . + . Parent=A1BGAS.bAug10 +19 AceView three_prime_UTR 58865735 58866548 . + . Parent=A1BGAS.bAug10 +19 AceView exon 58862110 58864410 . + . Parent=A1BGAS.bAug10 +19 AceView exon 58864745 58864840 . + . Parent=A1BGAS.bAug10 +19 AceView exon 58865080 58865223 . + . Parent=A1BGAS.bAug10 +19 AceView exon 58865735 58866548 . + . Parent=A1BGAS.bAug10 +19 AceView mRNA 58859153 58866090 . + . ID=A1BGAS.aAug10;Parent=A1BGAS +19 AceView five_prime_UTR 58859153 58859153 . + . Parent=A1BGAS.aAug10 +19 AceView CDS 58859154 58859210 . + 0 Parent=A1BGAS.aAug10 +19 AceView CDS 58864687 58864840 . + 0 Parent=A1BGAS.aAug10 +19 AceView CDS 58865080 58865117 . + 2 Parent=A1BGAS.aAug10 +19 AceView three_prime_UTR 58865118 58865223 . + . Parent=A1BGAS.aAug10 +19 AceView three_prime_UTR 58865735 58866090 . + . Parent=A1BGAS.aAug10 +19 AceView exon 58859153 58859210 . + . Parent=A1BGAS.aAug10 +19 AceView exon 58864687 58864840 . + . Parent=A1BGAS.aAug10 +19 AceView exon 58865080 58865223 . + . Parent=A1BGAS.aAug10 +19 AceView exon 58865735 58866090 . + . Parent=A1BGAS.aAug10 +19 AceView transcript 58859074 58860512 . + . ID=A1BGAS.eAug10-unspliced;Parent=A1BGAS +19 AceView exon 58859074 58860512 . + . Parent=A1BGAS.eAug10-unspliced +3 AceView gene 137842560 137851229 . - . ID=A4GNT;Name=A4GNT +3 AceView mRNA 137842560 137851229 . - . ID=A4GNT.aAug10;Parent=A4GNT +3 AceView five_prime_UTR 137850099 137850124 . - . Parent=A4GNT.aAug10 +3 AceView five_prime_UTR 137851054 137851229 . - . Parent=A4GNT.aAug10 +3 AceView CDS 137843106 137843720 . - 0 Parent=A4GNT.aAug10 +3 AceView CDS 137849691 137850098 . - 0 Parent=A4GNT.aAug10 +3 AceView three_prime_UTR 137842560 137843105 . - . Parent=A4GNT.aAug10 +3 AceView exon 137842560 137843720 . - . Parent=A4GNT.aAug10 +3 AceView exon 137849691 137850124 . - . Parent=A4GNT.aAug10 +3 AceView exon 137851054 137851229 . - . Parent=A4GNT.aAug10 +1 AceView gene 12776119 12788726 . + . ID=AADACL3;Name=AADACL3 +1 AceView mRNA 12776119 12788726 . + . ID=AADACL3.bAug10;Parent=AADACL3 +1 AceView five_prime_UTR 12776119 12776343 . + . Parent=AADACL3.bAug10 +1 AceView CDS 12776344 12776347 . + 0 Parent=AADACL3.bAug10 +1 AceView CDS 12780885 12780948 . + 2 Parent=AADACL3.bAug10 +1 AceView CDS 12785189 12785963 . + 1 Parent=AADACL3.bAug10 +1 AceView three_prime_UTR 12785964 12788726 . + . Parent=AADACL3.bAug10 +1 AceView exon 12776119 12776347 . + . Parent=AADACL3.bAug10 +1 AceView exon 12780885 12780948 . + . Parent=AADACL3.bAug10 +1 AceView exon 12785189 12788726 . + . Parent=AADACL3.bAug10 +1 AceView mRNA 12776119 12788726 . + . ID=AADACL3.aAug10;Parent=AADACL3 +1 AceView five_prime_UTR 12776119 12776347 . + . Parent=AADACL3.aAug10 +1 AceView five_prime_UTR 12779477 12779479 . + . Parent=AADACL3.aAug10 +1 AceView CDS 12779480 12779693 . + 0 Parent=AADACL3.aAug10 +1 AceView CDS 12780885 12780948 . + 2 Parent=AADACL3.aAug10 +1 AceView CDS 12785189 12785963 . + 1 Parent=AADACL3.aAug10 +1 AceView three_prime_UTR 12785964 12788726 . + . Parent=AADACL3.aAug10 +1 AceView exon 12776119 12776347 . + . Parent=AADACL3.aAug10 +1 AceView exon 12779477 12779693 . + . Parent=AADACL3.aAug10 +1 AceView exon 12780885 12780948 . + . Parent=AADACL3.aAug10 +1 AceView exon 12785189 12788726 . + . Parent=AADACL3.aAug10 +3 AceView gene 151515270 151546279 . + . ID=AADAC;Name=AADAC +3 AceView mRNA 151531830 151546276 . + . ID=AADAC.bAug10;Parent=AADAC +3 AceView five_prime_UTR 151531830 151531950 . + . Parent=AADAC.bAug10 +3 AceView CDS 151531951 151532088 . + 0 Parent=AADAC.bAug10 +3 AceView CDS 151535154 151535376 . + 0 Parent=AADAC.bAug10 +3 AceView CDS 151538171 151538240 . + 2 Parent=AADAC.bAug10 +3 AceView CDS 151542451 151542622 . + 1 Parent=AADAC.bAug10 +3 AceView CDS 151545364 151545960 . + 0 Parent=AADAC.bAug10 +3 AceView three_prime_UTR 151545961 151546276 . + . Parent=AADAC.bAug10 +3 AceView exon 151531830 151532088 . + . Parent=AADAC.bAug10 +3 AceView exon 151535154 151535376 . + . Parent=AADAC.bAug10 +3 AceView exon 151538171 151538240 . + . Parent=AADAC.bAug10 +3 AceView exon 151542451 151542622 . + . Parent=AADAC.bAug10 +3 AceView exon 151545364 151546276 . + . Parent=AADAC.bAug10 +3 AceView mRNA 151544253 151546279 . + . ID=AADAC.dAug10-unspliced;Parent=AADAC +3 AceView five_prime_UTR 151544253 151544696 . + . Parent=AADAC.dAug10-unspliced +3 AceView five_prime_UTR 151545122 151545327 . + . Parent=AADAC.dAug10-unspliced +3 AceView CDS 151545328 151545960 . + 0 Parent=AADAC.dAug10-unspliced +3 AceView three_prime_UTR 151545961 151546279 . + . Parent=AADAC.dAug10-unspliced +3 AceView exon 151544253 151544696 . + . Parent=AADAC.dAug10-unspliced +3 AceView exon 151545122 151546279 . + . Parent=AADAC.dAug10-unspliced +3 AceView mRNA 151526027 151545616 . + . ID=AADAC.cAug10;Parent=AADAC +3 AceView five_prime_UTR 151526027 151526028 . + . Parent=AADAC.cAug10 +3 AceView CDS 151531927 151532088 . + 0 Parent=AADAC.cAug10 +3 AceView CDS 151535154 151535376 . + 0 Parent=AADAC.cAug10 +3 AceView CDS 151538171 151538240 . + 2 Parent=AADAC.cAug10 +3 AceView CDS 151542451 151542622 . + 1 Parent=AADAC.cAug10 +3 AceView CDS 151545364 151545615 . + 0 Parent=AADAC.cAug10 +3 AceView three_prime_UTR 151545616 151545616 . + . Parent=AADAC.cAug10 +3 AceView exon 151526027 151526028 . + . Parent=AADAC.cAug10 +3 AceView exon 151531927 151532088 . + . Parent=AADAC.cAug10 +3 AceView exon 151535154 151535376 . + . Parent=AADAC.cAug10 +3 AceView exon 151538171 151538240 . + . Parent=AADAC.cAug10 +3 AceView exon 151542451 151542622 . + . Parent=AADAC.cAug10 +3 AceView exon 151545364 151545616 . + . Parent=AADAC.cAug10 +3 AceView mRNA 151515270 151542997 . + . ID=AADAC.eAug10;Parent=AADAC +3 AceView five_prime_UTR 151515270 151515335 . + . Parent=AADAC.eAug10 +3 AceView five_prime_UTR 151521494 151521713 . + . Parent=AADAC.eAug10 +3 AceView five_prime_UTR 151525932 151526028 . + . Parent=AADAC.eAug10 +3 AceView five_prime_UTR 151531927 151531950 . + . Parent=AADAC.eAug10 +3 AceView CDS 151531951 151532088 . + 0 Parent=AADAC.eAug10 +3 AceView CDS 151535154 151535376 . + 0 Parent=AADAC.eAug10 +3 AceView CDS 151538171 151538240 . + 2 Parent=AADAC.eAug10 +3 AceView CDS 151542451 151542634 . + 1 Parent=AADAC.eAug10 +3 AceView three_prime_UTR 151542635 151542997 . + . Parent=AADAC.eAug10 +3 AceView exon 151515270 151515335 . + . Parent=AADAC.eAug10 +3 AceView exon 151521494 151521713 . + . Parent=AADAC.eAug10 +3 AceView exon 151525932 151526028 . + . Parent=AADAC.eAug10 +3 AceView exon 151531927 151532088 . + . Parent=AADAC.eAug10 +3 AceView exon 151535154 151535376 . + . Parent=AADAC.eAug10 +3 AceView exon 151538171 151538240 . + . Parent=AADAC.eAug10 +3 AceView exon 151542451 151542997 . + . Parent=AADAC.eAug10 +3 AceView mRNA 151531801 151546276 . + . ID=AADAC.aAug10;Parent=AADAC +3 AceView five_prime_UTR 151531801 151531822 . + . Parent=AADAC.aAug10 +3 AceView five_prime_UTR 151531927 151531950 . + . Parent=AADAC.aAug10 +3 AceView CDS 151531951 151532088 . + 0 Parent=AADAC.aAug10 +3 AceView CDS 151535154 151535376 . + 0 Parent=AADAC.aAug10 +3 AceView CDS 151538171 151538240 . + 2 Parent=AADAC.aAug10 +3 AceView CDS 151542451 151542622 . + 1 Parent=AADAC.aAug10 +3 AceView CDS 151545364 151545960 . + 0 Parent=AADAC.aAug10 +3 AceView three_prime_UTR 151545961 151546276 . + . Parent=AADAC.aAug10 +3 AceView exon 151531801 151531822 . + . Parent=AADAC.aAug10 +3 AceView exon 151531927 151532088 . + . Parent=AADAC.aAug10 +3 AceView exon 151535154 151535376 . + . Parent=AADAC.aAug10 +3 AceView exon 151538171 151538240 . + . Parent=AADAC.aAug10 +3 AceView exon 151542451 151542622 . + . Parent=AADAC.aAug10 +3 AceView exon 151545364 151546276 . + . Parent=AADAC.aAug10 +10 AceView gene 52566307 52645436 . - . ID=A1CF;Name=A1CF +10 AceView mRNA 52566481 52645411 . - . ID=A1CF.eAug10;Parent=A1CF +10 AceView five_prime_UTR 52619701 52619745 . - . Parent=A1CF.eAug10 +10 AceView five_prime_UTR 52645341 52645411 . - . Parent=A1CF.eAug10 +10 AceView CDS 52566489 52566640 . - 2 Parent=A1CF.eAug10 +10 AceView CDS 52569654 52569802 . - 1 Parent=A1CF.eAug10 +10 AceView CDS 52570800 52570936 . - 0 Parent=A1CF.eAug10 +10 AceView CDS 52573617 52573798 . - 2 Parent=A1CF.eAug10 +10 AceView CDS 52575766 52576039 . - 0 Parent=A1CF.eAug10 +10 AceView CDS 52580312 52580409 . - 2 Parent=A1CF.eAug10 +10 AceView CDS 52587891 52588055 . - 2 Parent=A1CF.eAug10 +10 AceView CDS 52595834 52596072 . - 1 Parent=A1CF.eAug10 +10 AceView CDS 52601622 52601752 . - 0 Parent=A1CF.eAug10 +10 AceView CDS 52603748 52603882 . - 0 Parent=A1CF.eAug10 +10 AceView CDS 52619602 52619700 . - 0 Parent=A1CF.eAug10 +10 AceView three_prime_UTR 52566481 52566488 . - . Parent=A1CF.eAug10 +10 AceView exon 52566481 52566640 . - . Parent=A1CF.eAug10 +10 AceView exon 52569654 52569802 . - . Parent=A1CF.eAug10 +10 AceView exon 52570800 52570936 . - . Parent=A1CF.eAug10 +10 AceView exon 52573617 52573798 . - . Parent=A1CF.eAug10 +10 AceView exon 52575766 52576039 . - . Parent=A1CF.eAug10 +10 AceView exon 52580312 52580409 . - . Parent=A1CF.eAug10 +10 AceView exon 52587891 52588055 . - . Parent=A1CF.eAug10 +10 AceView exon 52595834 52596072 . - . Parent=A1CF.eAug10 +10 AceView exon 52601622 52601752 . - . Parent=A1CF.eAug10 +10 AceView exon 52603748 52603882 . - . Parent=A1CF.eAug10 +10 AceView exon 52619602 52619745 . - . Parent=A1CF.eAug10 +10 AceView exon 52645341 52645411 . - . Parent=A1CF.eAug10 +10 AceView mRNA 52566327 52645435 . - . ID=A1CF.cAug10;Parent=A1CF +10 AceView five_prime_UTR 52619701 52619745 . - . Parent=A1CF.cAug10 +10 AceView five_prime_UTR 52623793 52623840 . - . Parent=A1CF.cAug10 +10 AceView five_prime_UTR 52645341 52645435 . - . Parent=A1CF.cAug10 +10 AceView CDS 52566489 52566640 . - 2 Parent=A1CF.cAug10 +10 AceView CDS 52569654 52569802 . - 1 Parent=A1CF.cAug10 +10 AceView CDS 52570800 52570936 . - 0 Parent=A1CF.cAug10 +10 AceView CDS 52573617 52573822 . - 2 Parent=A1CF.cAug10 +10 AceView CDS 52575766 52576039 . - 0 Parent=A1CF.cAug10 +10 AceView CDS 52580312 52580409 . - 2 Parent=A1CF.cAug10 +10 AceView CDS 52587891 52588055 . - 2 Parent=A1CF.cAug10 +10 AceView CDS 52595834 52596072 . - 1 Parent=A1CF.cAug10 +10 AceView CDS 52601622 52601752 . - 0 Parent=A1CF.cAug10 +10 AceView CDS 52603748 52603882 . - 0 Parent=A1CF.cAug10 +10 AceView CDS 52619602 52619700 . - 0 Parent=A1CF.cAug10 +10 AceView three_prime_UTR 52566327 52566488 . - . Parent=A1CF.cAug10 +10 AceView exon 52566327 52566640 . - . Parent=A1CF.cAug10 +10 AceView exon 52569654 52569802 . - . Parent=A1CF.cAug10 +10 AceView exon 52570800 52570936 . - . Parent=A1CF.cAug10 +10 AceView exon 52573617 52573822 . - . Parent=A1CF.cAug10 +10 AceView exon 52575766 52576039 . - . Parent=A1CF.cAug10 +10 AceView exon 52580312 52580409 . - . Parent=A1CF.cAug10 +10 AceView exon 52587891 52588055 . - . Parent=A1CF.cAug10 +10 AceView exon 52595834 52596072 . - . Parent=A1CF.cAug10 +10 AceView exon 52601622 52601752 . - . Parent=A1CF.cAug10 +10 AceView exon 52603748 52603882 . - . Parent=A1CF.cAug10 +10 AceView exon 52619602 52619745 . - . Parent=A1CF.cAug10 +10 AceView exon 52623793 52623840 . - . Parent=A1CF.cAug10 +10 AceView exon 52645341 52645435 . - . Parent=A1CF.cAug10 +10 AceView mRNA 52587965 52645405 . - . ID=A1CF.jAug10;Parent=A1CF +10 AceView five_prime_UTR 52623835 52623840 . - . Parent=A1CF.jAug10 +10 AceView five_prime_UTR 52645341 52645405 . - . Parent=A1CF.jAug10 +10 AceView CDS 52587967 52588055 . - 2 Parent=A1CF.jAug10 +10 AceView CDS 52595834 52596072 . - 1 Parent=A1CF.jAug10 +10 AceView CDS 52601622 52601752 . - 0 Parent=A1CF.jAug10 +10 AceView CDS 52603748 52603882 . - 0 Parent=A1CF.jAug10 +10 AceView CDS 52623793 52623834 . - 0 Parent=A1CF.jAug10 +10 AceView three_prime_UTR 52587965 52587966 . - . Parent=A1CF.jAug10 +10 AceView exon 52587965 52588055 . - . Parent=A1CF.jAug10 +10 AceView exon 52595834 52596072 . - . Parent=A1CF.jAug10 +10 AceView exon 52601622 52601752 . - . Parent=A1CF.jAug10 +10 AceView exon 52603748 52603882 . - . Parent=A1CF.jAug10 +10 AceView exon 52623793 52623840 . - . Parent=A1CF.jAug10 +10 AceView exon 52645341 52645405 . - . Parent=A1CF.jAug10 +10 AceView mRNA 52570800 52588221 . - . ID=A1CF.hAug10;Parent=A1CF +10 AceView five_prime_UTR 52588179 52588221 . - . Parent=A1CF.hAug10 +10 AceView CDS 52570802 52570936 . - 0 Parent=A1CF.hAug10 +10 AceView CDS 52573617 52573822 . - 2 Parent=A1CF.hAug10 +10 AceView CDS 52575766 52576039 . - 0 Parent=A1CF.hAug10 +10 AceView CDS 52580312 52580409 . - 2 Parent=A1CF.hAug10 +10 AceView CDS 52587891 52588055 . - 2 Parent=A1CF.hAug10 +10 AceView CDS 52588148 52588178 . - 0 Parent=A1CF.hAug10 +10 AceView three_prime_UTR 52570800 52570801 . - . Parent=A1CF.hAug10 +10 AceView exon 52570800 52570936 . - . Parent=A1CF.hAug10 +10 AceView exon 52573617 52573822 . - . Parent=A1CF.hAug10 +10 AceView exon 52575766 52576039 . - . Parent=A1CF.hAug10 +10 AceView exon 52580312 52580409 . - . Parent=A1CF.hAug10 +10 AceView exon 52587891 52588055 . - . Parent=A1CF.hAug10 +10 AceView exon 52588148 52588221 . - . Parent=A1CF.hAug10 +10 AceView mRNA 52566420 52645388 . - . ID=A1CF.aAug10;Parent=A1CF +10 AceView five_prime_UTR 52610548 52610567 . - . Parent=A1CF.aAug10 +10 AceView five_prime_UTR 52619602 52619745 . - . Parent=A1CF.aAug10 +10 AceView five_prime_UTR 52622649 52622741 . - . Parent=A1CF.aAug10 +10 AceView five_prime_UTR 52623793 52623840 . - . Parent=A1CF.aAug10 +10 AceView five_prime_UTR 52645341 52645388 . - . Parent=A1CF.aAug10 +10 AceView CDS 52566489 52566640 . - 2 Parent=A1CF.aAug10 +10 AceView CDS 52569654 52569802 . - 1 Parent=A1CF.aAug10 +10 AceView CDS 52570800 52570936 . - 0 Parent=A1CF.aAug10 +10 AceView CDS 52573617 52573822 . - 2 Parent=A1CF.aAug10 +10 AceView CDS 52575766 52576039 . - 0 Parent=A1CF.aAug10 +10 AceView CDS 52580312 52580409 . - 2 Parent=A1CF.aAug10 +10 AceView CDS 52587891 52588055 . - 2 Parent=A1CF.aAug10 +10 AceView CDS 52595834 52596072 . - 1 Parent=A1CF.aAug10 +10 AceView CDS 52601622 52601752 . - 0 Parent=A1CF.aAug10 +10 AceView CDS 52603748 52603882 . - 0 Parent=A1CF.aAug10 +10 AceView CDS 52610425 52610547 . - 0 Parent=A1CF.aAug10 +10 AceView three_prime_UTR 52566420 52566488 . - . Parent=A1CF.aAug10 +10 AceView exon 52566420 52566640 . - . Parent=A1CF.aAug10 +10 AceView exon 52569654 52569802 . - . Parent=A1CF.aAug10 +10 AceView exon 52570800 52570936 . - . Parent=A1CF.aAug10 +10 AceView exon 52573617 52573822 . - . Parent=A1CF.aAug10 +10 AceView exon 52575766 52576039 . - . Parent=A1CF.aAug10 +10 AceView exon 52580312 52580409 . - . Parent=A1CF.aAug10 +10 AceView exon 52587891 52588055 . - . Parent=A1CF.aAug10 +10 AceView exon 52595834 52596072 . - . Parent=A1CF.aAug10 +10 AceView exon 52601622 52601752 . - . Parent=A1CF.aAug10 +10 AceView exon 52603748 52603882 . - . Parent=A1CF.aAug10 +10 AceView exon 52610425 52610567 . - . Parent=A1CF.aAug10 +10 AceView exon 52619602 52619745 . - . Parent=A1CF.aAug10 +10 AceView exon 52622649 52622741 . - . Parent=A1CF.aAug10 +10 AceView exon 52623793 52623840 . - . Parent=A1CF.aAug10 +10 AceView exon 52645341 52645388 . - . Parent=A1CF.aAug10 +10 AceView mRNA 52566327 52645435 . - . ID=A1CF.gAug10;Parent=A1CF +10 AceView five_prime_UTR 52619701 52619745 . - . Parent=A1CF.gAug10 +10 AceView five_prime_UTR 52623793 52623840 . - . Parent=A1CF.gAug10 +10 AceView five_prime_UTR 52645341 52645435 . - . Parent=A1CF.gAug10 +10 AceView CDS 52566489 52566640 . - 2 Parent=A1CF.gAug10 +10 AceView CDS 52569654 52569802 . - 1 Parent=A1CF.gAug10 +10 AceView CDS 52570800 52570936 . - 0 Parent=A1CF.gAug10 +10 AceView CDS 52573617 52573798 . - 2 Parent=A1CF.gAug10 +10 AceView CDS 52575766 52576039 . - 0 Parent=A1CF.gAug10 +10 AceView CDS 52580312 52580409 . - 2 Parent=A1CF.gAug10 +10 AceView CDS 52587891 52588055 . - 2 Parent=A1CF.gAug10 +10 AceView CDS 52595834 52596072 . - 1 Parent=A1CF.gAug10 +10 AceView CDS 52601622 52601752 . - 0 Parent=A1CF.gAug10 +10 AceView CDS 52603748 52603882 . - 0 Parent=A1CF.gAug10 +10 AceView CDS 52619602 52619700 . - 0 Parent=A1CF.gAug10 +10 AceView three_prime_UTR 52566327 52566488 . - . Parent=A1CF.gAug10 +10 AceView exon 52566327 52566640 . - . Parent=A1CF.gAug10 +10 AceView exon 52569654 52569802 . - . Parent=A1CF.gAug10 +10 AceView exon 52570800 52570936 . - . Parent=A1CF.gAug10 +10 AceView exon 52573617 52573798 . - . Parent=A1CF.gAug10 +10 AceView exon 52575766 52576039 . - . Parent=A1CF.gAug10 +10 AceView exon 52580312 52580409 . - . Parent=A1CF.gAug10 +10 AceView exon 52587891 52588055 . - . Parent=A1CF.gAug10 +10 AceView exon 52595834 52596072 . - . Parent=A1CF.gAug10 +10 AceView exon 52601622 52601752 . - . Parent=A1CF.gAug10 +10 AceView exon 52603748 52603882 . - . Parent=A1CF.gAug10 +10 AceView exon 52619602 52619745 . - . Parent=A1CF.gAug10 +10 AceView exon 52623793 52623840 . - . Parent=A1CF.gAug10 +10 AceView exon 52645341 52645435 . - . Parent=A1CF.gAug10 +10 AceView mRNA 52566327 52645436 . - . ID=A1CF.dAug10;Parent=A1CF +10 AceView five_prime_UTR 52610548 52610567 . - . Parent=A1CF.dAug10 +10 AceView five_prime_UTR 52619602 52619745 . - . Parent=A1CF.dAug10 +10 AceView five_prime_UTR 52645341 52645436 . - . Parent=A1CF.dAug10 +10 AceView CDS 52566489 52566640 . - 2 Parent=A1CF.dAug10 +10 AceView CDS 52569654 52569802 . - 1 Parent=A1CF.dAug10 +10 AceView CDS 52570800 52570936 . - 0 Parent=A1CF.dAug10 +10 AceView CDS 52573617 52573798 . - 2 Parent=A1CF.dAug10 +10 AceView CDS 52575766 52576039 . - 0 Parent=A1CF.dAug10 +10 AceView CDS 52580312 52580409 . - 2 Parent=A1CF.dAug10 +10 AceView CDS 52587891 52588055 . - 2 Parent=A1CF.dAug10 +10 AceView CDS 52595834 52596072 . - 1 Parent=A1CF.dAug10 +10 AceView CDS 52601622 52601752 . - 0 Parent=A1CF.dAug10 +10 AceView CDS 52603748 52603882 . - 0 Parent=A1CF.dAug10 +10 AceView CDS 52610425 52610547 . - 0 Parent=A1CF.dAug10 +10 AceView three_prime_UTR 52566327 52566488 . - . Parent=A1CF.dAug10 +10 AceView exon 52566327 52566640 . - . Parent=A1CF.dAug10 +10 AceView exon 52569654 52569802 . - . Parent=A1CF.dAug10 +10 AceView exon 52570800 52570936 . - . Parent=A1CF.dAug10 +10 AceView exon 52573617 52573798 . - . Parent=A1CF.dAug10 +10 AceView exon 52575766 52576039 . - . Parent=A1CF.dAug10 +10 AceView exon 52580312 52580409 . - . Parent=A1CF.dAug10 +10 AceView exon 52587891 52588055 . - . Parent=A1CF.dAug10 +10 AceView exon 52595834 52596072 . - . Parent=A1CF.dAug10 +10 AceView exon 52601622 52601752 . - . Parent=A1CF.dAug10 +10 AceView exon 52603748 52603882 . - . Parent=A1CF.dAug10 +10 AceView exon 52610425 52610567 . - . Parent=A1CF.dAug10 +10 AceView exon 52619602 52619745 . - . Parent=A1CF.dAug10 +10 AceView exon 52645341 52645436 . - . Parent=A1CF.dAug10 +10 AceView mRNA 52601582 52645434 . - . ID=A1CF.kAug10;Parent=A1CF +10 AceView five_prime_UTR 52619701 52619745 . - . Parent=A1CF.kAug10 +10 AceView five_prime_UTR 52645341 52645434 . - . Parent=A1CF.kAug10 +10 AceView CDS 52601618 52601752 . - 0 Parent=A1CF.kAug10 +10 AceView CDS 52603748 52603882 . - 0 Parent=A1CF.kAug10 +10 AceView CDS 52619602 52619700 . - 0 Parent=A1CF.kAug10 +10 AceView three_prime_UTR 52601582 52601617 . - . Parent=A1CF.kAug10 +10 AceView exon 52601582 52601752 . - . Parent=A1CF.kAug10 +10 AceView exon 52603748 52603882 . - . Parent=A1CF.kAug10 +10 AceView exon 52619602 52619745 . - . Parent=A1CF.kAug10 +10 AceView exon 52645341 52645434 . - . Parent=A1CF.kAug10 +10 AceView mRNA 52566307 52645387 . - . ID=A1CF.fAug10;Parent=A1CF +10 AceView five_prime_UTR 52619701 52619745 . - . Parent=A1CF.fAug10 +10 AceView five_prime_UTR 52622649 52622741 . - . Parent=A1CF.fAug10 +10 AceView five_prime_UTR 52623793 52623840 . - . Parent=A1CF.fAug10 +10 AceView five_prime_UTR 52645341 52645387 . - . Parent=A1CF.fAug10 +10 AceView CDS 52566489 52566640 . - 2 Parent=A1CF.fAug10 +10 AceView CDS 52569654 52569802 . - 1 Parent=A1CF.fAug10 +10 AceView CDS 52570800 52570936 . - 0 Parent=A1CF.fAug10 +10 AceView CDS 52573617 52573798 . - 2 Parent=A1CF.fAug10 +10 AceView CDS 52575766 52576039 . - 0 Parent=A1CF.fAug10 +10 AceView CDS 52580312 52580409 . - 2 Parent=A1CF.fAug10 +10 AceView CDS 52587891 52588055 . - 2 Parent=A1CF.fAug10 +10 AceView CDS 52595834 52596072 . - 1 Parent=A1CF.fAug10 +10 AceView CDS 52601622 52601752 . - 0 Parent=A1CF.fAug10 +10 AceView CDS 52603748 52603882 . - 0 Parent=A1CF.fAug10 +10 AceView CDS 52619602 52619700 . - 0 Parent=A1CF.fAug10 +10 AceView three_prime_UTR 52566307 52566488 . - . Parent=A1CF.fAug10 +10 AceView exon 52566307 52566640 . - . Parent=A1CF.fAug10 +10 AceView exon 52569654 52569802 . - . Parent=A1CF.fAug10 +10 AceView exon 52570800 52570936 . - . Parent=A1CF.fAug10 +10 AceView exon 52573617 52573798 . - . Parent=A1CF.fAug10 +10 AceView exon 52575766 52576039 . - . Parent=A1CF.fAug10 +10 AceView exon 52580312 52580409 . - . Parent=A1CF.fAug10 +10 AceView exon 52587891 52588055 . - . Parent=A1CF.fAug10 +10 AceView exon 52595834 52596072 . - . Parent=A1CF.fAug10 +10 AceView exon 52601622 52601752 . - . Parent=A1CF.fAug10 +10 AceView exon 52603748 52603882 . - . Parent=A1CF.fAug10 +10 AceView exon 52619602 52619745 . - . Parent=A1CF.fAug10 +10 AceView exon 52622649 52622741 . - . Parent=A1CF.fAug10 +10 AceView exon 52623793 52623840 . - . Parent=A1CF.fAug10 +10 AceView exon 52645341 52645387 . - . Parent=A1CF.fAug10 +10 AceView mRNA 52573617 52588060 . - . ID=A1CF.iAug10;Parent=A1CF +10 AceView five_prime_UTR 52588060 52588060 . - . Parent=A1CF.iAug10 +10 AceView CDS 52573617 52573822 . - 2 Parent=A1CF.iAug10 +10 AceView CDS 52575766 52576039 . - 0 Parent=A1CF.iAug10 +10 AceView CDS 52580312 52580409 . - 2 Parent=A1CF.iAug10 +10 AceView CDS 52587891 52588059 . - 0 Parent=A1CF.iAug10 +10 AceView exon 52573617 52573822 . - . Parent=A1CF.iAug10 +10 AceView exon 52575766 52576039 . - . Parent=A1CF.iAug10 +10 AceView exon 52580312 52580409 . - . Parent=A1CF.iAug10 +10 AceView exon 52587891 52588060 . - . Parent=A1CF.iAug10 +10 AceView mRNA 52566400 52623833 . - . ID=A1CF.bAug10;Parent=A1CF +10 AceView five_prime_UTR 52610548 52610567 . - . Parent=A1CF.bAug10 +10 AceView five_prime_UTR 52619602 52619745 . - . Parent=A1CF.bAug10 +10 AceView five_prime_UTR 52623793 52623833 . - . Parent=A1CF.bAug10 +10 AceView CDS 52566489 52566640 . - 2 Parent=A1CF.bAug10 +10 AceView CDS 52569654 52569802 . - 1 Parent=A1CF.bAug10 +10 AceView CDS 52570800 52570936 . - 0 Parent=A1CF.bAug10 +10 AceView CDS 52573617 52573798 . - 2 Parent=A1CF.bAug10 +10 AceView CDS 52575766 52576039 . - 0 Parent=A1CF.bAug10 +10 AceView CDS 52580312 52580409 . - 2 Parent=A1CF.bAug10 +10 AceView CDS 52587891 52588055 . - 2 Parent=A1CF.bAug10 +10 AceView CDS 52595834 52596072 . - 1 Parent=A1CF.bAug10 +10 AceView CDS 52601622 52601752 . - 0 Parent=A1CF.bAug10 +10 AceView CDS 52603748 52603882 . - 0 Parent=A1CF.bAug10 +10 AceView CDS 52610425 52610547 . - 0 Parent=A1CF.bAug10 +10 AceView three_prime_UTR 52566400 52566488 . - . Parent=A1CF.bAug10 +10 AceView exon 52566400 52566640 . - . Parent=A1CF.bAug10 +10 AceView exon 52569654 52569802 . - . Parent=A1CF.bAug10 +10 AceView exon 52570800 52570936 . - . Parent=A1CF.bAug10 +10 AceView exon 52573617 52573798 . - . Parent=A1CF.bAug10 +10 AceView exon 52575766 52576039 . - . Parent=A1CF.bAug10 +10 AceView exon 52580312 52580409 . - . Parent=A1CF.bAug10 +10 AceView exon 52587891 52588055 . - . Parent=A1CF.bAug10 +10 AceView exon 52595834 52596072 . - . Parent=A1CF.bAug10 +10 AceView exon 52601622 52601752 . - . Parent=A1CF.bAug10 +10 AceView exon 52603748 52603882 . - . Parent=A1CF.bAug10 +10 AceView exon 52610425 52610567 . - . Parent=A1CF.bAug10 +10 AceView exon 52619602 52619745 . - . Parent=A1CF.bAug10 +10 AceView exon 52623793 52623833 . - . Parent=A1CF.bAug10 +12 AceView gene 9381129 9412153 . - . ID=A2MP1;Name=A2MP1 +12 AceView mRNA 9383639 9386803 . - . ID=A2MP1.aAug10;Parent=A2MP1 +12 AceView five_prime_UTR 9386225 9386288 . - . Parent=A2MP1.aAug10 +12 AceView five_prime_UTR 9386731 9386803 . - . Parent=A2MP1.aAug10 +12 AceView CDS 9384277 9384292 . - 1 Parent=A2MP1.aAug10 +12 AceView CDS 9384651 9384781 . - 0 Parent=A2MP1.aAug10 +12 AceView CDS 9384958 9385176 . - 0 Parent=A2MP1.aAug10 +12 AceView CDS 9385982 9386224 . - 0 Parent=A2MP1.aAug10 +12 AceView three_prime_UTR 9383639 9383674 . - . Parent=A2MP1.aAug10 +12 AceView three_prime_UTR 9384202 9384276 . - . Parent=A2MP1.aAug10 +12 AceView exon 9383639 9383674 . - . Parent=A2MP1.aAug10 +12 AceView exon 9384202 9384292 . - . Parent=A2MP1.aAug10 +12 AceView exon 9384651 9384781 . - . Parent=A2MP1.aAug10 +12 AceView exon 9384958 9385176 . - . Parent=A2MP1.aAug10 +12 AceView exon 9385982 9386288 . - . Parent=A2MP1.aAug10 +12 AceView exon 9386731 9386803 . - . Parent=A2MP1.aAug10 +12 AceView transcript 9381129 9412153 . - . ID=A2MP1.bAug10;Parent=A2MP1 +12 AceView exon 9381129 9381294 . - . Parent=A2MP1.bAug10 +12 AceView exon 9381968 9382009 . - . Parent=A2MP1.bAug10 +12 AceView exon 9382849 9382951 . - . Parent=A2MP1.bAug10 +12 AceView exon 9383606 9383674 . - . Parent=A2MP1.bAug10 +12 AceView exon 9384202 9384292 . - . Parent=A2MP1.bAug10 +12 AceView exon 9384651 9384709 . - . Parent=A2MP1.bAug10 +12 AceView exon 9400252 9400308 . - . Parent=A2MP1.bAug10 +12 AceView exon 9406201 9406350 . - . Parent=A2MP1.bAug10 +12 AceView exon 9409240 9409382 . - . Parent=A2MP1.bAug10 +12 AceView exon 9411964 9412153 . - . Parent=A2MP1.bAug10 +13 AceView gene 101182342 101241782 . - . ID=A2LD1;Name=A2LD1 +13 AceView transcript 101184728 101241782 . - . ID=A2LD1.eAug10;Parent=A2LD1 +13 AceView exon 101184728 101184855 . - . Parent=A2LD1.eAug10 +13 AceView exon 101236079 101236251 . - . Parent=A2LD1.eAug10 +13 AceView exon 101241565 101241782 . - . Parent=A2LD1.eAug10 +13 AceView mRNA 101184284 101186437 . - . ID=A2LD1.dAug10;Parent=A2LD1 +13 AceView five_prime_UTR 101184846 101184855 . - . Parent=A2LD1.dAug10 +13 AceView five_prime_UTR 101185817 101186437 . - . Parent=A2LD1.dAug10 +13 AceView CDS 101184384 101184845 . - 0 Parent=A2LD1.dAug10 +13 AceView three_prime_UTR 101184284 101184383 . - . Parent=A2LD1.dAug10 +13 AceView exon 101184284 101184855 . - . Parent=A2LD1.dAug10 +13 AceView exon 101185817 101186437 . - . Parent=A2LD1.dAug10 +13 AceView mRNA 101184742 101185923 . - . ID=A2LD1.aAug10;Parent=A2LD1 +13 AceView CDS 101184742 101184855 . - 0 Parent=A2LD1.aAug10 +13 AceView CDS 101185541 101185622 . - 1 Parent=A2LD1.aAug10 +13 AceView CDS 101185817 101185923 . - 0 Parent=A2LD1.aAug10 +13 AceView exon 101184742 101184855 . - . Parent=A2LD1.aAug10 +13 AceView exon 101185541 101185622 . - . Parent=A2LD1.aAug10 +13 AceView exon 101185817 101185923 . - . Parent=A2LD1.aAug10 +13 AceView transcript 101182342 101241040 . - . ID=A2LD1.bAug10;Parent=A2LD1 +13 AceView exon 101182342 101184855 . - . Parent=A2LD1.bAug10 +13 AceView exon 101236079 101236251 . - . Parent=A2LD1.bAug10 +13 AceView exon 101240995 101241040 . - . Parent=A2LD1.bAug10 +13 AceView transcript 101184765 101185907 . - . ID=A2LD1.fAug10;Parent=A2LD1 +13 AceView exon 101184765 101184855 . - . Parent=A2LD1.fAug10 +13 AceView exon 101185541 101185907 . - . Parent=A2LD1.fAug10 +13 AceView transcript 101183811 101236251 . - . ID=A2LD1.cAug10;Parent=A2LD1 +13 AceView exon 101183811 101184855 . - . Parent=A2LD1.cAug10 +13 AceView exon 101185817 101186028 . - . Parent=A2LD1.cAug10 +13 AceView exon 101236079 101236251 . - . Parent=A2LD1.cAug10 +2 AceView gene 69685127 69901482 . - . ID=AAK1;Name=AAK1 +2 AceView mRNA 69870218 69901482 . - . ID=AAK1.iAug10;Parent=AAK1 +2 AceView CDS 69870351 69870406 . - 2 Parent=AAK1.iAug10 +2 AceView CDS 69901155 69901482 . - 0 Parent=AAK1.iAug10 +2 AceView three_prime_UTR 69870218 69870350 . - . Parent=AAK1.iAug10 +2 AceView exon 69870218 69870406 . - . Parent=AAK1.iAug10 +2 AceView exon 69901155 69901482 . - . Parent=AAK1.iAug10 +2 AceView mRNA 69870238 69871218 . - . ID=AAK1.fAug10-unspliced;Parent=AAK1 +2 AceView CDS 69870451 69871218 . - 0 Parent=AAK1.fAug10-unspliced +2 AceView three_prime_UTR 69870238 69870450 . - . Parent=AAK1.fAug10-unspliced +2 AceView exon 69870238 69871218 . - . Parent=AAK1.fAug10-unspliced +2 AceView mRNA 69870183 69871084 . - . ID=AAK1.lAug10;Parent=AAK1 +2 AceView five_prime_UTR 69871084 69871084 . - . Parent=AAK1.lAug10 +2 AceView CDS 69870334 69870406 . - 1 Parent=AAK1.lAug10 +2 AceView CDS 69870875 69871083 . - 0 Parent=AAK1.lAug10 +2 AceView three_prime_UTR 69870183 69870333 . - . Parent=AAK1.lAug10 +2 AceView exon 69870183 69870406 . - . Parent=AAK1.lAug10 +2 AceView exon 69870875 69871084 . - . Parent=AAK1.lAug10 +2 AceView mRNA 69685127 69693664 . - . ID=AAK1.eAug10;Parent=AAK1 +2 AceView five_prime_UTR 69693664 69693664 . - . Parent=AAK1.eAug10 +2 AceView CDS 69692557 69693663 . - 0 Parent=AAK1.eAug10 +2 AceView three_prime_UTR 69685127 69688837 . - . Parent=AAK1.eAug10 +2 AceView three_prime_UTR 69692432 69692556 . - . Parent=AAK1.eAug10 +2 AceView exon 69685127 69688837 . - . Parent=AAK1.eAug10 +2 AceView exon 69692432 69693664 . - . Parent=AAK1.eAug10 +2 AceView mRNA 69771143 69870780 . - . ID=AAK1.hAug10;Parent=AAK1 +2 AceView five_prime_UTR 69870173 69870406 . - . Parent=AAK1.hAug10 +2 AceView five_prime_UTR 69870707 69870780 . - . Parent=AAK1.hAug10 +2 AceView CDS 69771527 69771676 . - 0 Parent=AAK1.hAug10 +2 AceView CDS 69783992 69784110 . - 2 Parent=AAK1.hAug10 +2 AceView CDS 69870010 69870172 . - 0 Parent=AAK1.hAug10 +2 AceView three_prime_UTR 69771143 69771526 . - . Parent=AAK1.hAug10 +2 AceView exon 69771143 69771676 . - . Parent=AAK1.hAug10 +2 AceView exon 69783992 69784110 . - . Parent=AAK1.hAug10 +2 AceView exon 69870010 69870406 . - . Parent=AAK1.hAug10 +2 AceView exon 69870707 69870780 . - . Parent=AAK1.hAug10 +2 AceView mRNA 69709670 69871092 . - . ID=AAK1.bAug10;Parent=AAK1 +2 AceView five_prime_UTR 69870173 69870406 . - . Parent=AAK1.bAug10 +2 AceView five_prime_UTR 69870924 69871092 . - . Parent=AAK1.bAug10 +2 AceView CDS 69709718 69709944 . - 2 Parent=AAK1.bAug10 +2 AceView CDS 69723117 69723212 . - 2 Parent=AAK1.bAug10 +2 AceView CDS 69732701 69732805 . - 2 Parent=AAK1.bAug10 +2 AceView CDS 69734553 69734710 . - 1 Parent=AAK1.bAug10 +2 AceView CDS 69736363 69736595 . - 0 Parent=AAK1.bAug10 +2 AceView CDS 69741603 69741881 . - 0 Parent=AAK1.bAug10 +2 AceView CDS 69746086 69746372 . - 2 Parent=AAK1.bAug10 +2 AceView CDS 69747966 69748120 . - 1 Parent=AAK1.bAug10 +2 AceView CDS 69752165 69752244 . - 0 Parent=AAK1.bAug10 +2 AceView CDS 69754348 69754451 . - 2 Parent=AAK1.bAug10 +2 AceView CDS 69757140 69757272 . - 0 Parent=AAK1.bAug10 +2 AceView CDS 69757757 69757838 . - 1 Parent=AAK1.bAug10 +2 AceView CDS 69759173 69759294 . - 0 Parent=AAK1.bAug10 +2 AceView CDS 69769655 69769797 . - 2 Parent=AAK1.bAug10 +2 AceView CDS 69771568 69771676 . - 0 Parent=AAK1.bAug10 +2 AceView CDS 69783992 69784110 . - 2 Parent=AAK1.bAug10 +2 AceView CDS 69870010 69870172 . - 0 Parent=AAK1.bAug10 +2 AceView three_prime_UTR 69709670 69709717 . - . Parent=AAK1.bAug10 +2 AceView exon 69709670 69709944 . - . Parent=AAK1.bAug10 +2 AceView exon 69723117 69723212 . - . Parent=AAK1.bAug10 +2 AceView exon 69732701 69732805 . - . Parent=AAK1.bAug10 +2 AceView exon 69734553 69734710 . - . Parent=AAK1.bAug10 +2 AceView exon 69736363 69736595 . - . Parent=AAK1.bAug10 +2 AceView exon 69741603 69741881 . - . Parent=AAK1.bAug10 +2 AceView exon 69746086 69746372 . - . Parent=AAK1.bAug10 +2 AceView exon 69747966 69748120 . - . Parent=AAK1.bAug10 +2 AceView exon 69752165 69752244 . - . Parent=AAK1.bAug10 +2 AceView exon 69754348 69754451 . - . Parent=AAK1.bAug10 +2 AceView exon 69757140 69757272 . - . Parent=AAK1.bAug10 +2 AceView exon 69757757 69757838 . - . Parent=AAK1.bAug10 +2 AceView exon 69759173 69759294 . - . Parent=AAK1.bAug10 +2 AceView exon 69769655 69769797 . - . Parent=AAK1.bAug10 +2 AceView exon 69771568 69771676 . - . Parent=AAK1.bAug10 +2 AceView exon 69783992 69784110 . - . Parent=AAK1.bAug10 +2 AceView exon 69870010 69870406 . - . Parent=AAK1.bAug10 +2 AceView exon 69870924 69871092 . - . Parent=AAK1.bAug10 +2 AceView transcript 69722212 69735420 . - . ID=AAK1.nAug10;Parent=AAK1 +2 AceView exon 69722212 69723212 . - . Parent=AAK1.nAug10 +2 AceView exon 69732701 69732805 . - . Parent=AAK1.nAug10 +2 AceView exon 69734553 69734710 . - . Parent=AAK1.nAug10 +2 AceView exon 69735378 69735420 . - . Parent=AAK1.nAug10 +2 AceView mRNA 69685127 69871060 . - . ID=AAK1.aAug10;Parent=AAK1 +2 AceView five_prime_UTR 69870173 69870406 . - . Parent=AAK1.aAug10 +2 AceView five_prime_UTR 69870707 69871060 . - . Parent=AAK1.aAug10 +2 AceView CDS 69703001 69703095 . - 2 Parent=AAK1.aAug10 +2 AceView CDS 69704012 69704122 . - 2 Parent=AAK1.aAug10 +2 AceView CDS 69706083 69706193 . - 2 Parent=AAK1.aAug10 +2 AceView CDS 69707992 69708093 . - 2 Parent=AAK1.aAug10 +2 AceView CDS 69709843 69709944 . - 2 Parent=AAK1.aAug10 +2 AceView CDS 69723117 69723212 . - 2 Parent=AAK1.aAug10 +2 AceView CDS 69732701 69732805 . - 2 Parent=AAK1.aAug10 +2 AceView CDS 69734553 69734710 . - 1 Parent=AAK1.aAug10 +2 AceView CDS 69736363 69736592 . - 0 Parent=AAK1.aAug10 +2 AceView CDS 69741603 69741881 . - 0 Parent=AAK1.aAug10 +2 AceView CDS 69746086 69746372 . - 2 Parent=AAK1.aAug10 +2 AceView CDS 69747966 69748120 . - 1 Parent=AAK1.aAug10 +2 AceView CDS 69752165 69752244 . - 0 Parent=AAK1.aAug10 +2 AceView CDS 69754348 69754451 . - 2 Parent=AAK1.aAug10 +2 AceView CDS 69757140 69757272 . - 0 Parent=AAK1.aAug10 +2 AceView CDS 69757757 69757838 . - 1 Parent=AAK1.aAug10 +2 AceView CDS 69759173 69759294 . - 0 Parent=AAK1.aAug10 +2 AceView CDS 69769655 69769797 . - 2 Parent=AAK1.aAug10 +2 AceView CDS 69771568 69771676 . - 0 Parent=AAK1.aAug10 +2 AceView CDS 69783992 69784110 . - 2 Parent=AAK1.aAug10 +2 AceView CDS 69870010 69870172 . - 0 Parent=AAK1.aAug10 +2 AceView three_prime_UTR 69685127 69703000 . - . Parent=AAK1.aAug10 +2 AceView exon 69685127 69703095 . - . Parent=AAK1.aAug10 +2 AceView exon 69704012 69704122 . - . Parent=AAK1.aAug10 +2 AceView exon 69706083 69706193 . - . Parent=AAK1.aAug10 +2 AceView exon 69707992 69708093 . - . Parent=AAK1.aAug10 +2 AceView exon 69709843 69709944 . - . Parent=AAK1.aAug10 +2 AceView exon 69723117 69723212 . - . Parent=AAK1.aAug10 +2 AceView exon 69732701 69732805 . - . Parent=AAK1.aAug10 +2 AceView exon 69734553 69734710 . - . Parent=AAK1.aAug10 +2 AceView exon 69736363 69736592 . - . Parent=AAK1.aAug10 +2 AceView exon 69741603 69741881 . - . Parent=AAK1.aAug10 +2 AceView exon 69746086 69746372 . - . Parent=AAK1.aAug10 +2 AceView exon 69747966 69748120 . - . Parent=AAK1.aAug10 +2 AceView exon 69752165 69752244 . - . Parent=AAK1.aAug10 +2 AceView exon 69754348 69754451 . - . Parent=AAK1.aAug10 +2 AceView exon 69757140 69757272 . - . Parent=AAK1.aAug10 +2 AceView exon 69757757 69757838 . - . Parent=AAK1.aAug10 +2 AceView exon 69759173 69759294 . - . Parent=AAK1.aAug10 +2 AceView exon 69769655 69769797 . - . Parent=AAK1.aAug10 +2 AceView exon 69771568 69771676 . - . Parent=AAK1.aAug10 +2 AceView exon 69783992 69784110 . - . Parent=AAK1.aAug10 +2 AceView exon 69870010 69870406 . - . Parent=AAK1.aAug10 +2 AceView exon 69870707 69871060 . - . Parent=AAK1.aAug10 +2 AceView mRNA 69702852 69708174 . - . ID=AAK1.jAug10;Parent=AAK1 +2 AceView five_prime_UTR 69708056 69708174 . - . Parent=AAK1.jAug10 +2 AceView CDS 69703001 69703095 . - 2 Parent=AAK1.jAug10 +2 AceView CDS 69704012 69704122 . - 2 Parent=AAK1.jAug10 +2 AceView CDS 69706083 69706193 . - 2 Parent=AAK1.jAug10 +2 AceView CDS 69707992 69708055 . - 0 Parent=AAK1.jAug10 +2 AceView three_prime_UTR 69702852 69703000 . - . Parent=AAK1.jAug10 +2 AceView exon 69702852 69703095 . - . Parent=AAK1.jAug10 +2 AceView exon 69704012 69704122 . - . Parent=AAK1.jAug10 +2 AceView exon 69706083 69706193 . - . Parent=AAK1.jAug10 +2 AceView exon 69707992 69708174 . - . Parent=AAK1.jAug10 +2 AceView mRNA 69708188 69870849 . - . ID=AAK1.cAug10;Parent=AAK1 +2 AceView five_prime_UTR 69870173 69870406 . - . Parent=AAK1.cAug10 +2 AceView five_prime_UTR 69870707 69870849 . - . Parent=AAK1.cAug10 +2 AceView CDS 69709718 69709944 . - 2 Parent=AAK1.cAug10 +2 AceView CDS 69723117 69723212 . - 2 Parent=AAK1.cAug10 +2 AceView CDS 69732701 69732805 . - 2 Parent=AAK1.cAug10 +2 AceView CDS 69734553 69734710 . - 1 Parent=AAK1.cAug10 +2 AceView CDS 69736363 69736592 . - 0 Parent=AAK1.cAug10 +2 AceView CDS 69741603 69741881 . - 0 Parent=AAK1.cAug10 +2 AceView CDS 69746086 69746372 . - 2 Parent=AAK1.cAug10 +2 AceView CDS 69747966 69748120 . - 1 Parent=AAK1.cAug10 +2 AceView CDS 69752165 69752244 . - 0 Parent=AAK1.cAug10 +2 AceView CDS 69754348 69754451 . - 2 Parent=AAK1.cAug10 +2 AceView CDS 69757140 69757272 . - 0 Parent=AAK1.cAug10 +2 AceView CDS 69757757 69757838 . - 1 Parent=AAK1.cAug10 +2 AceView CDS 69759173 69759294 . - 0 Parent=AAK1.cAug10 +2 AceView CDS 69769655 69769797 . - 2 Parent=AAK1.cAug10 +2 AceView CDS 69771568 69771676 . - 0 Parent=AAK1.cAug10 +2 AceView CDS 69783992 69784110 . - 2 Parent=AAK1.cAug10 +2 AceView CDS 69870010 69870172 . - 0 Parent=AAK1.cAug10 +2 AceView three_prime_UTR 69708188 69709717 . - . Parent=AAK1.cAug10 +2 AceView exon 69708188 69709944 . - . Parent=AAK1.cAug10 +2 AceView exon 69723117 69723212 . - . Parent=AAK1.cAug10 +2 AceView exon 69732701 69732805 . - . Parent=AAK1.cAug10 +2 AceView exon 69734553 69734710 . - . Parent=AAK1.cAug10 +2 AceView exon 69736363 69736592 . - . Parent=AAK1.cAug10 +2 AceView exon 69741603 69741881 . - . Parent=AAK1.cAug10 +2 AceView exon 69746086 69746372 . - . Parent=AAK1.cAug10 +2 AceView exon 69747966 69748120 . - . Parent=AAK1.cAug10 +2 AceView exon 69752165 69752244 . - . Parent=AAK1.cAug10 +2 AceView exon 69754348 69754451 . - . Parent=AAK1.cAug10 +2 AceView exon 69757140 69757272 . - . Parent=AAK1.cAug10 +2 AceView exon 69757757 69757838 . - . Parent=AAK1.cAug10 +2 AceView exon 69759173 69759294 . - . Parent=AAK1.cAug10 +2 AceView exon 69769655 69769797 . - . Parent=AAK1.cAug10 +2 AceView exon 69771568 69771676 . - . Parent=AAK1.cAug10 +2 AceView exon 69783992 69784110 . - . Parent=AAK1.cAug10 +2 AceView exon 69870010 69870406 . - . Parent=AAK1.cAug10 +2 AceView exon 69870707 69870849 . - . Parent=AAK1.cAug10 +2 AceView mRNA 69688532 69870785 . - . ID=AAK1.dAug10;Parent=AAK1 +2 AceView five_prime_UTR 69870173 69870406 . - . Parent=AAK1.dAug10 +2 AceView five_prime_UTR 69870707 69870785 . - . Parent=AAK1.dAug10 +2 AceView CDS 69688799 69688843 . - 0 Parent=AAK1.dAug10 +2 AceView CDS 69736389 69736592 . - 0 Parent=AAK1.dAug10 +2 AceView CDS 69741603 69741881 . - 0 Parent=AAK1.dAug10 +2 AceView CDS 69746086 69746372 . - 2 Parent=AAK1.dAug10 +2 AceView CDS 69747966 69748120 . - 1 Parent=AAK1.dAug10 +2 AceView CDS 69752165 69752244 . - 0 Parent=AAK1.dAug10 +2 AceView CDS 69754348 69754451 . - 2 Parent=AAK1.dAug10 +2 AceView CDS 69757140 69757272 . - 0 Parent=AAK1.dAug10 +2 AceView CDS 69757757 69757838 . - 1 Parent=AAK1.dAug10 +2 AceView CDS 69759173 69759294 . - 0 Parent=AAK1.dAug10 +2 AceView CDS 69769655 69769797 . - 2 Parent=AAK1.dAug10 +2 AceView CDS 69771568 69771676 . - 0 Parent=AAK1.dAug10 +2 AceView CDS 69783992 69784110 . - 2 Parent=AAK1.dAug10 +2 AceView CDS 69870010 69870172 . - 0 Parent=AAK1.dAug10 +2 AceView three_prime_UTR 69688532 69688798 . - . Parent=AAK1.dAug10 +2 AceView exon 69688532 69688843 . - . Parent=AAK1.dAug10 +2 AceView exon 69736389 69736592 . - . Parent=AAK1.dAug10 +2 AceView exon 69741603 69741881 . - . Parent=AAK1.dAug10 +2 AceView exon 69746086 69746372 . - . Parent=AAK1.dAug10 +2 AceView exon 69747966 69748120 . - . Parent=AAK1.dAug10 +2 AceView exon 69752165 69752244 . - . Parent=AAK1.dAug10 +2 AceView exon 69754348 69754451 . - . Parent=AAK1.dAug10 +2 AceView exon 69757140 69757272 . - . Parent=AAK1.dAug10 +2 AceView exon 69757757 69757838 . - . Parent=AAK1.dAug10 +2 AceView exon 69759173 69759294 . - . Parent=AAK1.dAug10 +2 AceView exon 69769655 69769797 . - . Parent=AAK1.dAug10 +2 AceView exon 69771568 69771676 . - . Parent=AAK1.dAug10 +2 AceView exon 69783992 69784110 . - . Parent=AAK1.dAug10 +2 AceView exon 69870010 69870406 . - . Parent=AAK1.dAug10 +2 AceView exon 69870707 69870785 . - . Parent=AAK1.dAug10 +2 AceView mRNA 69709896 69710563 . - . ID=AAK1.kAug10-unspliced;Parent=AAK1 +2 AceView CDS 69710258 69710563 . - 0 Parent=AAK1.kAug10-unspliced +2 AceView three_prime_UTR 69709896 69710257 . - . Parent=AAK1.kAug10-unspliced +2 AceView exon 69709896 69710563 . - . Parent=AAK1.kAug10-unspliced +2 AceView transcript 69731836 69735403 . - . ID=AAK1.mAug10-unspliced;Parent=AAK1 +2 AceView exon 69731836 69735403 . - . Parent=AAK1.mAug10-unspliced +2 AceView mRNA 69748060 69771641 . - . ID=AAK1.gAug10;Parent=AAK1 +2 AceView five_prime_UTR 69757808 69757838 . - . Parent=AAK1.gAug10 +2 AceView five_prime_UTR 69758733 69759294 . - . Parent=AAK1.gAug10 +2 AceView five_prime_UTR 69769655 69769797 . - . Parent=AAK1.gAug10 +2 AceView five_prime_UTR 69771568 69771641 . - . Parent=AAK1.gAug10 +2 AceView CDS 69748060 69748120 . - 1 Parent=AAK1.gAug10 +2 AceView CDS 69752165 69752244 . - 0 Parent=AAK1.gAug10 +2 AceView CDS 69754348 69754451 . - 2 Parent=AAK1.gAug10 +2 AceView CDS 69757140 69757272 . - 0 Parent=AAK1.gAug10 +2 AceView CDS 69757757 69757807 . - 0 Parent=AAK1.gAug10 +2 AceView exon 69748060 69748120 . - . Parent=AAK1.gAug10 +2 AceView exon 69752165 69752244 . - . Parent=AAK1.gAug10 +2 AceView exon 69754348 69754451 . - . Parent=AAK1.gAug10 +2 AceView exon 69757140 69757272 . - . Parent=AAK1.gAug10 +2 AceView exon 69757757 69757838 . - . Parent=AAK1.gAug10 +2 AceView exon 69758733 69759294 . - . Parent=AAK1.gAug10 +2 AceView exon 69769655 69769797 . - . Parent=AAK1.gAug10 +2 AceView exon 69771568 69771641 . - . Parent=AAK1.gAug10 +5 AceView gene 178191862 178245436 . - . ID=AACSL;Name=AACSL +5 AceView mRNA 178194262 178203188 . - . ID=AACSL.cAug10;Parent=AACSL +5 AceView five_prime_UTR 178203188 178203188 . - . Parent=AACSL.cAug10 +5 AceView CDS 178194262 178194336 . - 0 Parent=AACSL.cAug10 +5 AceView CDS 178199430 178199632 . - 2 Parent=AACSL.cAug10 +5 AceView CDS 178201499 178201549 . - 2 Parent=AACSL.cAug10 +5 AceView CDS 178202268 178202337 . - 0 Parent=AACSL.cAug10 +5 AceView CDS 178203143 178203187 . - 0 Parent=AACSL.cAug10 +5 AceView exon 178194262 178194336 . - . Parent=AACSL.cAug10 +5 AceView exon 178199430 178199632 . - . Parent=AACSL.cAug10 +5 AceView exon 178201499 178201549 . - . Parent=AACSL.cAug10 +5 AceView exon 178202268 178202337 . - . Parent=AACSL.cAug10 +5 AceView exon 178203143 178203188 . - . Parent=AACSL.cAug10 +5 AceView transcript 178191866 178195523 . - . ID=AACSL.dAug10;Parent=AACSL +5 AceView exon 178191866 178192398 . - . Parent=AACSL.dAug10 +5 AceView exon 178193362 178194336 . - . Parent=AACSL.dAug10 +5 AceView exon 178195471 178195523 . - . Parent=AACSL.dAug10 +5 AceView mRNA 178193085 178245387 . - . ID=AACSL.aAug10;Parent=AACSL +5 AceView five_prime_UTR 178224568 178224612 . - . Parent=AACSL.aAug10 +5 AceView five_prime_UTR 178238175 178238287 . - . Parent=AACSL.aAug10 +5 AceView five_prime_UTR 178241899 178242009 . - . Parent=AACSL.aAug10 +5 AceView five_prime_UTR 178245095 178245387 . - . Parent=AACSL.aAug10 +5 AceView CDS 178195540 178195668 . - 0 Parent=AACSL.aAug10 +5 AceView CDS 178199430 178199632 . - 2 Parent=AACSL.aAug10 +5 AceView CDS 178201499 178201549 . - 2 Parent=AACSL.aAug10 +5 AceView CDS 178202268 178202337 . - 0 Parent=AACSL.aAug10 +5 AceView CDS 178203143 178203277 . - 0 Parent=AACSL.aAug10 +5 AceView CDS 178224532 178224567 . - 0 Parent=AACSL.aAug10 +5 AceView three_prime_UTR 178193085 178193176 . - . Parent=AACSL.aAug10 +5 AceView three_prime_UTR 178194131 178194336 . - . Parent=AACSL.aAug10 +5 AceView three_prime_UTR 178195471 178195539 . - . Parent=AACSL.aAug10 +5 AceView exon 178193085 178193176 . - . Parent=AACSL.aAug10 +5 AceView exon 178194131 178194336 . - . Parent=AACSL.aAug10 +5 AceView exon 178195471 178195668 . - . Parent=AACSL.aAug10 +5 AceView exon 178199430 178199632 . - . Parent=AACSL.aAug10 +5 AceView exon 178201499 178201549 . - . Parent=AACSL.aAug10 +5 AceView exon 178202268 178202337 . - . Parent=AACSL.aAug10 +5 AceView exon 178203143 178203277 . - . Parent=AACSL.aAug10 +5 AceView exon 178224532 178224612 . - . Parent=AACSL.aAug10 +5 AceView exon 178238175 178238287 . - . Parent=AACSL.aAug10 +5 AceView exon 178241899 178242009 . - . Parent=AACSL.aAug10 +5 AceView exon 178245095 178245387 . - . Parent=AACSL.aAug10 +5 AceView mRNA 178191862 178245436 . - . ID=AACSL.bAug10;Parent=AACSL +5 AceView five_prime_UTR 178224568 178224612 . - . Parent=AACSL.bAug10 +5 AceView five_prime_UTR 178238175 178238287 . - . Parent=AACSL.bAug10 +5 AceView five_prime_UTR 178241899 178242009 . - . Parent=AACSL.bAug10 +5 AceView five_prime_UTR 178245095 178245436 . - . Parent=AACSL.bAug10 +5 AceView CDS 178195540 178195665 . - 0 Parent=AACSL.bAug10 +5 AceView CDS 178199430 178199632 . - 2 Parent=AACSL.bAug10 +5 AceView CDS 178201499 178201549 . - 2 Parent=AACSL.bAug10 +5 AceView CDS 178202268 178202337 . - 0 Parent=AACSL.bAug10 +5 AceView CDS 178203143 178203277 . - 0 Parent=AACSL.bAug10 +5 AceView CDS 178224532 178224567 . - 0 Parent=AACSL.bAug10 +5 AceView three_prime_UTR 178191862 178193176 . - . Parent=AACSL.bAug10 +5 AceView three_prime_UTR 178194131 178194336 . - . Parent=AACSL.bAug10 +5 AceView three_prime_UTR 178195471 178195539 . - . Parent=AACSL.bAug10 +5 AceView exon 178191862 178193176 . - . Parent=AACSL.bAug10 +5 AceView exon 178194131 178194336 . - . Parent=AACSL.bAug10 +5 AceView exon 178195471 178195665 . - . Parent=AACSL.bAug10 +5 AceView exon 178199430 178199632 . - . Parent=AACSL.bAug10 +5 AceView exon 178201499 178201549 . - . Parent=AACSL.bAug10 +5 AceView exon 178202268 178202337 . - . Parent=AACSL.bAug10 +5 AceView exon 178203143 178203277 . - . Parent=AACSL.bAug10 +5 AceView exon 178224532 178224612 . - . Parent=AACSL.bAug10 +5 AceView exon 178238175 178238287 . - . Parent=AACSL.bAug10 +5 AceView exon 178241899 178242009 . - . Parent=AACSL.bAug10 +5 AceView exon 178245095 178245436 . - . Parent=AACSL.bAug10 +2 AceView gene 219128851 219134979 . - . ID=AAMP;Name=AAMP +2 AceView mRNA 219128883 219134811 . - . ID=AAMP.fAug10;Parent=AAMP +2 AceView five_prime_UTR 219134810 219134811 . - . Parent=AAMP.fAug10 +2 AceView CDS 219129739 219129897 . - 0 Parent=AAMP.fAug10 +2 AceView CDS 219130094 219130184 . - 1 Parent=AAMP.fAug10 +2 AceView CDS 219130302 219130405 . - 0 Parent=AAMP.fAug10 +2 AceView CDS 219130554 219130669 . - 2 Parent=AAMP.fAug10 +2 AceView CDS 219130787 219130870 . - 2 Parent=AAMP.fAug10 +2 AceView CDS 219131166 219131310 . - 0 Parent=AAMP.fAug10 +2 AceView CDS 219131570 219131709 . - 2 Parent=AAMP.fAug10 +2 AceView CDS 219132217 219132336 . - 2 Parent=AAMP.fAug10 +2 AceView CDS 219134105 219134260 . - 2 Parent=AAMP.fAug10 +2 AceView CDS 219134689 219134809 . - 0 Parent=AAMP.fAug10 +2 AceView three_prime_UTR 219128883 219129331 . - . Parent=AAMP.fAug10 +2 AceView exon 219128883 219129331 . - . Parent=AAMP.fAug10 +2 AceView exon 219129739 219129897 . - . Parent=AAMP.fAug10 +2 AceView exon 219130094 219130184 . - . Parent=AAMP.fAug10 +2 AceView exon 219130302 219130405 . - . Parent=AAMP.fAug10 +2 AceView exon 219130554 219130669 . - . Parent=AAMP.fAug10 +2 AceView exon 219130787 219130870 . - . Parent=AAMP.fAug10 +2 AceView exon 219131166 219131310 . - . Parent=AAMP.fAug10 +2 AceView exon 219131570 219131709 . - . Parent=AAMP.fAug10 +2 AceView exon 219132217 219132336 . - . Parent=AAMP.fAug10 +2 AceView exon 219134105 219134260 . - . Parent=AAMP.fAug10 +2 AceView exon 219134689 219134811 . - . Parent=AAMP.fAug10 +2 AceView mRNA 219128885 219134860 . - . ID=AAMP.eAug10;Parent=AAMP +2 AceView five_prime_UTR 219134322 219134860 . - . Parent=AAMP.eAug10 +2 AceView CDS 219129256 219129331 . - 1 Parent=AAMP.eAug10 +2 AceView CDS 219129743 219129897 . - 0 Parent=AAMP.eAug10 +2 AceView CDS 219130094 219130184 . - 1 Parent=AAMP.eAug10 +2 AceView CDS 219130302 219130405 . - 0 Parent=AAMP.eAug10 +2 AceView CDS 219130554 219130669 . - 2 Parent=AAMP.eAug10 +2 AceView CDS 219130787 219130870 . - 2 Parent=AAMP.eAug10 +2 AceView CDS 219131166 219131310 . - 0 Parent=AAMP.eAug10 +2 AceView CDS 219131570 219131709 . - 2 Parent=AAMP.eAug10 +2 AceView CDS 219132217 219132336 . - 2 Parent=AAMP.eAug10 +2 AceView CDS 219134105 219134321 . - 0 Parent=AAMP.eAug10 +2 AceView three_prime_UTR 219128885 219129255 . - . Parent=AAMP.eAug10 +2 AceView exon 219128885 219129331 . - . Parent=AAMP.eAug10 +2 AceView exon 219129743 219129897 . - . Parent=AAMP.eAug10 +2 AceView exon 219130094 219130184 . - . Parent=AAMP.eAug10 +2 AceView exon 219130302 219130405 . - . Parent=AAMP.eAug10 +2 AceView exon 219130554 219130669 . - . Parent=AAMP.eAug10 +2 AceView exon 219130787 219130870 . - . Parent=AAMP.eAug10 +2 AceView exon 219131166 219131310 . - . Parent=AAMP.eAug10 +2 AceView exon 219131570 219131709 . - . Parent=AAMP.eAug10 +2 AceView exon 219132217 219132336 . - . Parent=AAMP.eAug10 +2 AceView exon 219134105 219134860 . - . Parent=AAMP.eAug10 +2 AceView mRNA 219128853 219134843 . - . ID=AAMP.hAug10;Parent=AAMP +2 AceView five_prime_UTR 219134810 219134843 . - . Parent=AAMP.hAug10 +2 AceView CDS 219130389 219130669 . - 2 Parent=AAMP.hAug10 +2 AceView CDS 219130787 219130870 . - 2 Parent=AAMP.hAug10 +2 AceView CDS 219131166 219131310 . - 0 Parent=AAMP.hAug10 +2 AceView CDS 219131570 219131709 . - 2 Parent=AAMP.hAug10 +2 AceView CDS 219132217 219132336 . - 2 Parent=AAMP.hAug10 +2 AceView CDS 219134105 219134257 . - 2 Parent=AAMP.hAug10 +2 AceView CDS 219134689 219134809 . - 0 Parent=AAMP.hAug10 +2 AceView three_prime_UTR 219128853 219129331 . - . Parent=AAMP.hAug10 +2 AceView three_prime_UTR 219129743 219129897 . - . Parent=AAMP.hAug10 +2 AceView three_prime_UTR 219130094 219130184 . - . Parent=AAMP.hAug10 +2 AceView three_prime_UTR 219130302 219130388 . - . Parent=AAMP.hAug10 +2 AceView exon 219128853 219129331 . - . Parent=AAMP.hAug10 +2 AceView exon 219129743 219129897 . - . Parent=AAMP.hAug10 +2 AceView exon 219130094 219130184 . - . Parent=AAMP.hAug10 +2 AceView exon 219130302 219130669 . - . Parent=AAMP.hAug10 +2 AceView exon 219130787 219130870 . - . Parent=AAMP.hAug10 +2 AceView exon 219131166 219131310 . - . Parent=AAMP.hAug10 +2 AceView exon 219131570 219131709 . - . Parent=AAMP.hAug10 +2 AceView exon 219132217 219132336 . - . Parent=AAMP.hAug10 +2 AceView exon 219134105 219134257 . - . Parent=AAMP.hAug10 +2 AceView exon 219134689 219134843 . - . Parent=AAMP.hAug10 +2 AceView mRNA 219128853 219134893 . - . ID=AAMP.dAug10;Parent=AAMP +2 AceView five_prime_UTR 219134810 219134893 . - . Parent=AAMP.dAug10 +2 AceView CDS 219129256 219129331 . - 1 Parent=AAMP.dAug10 +2 AceView CDS 219129743 219129897 . - 0 Parent=AAMP.dAug10 +2 AceView CDS 219130094 219130184 . - 1 Parent=AAMP.dAug10 +2 AceView CDS 219130302 219130405 . - 0 Parent=AAMP.dAug10 +2 AceView CDS 219130554 219130669 . - 2 Parent=AAMP.dAug10 +2 AceView CDS 219130787 219130870 . - 2 Parent=AAMP.dAug10 +2 AceView CDS 219131166 219131310 . - 0 Parent=AAMP.dAug10 +2 AceView CDS 219131570 219131709 . - 2 Parent=AAMP.dAug10 +2 AceView CDS 219132217 219132336 . - 2 Parent=AAMP.dAug10 +2 AceView CDS 219134105 219134257 . - 2 Parent=AAMP.dAug10 +2 AceView CDS 219134689 219134809 . - 0 Parent=AAMP.dAug10 +2 AceView three_prime_UTR 219128853 219129255 . - . Parent=AAMP.dAug10 +2 AceView exon 219128853 219129331 . - . Parent=AAMP.dAug10 +2 AceView exon 219129743 219129897 . - . Parent=AAMP.dAug10 +2 AceView exon 219130094 219130184 . - . Parent=AAMP.dAug10 +2 AceView exon 219130302 219130405 . - . Parent=AAMP.dAug10 +2 AceView exon 219130554 219130669 . - . Parent=AAMP.dAug10 +2 AceView exon 219130787 219130870 . - . Parent=AAMP.dAug10 +2 AceView exon 219131166 219131310 . - . Parent=AAMP.dAug10 +2 AceView exon 219131570 219131709 . - . Parent=AAMP.dAug10 +2 AceView exon 219132217 219132336 . - . Parent=AAMP.dAug10 +2 AceView exon 219134105 219134257 . - . Parent=AAMP.dAug10 +2 AceView exon 219134689 219134893 . - . Parent=AAMP.dAug10 +2 AceView mRNA 219129090 219134860 . - . ID=AAMP.aAug10;Parent=AAMP +2 AceView five_prime_UTR 219134810 219134860 . - . Parent=AAMP.aAug10 +2 AceView CDS 219129256 219129331 . - 1 Parent=AAMP.aAug10 +2 AceView CDS 219129743 219129897 . - 0 Parent=AAMP.aAug10 +2 AceView CDS 219130094 219130184 . - 1 Parent=AAMP.aAug10 +2 AceView CDS 219130302 219130405 . - 0 Parent=AAMP.aAug10 +2 AceView CDS 219130554 219130669 . - 2 Parent=AAMP.aAug10 +2 AceView CDS 219130778 219130870 . - 2 Parent=AAMP.aAug10 +2 AceView CDS 219131166 219131310 . - 0 Parent=AAMP.aAug10 +2 AceView CDS 219131570 219131709 . - 2 Parent=AAMP.aAug10 +2 AceView CDS 219132217 219132336 . - 2 Parent=AAMP.aAug10 +2 AceView CDS 219134105 219134260 . - 2 Parent=AAMP.aAug10 +2 AceView CDS 219134689 219134809 . - 0 Parent=AAMP.aAug10 +2 AceView three_prime_UTR 219129090 219129255 . - . Parent=AAMP.aAug10 +2 AceView exon 219129090 219129331 . - . Parent=AAMP.aAug10 +2 AceView exon 219129743 219129897 . - . Parent=AAMP.aAug10 +2 AceView exon 219130094 219130184 . - . Parent=AAMP.aAug10 +2 AceView exon 219130302 219130405 . - . Parent=AAMP.aAug10 +2 AceView exon 219130554 219130669 . - . Parent=AAMP.aAug10 +2 AceView exon 219130778 219130870 . - . Parent=AAMP.aAug10 +2 AceView exon 219131166 219131310 . - . Parent=AAMP.aAug10 +2 AceView exon 219131570 219131709 . - . Parent=AAMP.aAug10 +2 AceView exon 219132217 219132336 . - . Parent=AAMP.aAug10 +2 AceView exon 219134105 219134260 . - . Parent=AAMP.aAug10 +2 AceView exon 219134689 219134860 . - . Parent=AAMP.aAug10 +2 AceView mRNA 219128852 219134979 . - . ID=AAMP.bAug10;Parent=AAMP +2 AceView five_prime_UTR 219134810 219134979 . - . Parent=AAMP.bAug10 +2 AceView CDS 219129256 219129331 . - 1 Parent=AAMP.bAug10 +2 AceView CDS 219129743 219129897 . - 0 Parent=AAMP.bAug10 +2 AceView CDS 219130094 219130184 . - 1 Parent=AAMP.bAug10 +2 AceView CDS 219130302 219130405 . - 0 Parent=AAMP.bAug10 +2 AceView CDS 219130554 219130669 . - 2 Parent=AAMP.bAug10 +2 AceView CDS 219130778 219130870 . - 2 Parent=AAMP.bAug10 +2 AceView CDS 219131166 219131310 . - 0 Parent=AAMP.bAug10 +2 AceView CDS 219131570 219131709 . - 2 Parent=AAMP.bAug10 +2 AceView CDS 219132217 219132336 . - 2 Parent=AAMP.bAug10 +2 AceView CDS 219134105 219134257 . - 2 Parent=AAMP.bAug10 +2 AceView CDS 219134689 219134809 . - 0 Parent=AAMP.bAug10 +2 AceView three_prime_UTR 219128852 219129089 . - . Parent=AAMP.bAug10 +2 AceView three_prime_UTR 219129238 219129255 . - . Parent=AAMP.bAug10 +2 AceView exon 219128852 219129089 . - . Parent=AAMP.bAug10 +2 AceView exon 219129238 219129331 . - . Parent=AAMP.bAug10 +2 AceView exon 219129743 219129897 . - . Parent=AAMP.bAug10 +2 AceView exon 219130094 219130184 . - . Parent=AAMP.bAug10 +2 AceView exon 219130302 219130405 . - . Parent=AAMP.bAug10 +2 AceView exon 219130554 219130669 . - . Parent=AAMP.bAug10 +2 AceView exon 219130778 219130870 . - . Parent=AAMP.bAug10 +2 AceView exon 219131166 219131310 . - . Parent=AAMP.bAug10 +2 AceView exon 219131570 219131709 . - . Parent=AAMP.bAug10 +2 AceView exon 219132217 219132336 . - . Parent=AAMP.bAug10 +2 AceView exon 219134105 219134257 . - . Parent=AAMP.bAug10 +2 AceView exon 219134689 219134979 . - . Parent=AAMP.bAug10 +2 AceView mRNA 219128853 219134857 . - . ID=AAMP.gAug10;Parent=AAMP +2 AceView five_prime_UTR 219134810 219134857 . - . Parent=AAMP.gAug10 +2 AceView CDS 219129739 219129897 . - 0 Parent=AAMP.gAug10 +2 AceView CDS 219130094 219130184 . - 1 Parent=AAMP.gAug10 +2 AceView CDS 219130302 219130405 . - 0 Parent=AAMP.gAug10 +2 AceView CDS 219130554 219130669 . - 2 Parent=AAMP.gAug10 +2 AceView CDS 219130787 219130870 . - 2 Parent=AAMP.gAug10 +2 AceView CDS 219131166 219131310 . - 0 Parent=AAMP.gAug10 +2 AceView CDS 219131570 219131709 . - 2 Parent=AAMP.gAug10 +2 AceView CDS 219132217 219132336 . - 2 Parent=AAMP.gAug10 +2 AceView CDS 219134105 219134257 . - 2 Parent=AAMP.gAug10 +2 AceView CDS 219134689 219134809 . - 0 Parent=AAMP.gAug10 +2 AceView three_prime_UTR 219128853 219129331 . - . Parent=AAMP.gAug10 +2 AceView exon 219128853 219129331 . - . Parent=AAMP.gAug10 +2 AceView exon 219129739 219129897 . - . Parent=AAMP.gAug10 +2 AceView exon 219130094 219130184 . - . Parent=AAMP.gAug10 +2 AceView exon 219130302 219130405 . - . Parent=AAMP.gAug10 +2 AceView exon 219130554 219130669 . - . Parent=AAMP.gAug10 +2 AceView exon 219130787 219130870 . - . Parent=AAMP.gAug10 +2 AceView exon 219131166 219131310 . - . Parent=AAMP.gAug10 +2 AceView exon 219131570 219131709 . - . Parent=AAMP.gAug10 +2 AceView exon 219132217 219132336 . - . Parent=AAMP.gAug10 +2 AceView exon 219134105 219134257 . - . Parent=AAMP.gAug10 +2 AceView exon 219134689 219134857 . - . Parent=AAMP.gAug10 +2 AceView mRNA 219128851 219134882 . - . ID=AAMP.cAug10;Parent=AAMP +2 AceView five_prime_UTR 219134810 219134882 . - . Parent=AAMP.cAug10 +2 AceView CDS 219129256 219129331 . - 1 Parent=AAMP.cAug10 +2 AceView CDS 219129743 219129897 . - 0 Parent=AAMP.cAug10 +2 AceView CDS 219130094 219130184 . - 1 Parent=AAMP.cAug10 +2 AceView CDS 219130302 219130405 . - 0 Parent=AAMP.cAug10 +2 AceView CDS 219130554 219130669 . - 2 Parent=AAMP.cAug10 +2 AceView CDS 219130787 219130870 . - 2 Parent=AAMP.cAug10 +2 AceView CDS 219131166 219131310 . - 0 Parent=AAMP.cAug10 +2 AceView CDS 219131570 219131709 . - 2 Parent=AAMP.cAug10 +2 AceView CDS 219132217 219132336 . - 2 Parent=AAMP.cAug10 +2 AceView CDS 219134105 219134260 . - 2 Parent=AAMP.cAug10 +2 AceView CDS 219134689 219134809 . - 0 Parent=AAMP.cAug10 +2 AceView three_prime_UTR 219128851 219129255 . - . Parent=AAMP.cAug10 +2 AceView exon 219128851 219129331 . - . Parent=AAMP.cAug10 +2 AceView exon 219129743 219129897 . - . Parent=AAMP.cAug10 +2 AceView exon 219130094 219130184 . - . Parent=AAMP.cAug10 +2 AceView exon 219130302 219130405 . - . Parent=AAMP.cAug10 +2 AceView exon 219130554 219130669 . - . Parent=AAMP.cAug10 +2 AceView exon 219130787 219130870 . - . Parent=AAMP.cAug10 +2 AceView exon 219131166 219131310 . - . Parent=AAMP.cAug10 +2 AceView exon 219131570 219131709 . - . Parent=AAMP.cAug10 +2 AceView exon 219132217 219132336 . - . Parent=AAMP.cAug10 +2 AceView exon 219134105 219134260 . - . Parent=AAMP.cAug10 +2 AceView exon 219134689 219134882 . - . Parent=AAMP.cAug10 +3 AceView gene 151451704 151479124 . + . ID=AADACL2;Name=AADACL2 +3 AceView mRNA 151451704 151475667 . + . ID=AADACL2.aAug10;Parent=AADACL2 +3 AceView five_prime_UTR 151451704 151451823 . + . Parent=AADACL2.aAug10 +3 AceView CDS 151451824 151451961 . + 0 Parent=AADACL2.aAug10 +3 AceView CDS 151458434 151458656 . + 0 Parent=AADACL2.aAug10 +3 AceView CDS 151461881 151461950 . + 2 Parent=AADACL2.aAug10 +3 AceView CDS 151463297 151463468 . + 1 Parent=AADACL2.aAug10 +3 AceView CDS 151474780 151475382 . + 0 Parent=AADACL2.aAug10 +3 AceView three_prime_UTR 151475383 151475667 . + . Parent=AADACL2.aAug10 +3 AceView exon 151451704 151451961 . + . Parent=AADACL2.aAug10 +3 AceView exon 151458434 151458656 . + . Parent=AADACL2.aAug10 +3 AceView exon 151461881 151461950 . + . Parent=AADACL2.aAug10 +3 AceView exon 151463297 151463468 . + . Parent=AADACL2.aAug10 +3 AceView exon 151474780 151475667 . + . Parent=AADACL2.aAug10 +3 AceView mRNA 151451704 151479124 . + . ID=AADACL2.bAug10;Parent=AADACL2 +3 AceView five_prime_UTR 151451704 151451948 . + . Parent=AADACL2.bAug10 +3 AceView CDS 151451949 151451961 . + 0 Parent=AADACL2.bAug10 +3 AceView CDS 151461881 151461950 . + 2 Parent=AADACL2.bAug10 +3 AceView CDS 151463297 151463468 . + 1 Parent=AADACL2.bAug10 +3 AceView CDS 151474780 151475382 . + 0 Parent=AADACL2.bAug10 +3 AceView three_prime_UTR 151475383 151479124 . + . Parent=AADACL2.bAug10 +3 AceView exon 151451704 151451961 . + . Parent=AADACL2.bAug10 +3 AceView exon 151461881 151461950 . + . Parent=AADACL2.bAug10 +3 AceView exon 151463297 151463468 . + . Parent=AADACL2.bAug10 +3 AceView exon 151474780 151479124 . + . Parent=AADACL2.bAug10
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/aceview_hs_37.gtf Thu Apr 23 17:57:49 2015 -0400 @@ -0,0 +1,3989 @@ +11 AceView exon 111933358 111934981 . - 0 gene_id 2-oxoacid_dh; Gene_type cDNA_supported; transcript_id 2-oxoacid_dh.aAug10-unspliced; exon_number 1 +19 AceView CDS 58859154 58859210 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.aAug10; product_id A1BGAS.aAug10; exon_number 1 +19 AceView exon 58859153 58859210 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.aAug10; exon_number 1 +19 AceView intron 58859211 58864686 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.aAug10; type gt_ag +19 AceView CDS 58864687 58864840 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.aAug10; product_id A1BGAS.aAug10; exon_number 2 +19 AceView exon 58864687 58864840 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.aAug10; exon_number 2 +19 AceView intron 58864841 58865079 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.aAug10; type gt_ag +19 AceView CDS 58865080 58865114 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.aAug10; product_id A1BGAS.aAug10; exon_number 3 +19 AceView exon 58865080 58865223 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.aAug10; exon_number 3 +19 AceView stop_codon 58865115 58865117 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.aAug10; product_id A1BGAS.aAug10; +19 AceView intron 58865224 58865734 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.aAug10; type gt_ag +19 AceView exon 58865735 58866090 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.aAug10; exon_number 4 +19 AceView start_codon 58864404 58864406 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.bAug10; product_id A1BGAS.bAug10; +19 AceView CDS 58864404 58864410 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.bAug10; product_id A1BGAS.bAug10; exon_number 1 +19 AceView exon 58862110 58864410 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.bAug10; exon_number 1 +19 AceView intron 58864411 58864744 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.bAug10; type gt_ag +19 AceView CDS 58864745 58864840 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.bAug10; product_id A1BGAS.bAug10; exon_number 2 +19 AceView exon 58864745 58864840 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.bAug10; exon_number 2 +19 AceView intron 58864841 58865079 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.bAug10; type gt_ag +19 AceView CDS 58865080 58865114 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.bAug10; product_id A1BGAS.bAug10; exon_number 3 +19 AceView exon 58865080 58865223 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.bAug10; exon_number 3 +19 AceView stop_codon 58865115 58865117 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.bAug10; product_id A1BGAS.bAug10; +19 AceView intron 58865224 58865734 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.bAug10; type gt_ag +19 AceView exon 58865735 58866548 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.bAug10; exon_number 4 +19 AceView exon 58859122 58859210 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.cAug10; exon_number 1 +19 AceView intron 58859211 58864686 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.cAug10; type gt_ag +19 AceView exon 58864687 58864840 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.cAug10; exon_number 2 +19 AceView intron 58864841 58865079 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.cAug10; type gt_ag +19 AceView start_codon 58865831 58865833 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.cAug10; product_id A1BGAS.cAug10; +19 AceView CDS 58865831 58866547 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.cAug10; product_id A1BGAS.cAug10; exon_number 3 +19 AceView exon 58865080 58866548 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.cAug10; exon_number 3 +19 AceView exon 58859122 58859210 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.dAug10; exon_number 1 +19 AceView intron 58859211 58864744 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.dAug10; type gt_ag +19 AceView exon 58864745 58864840 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.dAug10; exon_number 2 +19 AceView intron 58864841 58865079 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.dAug10; type gt_ag +19 AceView start_codon 58865831 58865833 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.dAug10; product_id A1BGAS.dAug10; +19 AceView CDS 58865831 58866547 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.dAug10; product_id A1BGAS.dAug10; exon_number 3 +19 AceView exon 58865080 58866549 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.dAug10; exon_number 3 +19 AceView exon 58859074 58860512 . + 0 gene_id A1BGAS; Gene_type cDNA_supported; transcript_id A1BGAS.eAug10-unspliced; exon_number 1 +10 AceView exon 52645341 52645388 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 1 +10 AceView intron 52623841 52645340 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView exon 52623793 52623840 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 2 +10 AceView intron 52622742 52623792 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView exon 52622649 52622741 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 3 +10 AceView intron 52619746 52622648 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView exon 52619602 52619745 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 4 +10 AceView intron 52610568 52619601 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView start_codon 52610545 52610547 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; +10 AceView CDS 52610425 52610547 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; exon_number 5 +10 AceView exon 52610425 52610567 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 5 +10 AceView intron 52603883 52610424 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView CDS 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; exon_number 6 +10 AceView exon 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 6 +10 AceView intron 52601753 52603747 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView CDS 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; exon_number 7 +10 AceView exon 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 7 +10 AceView intron 52596073 52601621 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView CDS 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; exon_number 8 +10 AceView exon 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 8 +10 AceView intron 52588056 52595833 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView CDS 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; exon_number 9 +10 AceView exon 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 9 +10 AceView intron 52580410 52587890 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView CDS 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; exon_number 10 +10 AceView exon 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 10 +10 AceView intron 52576040 52580311 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView CDS 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; exon_number 11 +10 AceView exon 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 11 +10 AceView intron 52573823 52575765 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView CDS 52573617 52573822 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; exon_number 12 +10 AceView exon 52573617 52573822 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 12 +10 AceView intron 52570937 52573616 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView CDS 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; exon_number 13 +10 AceView exon 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 13 +10 AceView intron 52569803 52570799 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView CDS 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; exon_number 14 +10 AceView exon 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 14 +10 AceView intron 52566641 52569653 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; type gt_ag +10 AceView CDS 52566492 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; exon_number 15 +10 AceView exon 52566420 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; exon_number 15 +10 AceView stop_codon 52566489 52566491 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.aAug10; product_id A1CF.aAug10; +10 AceView exon 52623793 52623833 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 1 +10 AceView intron 52619746 52623792 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; type gt_ag +10 AceView exon 52619602 52619745 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 2 +10 AceView intron 52610568 52619601 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; type gt_ag +10 AceView start_codon 52610545 52610547 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; +10 AceView CDS 52610425 52610547 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; exon_number 3 +10 AceView exon 52610425 52610567 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 3 +10 AceView intron 52603883 52610424 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; type gt_ag +10 AceView CDS 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; exon_number 4 +10 AceView exon 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 4 +10 AceView intron 52601753 52603747 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; type gt_ag +10 AceView CDS 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; exon_number 5 +10 AceView exon 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 5 +10 AceView intron 52596073 52601621 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; type gt_ag +10 AceView CDS 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; exon_number 6 +10 AceView exon 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 6 +10 AceView intron 52588056 52595833 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; type gt_ag +10 AceView CDS 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; exon_number 7 +10 AceView exon 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 7 +10 AceView intron 52580410 52587890 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; type gt_ag +10 AceView CDS 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; exon_number 8 +10 AceView exon 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 8 +10 AceView intron 52576040 52580311 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; type gt_ag +10 AceView CDS 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; exon_number 9 +10 AceView exon 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 9 +10 AceView intron 52573799 52575765 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; type gt_ag +10 AceView CDS 52573617 52573798 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; exon_number 10 +10 AceView exon 52573617 52573798 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 10 +10 AceView intron 52570937 52573616 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; type gt_ag +10 AceView CDS 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; exon_number 11 +10 AceView exon 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 11 +10 AceView intron 52569803 52570799 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; type gt_ag +10 AceView CDS 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; exon_number 12 +10 AceView exon 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 12 +10 AceView intron 52566641 52569653 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; type gt_ag +10 AceView CDS 52566492 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; exon_number 13 +10 AceView exon 52566400 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; exon_number 13 +10 AceView stop_codon 52566489 52566491 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.bAug10; product_id A1CF.bAug10; +10 AceView exon 52645341 52645435 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 1 +10 AceView intron 52623841 52645340 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; type gt_ag +10 AceView exon 52623793 52623840 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 2 +10 AceView intron 52619746 52623792 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; type gt_ag +10 AceView start_codon 52619698 52619700 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; +10 AceView CDS 52619602 52619700 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; exon_number 3 +10 AceView exon 52619602 52619745 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 3 +10 AceView intron 52603883 52619601 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; type gt_ag +10 AceView CDS 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; exon_number 4 +10 AceView exon 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 4 +10 AceView intron 52601753 52603747 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; type gt_ag +10 AceView CDS 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; exon_number 5 +10 AceView exon 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 5 +10 AceView intron 52596073 52601621 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; type gt_ag +10 AceView CDS 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; exon_number 6 +10 AceView exon 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 6 +10 AceView intron 52588056 52595833 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; type gt_ag +10 AceView CDS 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; exon_number 7 +10 AceView exon 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 7 +10 AceView intron 52580410 52587890 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; type gt_ag +10 AceView CDS 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; exon_number 8 +10 AceView exon 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 8 +10 AceView intron 52576040 52580311 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; type gt_ag +10 AceView CDS 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; exon_number 9 +10 AceView exon 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 9 +10 AceView intron 52573823 52575765 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; type gt_ag +10 AceView CDS 52573617 52573822 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; exon_number 10 +10 AceView exon 52573617 52573822 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 10 +10 AceView intron 52570937 52573616 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; type gt_ag +10 AceView CDS 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; exon_number 11 +10 AceView exon 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 11 +10 AceView intron 52569803 52570799 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; type gt_ag +10 AceView CDS 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; exon_number 12 +10 AceView exon 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 12 +10 AceView intron 52566641 52569653 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; type gt_ag +10 AceView CDS 52566492 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; exon_number 13 +10 AceView exon 52566327 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; exon_number 13 +10 AceView stop_codon 52566489 52566491 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.cAug10; product_id A1CF.cAug10; +10 AceView exon 52645341 52645436 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 1 +10 AceView intron 52619746 52645340 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; type gt_ag +10 AceView exon 52619602 52619745 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 2 +10 AceView intron 52610568 52619601 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; type gt_ag +10 AceView start_codon 52610545 52610547 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; +10 AceView CDS 52610425 52610547 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; exon_number 3 +10 AceView exon 52610425 52610567 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 3 +10 AceView intron 52603883 52610424 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; type gt_ag +10 AceView CDS 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; exon_number 4 +10 AceView exon 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 4 +10 AceView intron 52601753 52603747 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; type gt_ag +10 AceView CDS 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; exon_number 5 +10 AceView exon 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 5 +10 AceView intron 52596073 52601621 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; type gt_ag +10 AceView CDS 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; exon_number 6 +10 AceView exon 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 6 +10 AceView intron 52588056 52595833 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; type gt_ag +10 AceView CDS 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; exon_number 7 +10 AceView exon 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 7 +10 AceView intron 52580410 52587890 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; type gt_ag +10 AceView CDS 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; exon_number 8 +10 AceView exon 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 8 +10 AceView intron 52576040 52580311 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; type gt_ag +10 AceView CDS 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; exon_number 9 +10 AceView exon 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 9 +10 AceView intron 52573799 52575765 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; type gt_ag +10 AceView CDS 52573617 52573798 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; exon_number 10 +10 AceView exon 52573617 52573798 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 10 +10 AceView intron 52570937 52573616 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; type gt_ag +10 AceView CDS 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; exon_number 11 +10 AceView exon 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 11 +10 AceView intron 52569803 52570799 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; type gt_ag +10 AceView CDS 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; exon_number 12 +10 AceView exon 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 12 +10 AceView intron 52566641 52569653 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; type gt_ag +10 AceView CDS 52566492 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; exon_number 13 +10 AceView exon 52566327 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; exon_number 13 +10 AceView stop_codon 52566489 52566491 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.dAug10; product_id A1CF.dAug10; +10 AceView exon 52645341 52645411 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; exon_number 1 +10 AceView intron 52619746 52645340 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; type gt_ag +10 AceView start_codon 52619698 52619700 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; +10 AceView CDS 52619602 52619700 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; exon_number 2 +10 AceView exon 52619602 52619745 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; exon_number 2 +10 AceView intron 52603883 52619601 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; type gt_ag +10 AceView CDS 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; exon_number 3 +10 AceView exon 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; exon_number 3 +10 AceView intron 52601753 52603747 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; type gt_ag +10 AceView CDS 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; exon_number 4 +10 AceView exon 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; exon_number 4 +10 AceView intron 52596073 52601621 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; type gt_ag +10 AceView CDS 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; exon_number 5 +10 AceView exon 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; exon_number 5 +10 AceView intron 52588056 52595833 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; type gt_ag +10 AceView CDS 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; exon_number 6 +10 AceView exon 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; exon_number 6 +10 AceView intron 52580410 52587890 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; type gt_ag +10 AceView CDS 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; exon_number 7 +10 AceView exon 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; exon_number 7 +10 AceView intron 52576040 52580311 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; type gt_ag +10 AceView CDS 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; exon_number 8 +10 AceView exon 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; exon_number 8 +10 AceView intron 52573799 52575765 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; type gt_ag +10 AceView CDS 52573617 52573798 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; exon_number 9 +10 AceView exon 52573617 52573798 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; exon_number 9 +10 AceView intron 52570937 52573616 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; type gt_ag +10 AceView CDS 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; exon_number 10 +10 AceView exon 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; exon_number 10 +10 AceView intron 52569803 52570799 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; type gt_ag +10 AceView CDS 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; exon_number 11 +10 AceView exon 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; exon_number 11 +10 AceView intron 52566641 52569653 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; type gt_ag +10 AceView CDS 52566492 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; exon_number 12 +10 AceView exon 52566481 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; exon_number 12 +10 AceView stop_codon 52566489 52566491 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.eAug10; product_id A1CF.eAug10; +10 AceView exon 52645341 52645387 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 1 +10 AceView intron 52623841 52645340 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView exon 52623793 52623840 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 2 +10 AceView intron 52622742 52623792 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView exon 52622649 52622741 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 3 +10 AceView intron 52619746 52622648 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView start_codon 52619698 52619700 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; +10 AceView CDS 52619602 52619700 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; exon_number 4 +10 AceView exon 52619602 52619745 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 4 +10 AceView intron 52603883 52619601 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView CDS 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; exon_number 5 +10 AceView exon 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 5 +10 AceView intron 52601753 52603747 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView CDS 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; exon_number 6 +10 AceView exon 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 6 +10 AceView intron 52596073 52601621 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView CDS 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; exon_number 7 +10 AceView exon 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 7 +10 AceView intron 52588056 52595833 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView CDS 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; exon_number 8 +10 AceView exon 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 8 +10 AceView intron 52580410 52587890 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView CDS 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; exon_number 9 +10 AceView exon 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 9 +10 AceView intron 52576040 52580311 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView CDS 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; exon_number 10 +10 AceView exon 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 10 +10 AceView intron 52573799 52575765 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView CDS 52573617 52573798 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; exon_number 11 +10 AceView exon 52573617 52573798 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 11 +10 AceView intron 52570937 52573616 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView CDS 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; exon_number 12 +10 AceView exon 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 12 +10 AceView intron 52569803 52570799 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView CDS 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; exon_number 13 +10 AceView exon 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 13 +10 AceView intron 52566641 52569653 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; type gt_ag +10 AceView CDS 52566492 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; exon_number 14 +10 AceView exon 52566307 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; exon_number 14 +10 AceView stop_codon 52566489 52566491 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.fAug10; product_id A1CF.fAug10; +10 AceView exon 52645341 52645435 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 1 +10 AceView intron 52623841 52645340 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; type gt_ag +10 AceView exon 52623793 52623840 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 2 +10 AceView intron 52619746 52623792 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; type gt_ag +10 AceView start_codon 52619698 52619700 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; +10 AceView CDS 52619602 52619700 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; exon_number 3 +10 AceView exon 52619602 52619745 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 3 +10 AceView intron 52603883 52619601 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; type gt_ag +10 AceView CDS 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; exon_number 4 +10 AceView exon 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 4 +10 AceView intron 52601753 52603747 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; type gt_ag +10 AceView CDS 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; exon_number 5 +10 AceView exon 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 5 +10 AceView intron 52596073 52601621 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; type gt_ag +10 AceView CDS 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; exon_number 6 +10 AceView exon 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 6 +10 AceView intron 52588056 52595833 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; type gt_ag +10 AceView CDS 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; exon_number 7 +10 AceView exon 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 7 +10 AceView intron 52580410 52587890 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; type gt_ag +10 AceView CDS 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; exon_number 8 +10 AceView exon 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 8 +10 AceView intron 52576040 52580311 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; type gt_ag +10 AceView CDS 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; exon_number 9 +10 AceView exon 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 9 +10 AceView intron 52573799 52575765 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; type gt_ag +10 AceView CDS 52573617 52573798 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; exon_number 10 +10 AceView exon 52573617 52573798 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 10 +10 AceView intron 52570937 52573616 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; type gt_ag +10 AceView CDS 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; exon_number 11 +10 AceView exon 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 11 +10 AceView intron 52569803 52570799 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; type gt_ag +10 AceView CDS 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; exon_number 12 +10 AceView exon 52569654 52569802 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 12 +10 AceView intron 52566641 52569653 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; type gt_ag +10 AceView CDS 52566492 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; exon_number 13 +10 AceView exon 52566327 52566640 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; exon_number 13 +10 AceView stop_codon 52566489 52566491 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.gAug10; product_id A1CF.gAug10; +10 AceView start_codon 52588176 52588178 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; product_id A1CF.hAug10; +10 AceView CDS 52588148 52588178 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; product_id A1CF.hAug10; exon_number 1 +10 AceView exon 52588148 52588221 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; exon_number 1 +10 AceView intron 52588056 52588147 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; type gt_ag +10 AceView CDS 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; product_id A1CF.hAug10; exon_number 2 +10 AceView exon 52587891 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; exon_number 2 +10 AceView intron 52580410 52587890 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; type gt_ag +10 AceView CDS 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; product_id A1CF.hAug10; exon_number 3 +10 AceView exon 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; exon_number 3 +10 AceView intron 52576040 52580311 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; type gt_ag +10 AceView CDS 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; product_id A1CF.hAug10; exon_number 4 +10 AceView exon 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; exon_number 4 +10 AceView intron 52573823 52575765 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; type gt_ag +10 AceView CDS 52573617 52573822 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; product_id A1CF.hAug10; exon_number 5 +10 AceView exon 52573617 52573822 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; exon_number 5 +10 AceView intron 52570937 52573616 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; type gt_ag +10 AceView CDS 52570802 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; product_id A1CF.hAug10; exon_number 6 +10 AceView exon 52570800 52570936 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.hAug10; exon_number 6 +10 AceView CDS 52587891 52588059 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.iAug10; product_id A1CF.iAug10; exon_number 1 +10 AceView exon 52587891 52588060 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.iAug10; exon_number 1 +10 AceView intron 52580410 52587890 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.iAug10; type gt_ag +10 AceView CDS 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.iAug10; product_id A1CF.iAug10; exon_number 2 +10 AceView exon 52580312 52580409 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.iAug10; exon_number 2 +10 AceView intron 52576040 52580311 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.iAug10; type gt_ag +10 AceView CDS 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.iAug10; product_id A1CF.iAug10; exon_number 3 +10 AceView exon 52575766 52576039 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.iAug10; exon_number 3 +10 AceView intron 52573823 52575765 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.iAug10; type gt_ag +10 AceView CDS 52573617 52573822 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.iAug10; product_id A1CF.iAug10; exon_number 4 +10 AceView exon 52573617 52573822 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.iAug10; exon_number 4 +10 AceView exon 52645341 52645405 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; exon_number 1 +10 AceView intron 52623841 52645340 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; type gt_ag +10 AceView start_codon 52623832 52623834 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; product_id A1CF.jAug10; +10 AceView CDS 52623793 52623834 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; product_id A1CF.jAug10; exon_number 2 +10 AceView exon 52623793 52623840 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; exon_number 2 +10 AceView intron 52603883 52623792 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; type gt_ag +10 AceView CDS 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; product_id A1CF.jAug10; exon_number 3 +10 AceView exon 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; exon_number 3 +10 AceView intron 52601753 52603747 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; type gt_ag +10 AceView CDS 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; product_id A1CF.jAug10; exon_number 4 +10 AceView exon 52601622 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; exon_number 4 +10 AceView intron 52596073 52601621 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; type gt_ag +10 AceView CDS 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; product_id A1CF.jAug10; exon_number 5 +10 AceView exon 52595834 52596072 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; exon_number 5 +10 AceView intron 52588056 52595833 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; type gt_ag +10 AceView CDS 52587967 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; product_id A1CF.jAug10; exon_number 6 +10 AceView exon 52587965 52588055 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.jAug10; exon_number 6 +10 AceView exon 52645341 52645434 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.kAug10; exon_number 1 +10 AceView intron 52619746 52645340 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.kAug10; type gt_ag +10 AceView start_codon 52619698 52619700 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.kAug10; product_id A1CF.kAug10; +10 AceView CDS 52619602 52619700 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.kAug10; product_id A1CF.kAug10; exon_number 2 +10 AceView exon 52619602 52619745 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.kAug10; exon_number 2 +10 AceView intron 52603883 52619601 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.kAug10; type gt_ag +10 AceView CDS 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.kAug10; product_id A1CF.kAug10; exon_number 3 +10 AceView exon 52603748 52603882 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.kAug10; exon_number 3 +10 AceView intron 52601753 52603747 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.kAug10; type gt_ag +10 AceView CDS 52601621 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.kAug10; product_id A1CF.kAug10; exon_number 4 +10 AceView exon 52601582 52601752 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.kAug10; exon_number 4 +10 AceView stop_codon 52601618 52601620 . - 0 gene_id A1CF; Gene_type cDNA_supported; transcript_id A1CF.kAug10; product_id A1CF.kAug10; +16 AceView start_codon 7383003 7383005 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; +16 AceView CDS 7383003 7383089 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 1 +16 AceView exon 7382748 7383089 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 1 +16 AceView intron 7383090 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; type gt_ag +16 AceView CDS 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 2 +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 2 +16 AceView intron 7568392 7629778 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; type gt_ag +16 AceView CDS 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 3 +16 AceView exon 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 3 +16 AceView intron 7629923 7637248 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; type gt_ag +16 AceView CDS 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 4 +16 AceView exon 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 4 +16 AceView intron 7637303 7645550 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; type gt_ag +16 AceView CDS 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 5 +16 AceView exon 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 5 +16 AceView intron 7645644 7647372 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; type gt_ag +16 AceView CDS 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 6 +16 AceView exon 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 6 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 7 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 7 +16 AceView intron 7657341 7680604 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; type gt_ag +16 AceView CDS 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 8 +16 AceView exon 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 8 +16 AceView intron 7680686 7703816 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; type gt_ag +16 AceView CDS 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 9 +16 AceView exon 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 9 +16 AceView intron 7703950 7721558 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; type gt_ag +16 AceView CDS 7721559 7721601 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 10 +16 AceView exon 7721559 7721601 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 10 +16 AceView intron 7721602 7726775 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; type gt_ag +16 AceView CDS 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 11 +16 AceView exon 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 11 +16 AceView intron 7726841 7759057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; type gt_ag +16 AceView CDS 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 12 +16 AceView exon 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 12 +16 AceView intron 7759134 7760624 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; type gt_ag +16 AceView CDS 7760625 7760744 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; exon_number 13 +16 AceView exon 7760625 7763340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; exon_number 13 +16 AceView stop_codon 7760745 7760747 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.aAug10; product_id A2BP1.aAug10; +16 AceView exon 6823811 6824014 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 1 +16 AceView intron 6824015 7102057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView start_codon 7102073 7102075 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; +16 AceView CDS 7102073 7102099 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 2 +16 AceView exon 7102058 7102099 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 2 +16 AceView intron 7102100 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView CDS 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 3 +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 3 +16 AceView intron 7568392 7629778 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView CDS 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 4 +16 AceView exon 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 4 +16 AceView intron 7629923 7637248 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView CDS 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 5 +16 AceView exon 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 5 +16 AceView intron 7637303 7645550 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView CDS 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 6 +16 AceView exon 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 6 +16 AceView intron 7645644 7647372 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView CDS 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 7 +16 AceView exon 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 7 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 8 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 8 +16 AceView intron 7657341 7680604 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView CDS 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 9 +16 AceView exon 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 9 +16 AceView intron 7680686 7703816 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView CDS 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 10 +16 AceView exon 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 10 +16 AceView intron 7703950 7714930 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView CDS 7714931 7714970 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 11 +16 AceView exon 7714931 7714970 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 11 +16 AceView intron 7714971 7726775 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView CDS 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 12 +16 AceView exon 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 12 +16 AceView intron 7726841 7759057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView CDS 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 13 +16 AceView exon 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 13 +16 AceView intron 7759134 7760624 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; type gt_ag +16 AceView CDS 7760625 7760744 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; exon_number 14 +16 AceView exon 7760625 7763340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; exon_number 14 +16 AceView stop_codon 7760745 7760747 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.bAug10; product_id A2BP1.bAug10; +16 AceView exon 6068990 6069993 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 1 +16 AceView intron 6069994 6366995 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView exon 6366996 6367058 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 2 +16 AceView intron 6367059 6704603 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView exon 6704604 6704651 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 3 +16 AceView intron 6704652 7102057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView start_codon 7102073 7102075 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; +16 AceView CDS 7102073 7102099 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 4 +16 AceView exon 7102058 7102099 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 4 +16 AceView intron 7102100 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView CDS 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 5 +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 5 +16 AceView intron 7568392 7629778 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView CDS 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 6 +16 AceView exon 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 6 +16 AceView intron 7629923 7637248 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView CDS 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 7 +16 AceView exon 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 7 +16 AceView intron 7637303 7645550 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView CDS 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 8 +16 AceView exon 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 8 +16 AceView intron 7645644 7647372 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView CDS 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 9 +16 AceView exon 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 9 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 10 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 10 +16 AceView intron 7657341 7680604 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView CDS 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 11 +16 AceView exon 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 11 +16 AceView intron 7680686 7703816 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView CDS 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 12 +16 AceView exon 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 12 +16 AceView intron 7703950 7714930 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView CDS 7714931 7714970 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 13 +16 AceView exon 7714931 7714970 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 13 +16 AceView intron 7714971 7726775 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView CDS 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 14 +16 AceView exon 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 14 +16 AceView intron 7726841 7759057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView CDS 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 15 +16 AceView exon 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 15 +16 AceView intron 7759134 7760624 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; type gt_ag +16 AceView CDS 7760625 7760744 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; exon_number 16 +16 AceView exon 7760625 7763341 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; exon_number 16 +16 AceView stop_codon 7760745 7760747 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.cAug10; product_id A2BP1.cAug10; +16 AceView start_codon 7383003 7383005 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; +16 AceView CDS 7383003 7383089 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 1 +16 AceView exon 7382750 7383089 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 1 +16 AceView intron 7383090 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView CDS 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 2 +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 2 +16 AceView intron 7568392 7629778 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView CDS 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 3 +16 AceView exon 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 3 +16 AceView intron 7629923 7637248 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView CDS 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 4 +16 AceView exon 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 4 +16 AceView intron 7637303 7645550 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView CDS 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 5 +16 AceView exon 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 5 +16 AceView intron 7645644 7647372 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView CDS 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 6 +16 AceView exon 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 6 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 7 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 7 +16 AceView intron 7657341 7680604 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView CDS 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 8 +16 AceView exon 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 8 +16 AceView intron 7680686 7703816 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView CDS 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 9 +16 AceView exon 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 9 +16 AceView intron 7703950 7721558 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView CDS 7721559 7721601 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 10 +16 AceView exon 7721559 7721601 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 10 +16 AceView intron 7721602 7726775 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView CDS 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 11 +16 AceView exon 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 11 +16 AceView intron 7726841 7743316 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView CDS 7743317 7743369 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 12 +16 AceView exon 7743317 7743369 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 12 +16 AceView intron 7743370 7759057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView CDS 7759058 7759131 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; exon_number 13 +16 AceView exon 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 13 +16 AceView intron 7759134 7760624 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; type gt_ag +16 AceView exon 7760625 7763340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; exon_number 14 +16 AceView stop_codon 7760623 7760625 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.dAug10; product_id A2BP1.dAug10; +16 AceView start_codon 7383003 7383005 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; +16 AceView CDS 7383003 7383089 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 1 +16 AceView exon 7382750 7383089 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 1 +16 AceView intron 7383090 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; type gt_ag +16 AceView CDS 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 2 +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 2 +16 AceView intron 7568392 7629778 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; type gt_ag +16 AceView CDS 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 3 +16 AceView exon 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 3 +16 AceView intron 7629923 7637248 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; type gt_ag +16 AceView CDS 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 4 +16 AceView exon 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 4 +16 AceView intron 7637303 7645550 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; type gt_ag +16 AceView CDS 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 5 +16 AceView exon 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 5 +16 AceView intron 7645644 7647372 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; type gt_ag +16 AceView CDS 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 6 +16 AceView exon 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 6 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 7 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 7 +16 AceView intron 7657341 7680604 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; type gt_ag +16 AceView CDS 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 8 +16 AceView exon 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 8 +16 AceView intron 7680686 7703816 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; type gt_ag +16 AceView CDS 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 9 +16 AceView exon 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 9 +16 AceView intron 7703950 7721558 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; type gt_ag +16 AceView CDS 7721559 7721601 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 10 +16 AceView exon 7721559 7721601 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 10 +16 AceView intron 7721602 7726775 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; type gt_ag +16 AceView CDS 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 11 +16 AceView exon 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 11 +16 AceView intron 7726841 7759057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; type gt_ag +16 AceView CDS 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 12 +16 AceView exon 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 12 +16 AceView intron 7759134 7760702 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; type gt_ag +16 AceView CDS 7760703 7760744 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; exon_number 13 +16 AceView exon 7760703 7763340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; exon_number 13 +16 AceView stop_codon 7760745 7760747 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.eAug10; product_id A2BP1.eAug10; +16 AceView exon 6069222 6069993 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 1 +16 AceView intron 6069994 6704603 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView exon 6704604 6704651 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 2 +16 AceView intron 6704652 7102057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView start_codon 7102073 7102075 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; +16 AceView CDS 7102073 7102099 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 3 +16 AceView exon 7102058 7102099 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 3 +16 AceView intron 7102100 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView CDS 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 4 +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 4 +16 AceView intron 7568392 7629778 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView CDS 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 5 +16 AceView exon 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 5 +16 AceView intron 7629923 7637248 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView CDS 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 6 +16 AceView exon 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 6 +16 AceView intron 7637303 7645550 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView CDS 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 7 +16 AceView exon 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 7 +16 AceView intron 7645644 7647372 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView CDS 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 8 +16 AceView exon 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 8 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 9 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 9 +16 AceView intron 7657341 7680604 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView CDS 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 10 +16 AceView exon 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 10 +16 AceView intron 7680686 7703816 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView CDS 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 11 +16 AceView exon 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 11 +16 AceView intron 7703950 7714930 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView CDS 7714931 7714970 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 12 +16 AceView exon 7714931 7714970 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 12 +16 AceView intron 7714971 7726775 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView CDS 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 13 +16 AceView exon 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 13 +16 AceView intron 7726841 7759057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView CDS 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 14 +16 AceView exon 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 14 +16 AceView intron 7759134 7759495 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; type gt_ag +16 AceView CDS 7759496 7759570 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; exon_number 15 +16 AceView exon 7759496 7759783 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; exon_number 15 +16 AceView stop_codon 7759571 7759573 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.fAug10; product_id A2BP1.fAug10; +16 AceView start_codon 7383003 7383005 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; +16 AceView CDS 7383003 7383089 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; exon_number 1 +16 AceView exon 7382954 7383089 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; exon_number 1 +16 AceView intron 7383090 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; type gt_ag +16 AceView CDS 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; exon_number 2 +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; exon_number 2 +16 AceView intron 7568392 7629778 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; type gt_ag +16 AceView CDS 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; exon_number 3 +16 AceView exon 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; exon_number 3 +16 AceView intron 7629923 7637248 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; type gt_ag +16 AceView CDS 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; exon_number 4 +16 AceView exon 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; exon_number 4 +16 AceView intron 7637303 7645550 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; type gt_ag +16 AceView CDS 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; exon_number 5 +16 AceView exon 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; exon_number 5 +16 AceView intron 7645644 7647372 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; type gt_ag +16 AceView CDS 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; exon_number 6 +16 AceView exon 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; exon_number 6 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; exon_number 7 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; exon_number 7 +16 AceView intron 7657341 7703816 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; type gt_ag +16 AceView CDS 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; exon_number 8 +16 AceView exon 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; exon_number 8 +16 AceView intron 7703950 7721558 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; type gt_ag +16 AceView CDS 7721559 7721601 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; exon_number 9 +16 AceView exon 7721559 7721601 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; exon_number 9 +16 AceView intron 7721602 7726775 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; type gt_ag +16 AceView CDS 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; exon_number 10 +16 AceView exon 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; exon_number 10 +16 AceView intron 7726841 7759057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; type gt_ag +16 AceView CDS 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; exon_number 11 +16 AceView exon 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; exon_number 11 +16 AceView intron 7759134 7760624 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; type gt_ag +16 AceView CDS 7760625 7760681 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; product_id A2BP1.gAug10; exon_number 12 +16 AceView exon 7760625 7760683 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.gAug10; exon_number 12 +16 AceView exon 6069132 6069993 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 1 +16 AceView intron 6069994 6366995 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView exon 6366996 6367058 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 2 +16 AceView intron 6367059 6704603 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView exon 6704604 6704651 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 3 +16 AceView intron 6704652 7102057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView start_codon 7102073 7102075 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; +16 AceView CDS 7102073 7102099 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; exon_number 4 +16 AceView exon 7102058 7102099 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 4 +16 AceView intron 7102100 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView CDS 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; exon_number 5 +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 5 +16 AceView intron 7568392 7629778 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView CDS 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; exon_number 6 +16 AceView exon 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 6 +16 AceView intron 7629923 7637248 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView CDS 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; exon_number 7 +16 AceView exon 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 7 +16 AceView intron 7637303 7645550 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView CDS 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; exon_number 8 +16 AceView exon 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 8 +16 AceView intron 7645644 7647372 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView CDS 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; exon_number 9 +16 AceView exon 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 9 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; exon_number 10 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 10 +16 AceView intron 7657341 7703816 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView CDS 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; exon_number 11 +16 AceView exon 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 11 +16 AceView intron 7703950 7714930 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView CDS 7714931 7714970 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; exon_number 12 +16 AceView exon 7714931 7714970 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 12 +16 AceView intron 7714971 7726775 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView CDS 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; exon_number 13 +16 AceView exon 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 13 +16 AceView intron 7726841 7759057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView CDS 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; exon_number 14 +16 AceView exon 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 14 +16 AceView intron 7759134 7760624 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; type gt_ag +16 AceView CDS 7760625 7760744 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; exon_number 15 +16 AceView exon 7760625 7763340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; exon_number 15 +16 AceView stop_codon 7760745 7760747 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.hAug10; product_id A2BP1.hAug10; +16 AceView exon 7353253 7353549 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; exon_number 1 +16 AceView intron 7353550 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; type gt_ag +16 AceView start_codon 7568182 7568184 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; +16 AceView CDS 7568182 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; exon_number 2 +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; exon_number 2 +16 AceView intron 7568392 7637248 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; type gt_ag +16 AceView CDS 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; exon_number 3 +16 AceView exon 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; exon_number 3 +16 AceView intron 7637303 7647372 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; type gt_ag +16 AceView CDS 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; exon_number 4 +16 AceView exon 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; exon_number 4 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; exon_number 5 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; exon_number 5 +16 AceView intron 7657341 7680604 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; type gt_ag +16 AceView CDS 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; exon_number 6 +16 AceView exon 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; exon_number 6 +16 AceView intron 7680686 7703816 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; type gt_ag +16 AceView CDS 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; exon_number 7 +16 AceView exon 7703817 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; exon_number 7 +16 AceView intron 7703950 7714930 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; type gt_ag +16 AceView CDS 7714931 7714970 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; exon_number 8 +16 AceView exon 7714931 7714970 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; exon_number 8 +16 AceView intron 7714971 7726775 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; type gt_ag +16 AceView CDS 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; exon_number 9 +16 AceView exon 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; exon_number 9 +16 AceView intron 7726841 7743316 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; type gt_ag +16 AceView CDS 7743317 7743369 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; exon_number 10 +16 AceView exon 7743317 7743369 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; exon_number 10 +16 AceView intron 7743370 7759057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; type gt_ag +16 AceView CDS 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; exon_number 11 +16 AceView exon 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; exon_number 11 +16 AceView intron 7759134 7759495 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; type gt_ag +16 AceView CDS 7759496 7759640 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; exon_number 12 +16 AceView exon 7759496 7759778 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; exon_number 12 +16 AceView stop_codon 7759641 7759643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.iAug10; product_id A2BP1.iAug10; +16 AceView exon 6069095 6069993 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; exon_number 1 +16 AceView intron 6069994 6366995 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; type gt_ag +16 AceView exon 6366996 6367058 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; exon_number 2 +16 AceView intron 6367059 6704603 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; type gt_ag +16 AceView exon 6704604 6704651 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; exon_number 3 +16 AceView intron 6704652 7102057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; type gt_ag +16 AceView start_codon 7102073 7102075 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; product_id A2BP1.jAug10; +16 AceView CDS 7102073 7102099 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; product_id A2BP1.jAug10; exon_number 4 +16 AceView exon 7102058 7102099 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; exon_number 4 +16 AceView intron 7102100 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; type gt_ag +16 AceView CDS 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; product_id A2BP1.jAug10; exon_number 5 +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; exon_number 5 +16 AceView intron 7568392 7629781 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; type gt_ag +16 AceView CDS 7629782 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; product_id A2BP1.jAug10; exon_number 6 +16 AceView exon 7629782 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; exon_number 6 +16 AceView intron 7629923 7637248 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; type gt_ag +16 AceView CDS 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; product_id A2BP1.jAug10; exon_number 7 +16 AceView exon 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; exon_number 7 +16 AceView intron 7637303 7645550 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; type gt_ag +16 AceView CDS 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; product_id A2BP1.jAug10; exon_number 8 +16 AceView exon 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; exon_number 8 +16 AceView intron 7645644 7647372 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; type gt_ag +16 AceView CDS 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; product_id A2BP1.jAug10; exon_number 9 +16 AceView exon 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; exon_number 9 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; product_id A2BP1.jAug10; exon_number 10 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; exon_number 10 +16 AceView intron 7657341 7680604 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; type gt_ag +16 AceView CDS 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; product_id A2BP1.jAug10; exon_number 11 +16 AceView exon 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; exon_number 11 +16 AceView intron 7680686 7703816 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; type gt_ag +16 AceView CDS 7703817 7703848 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; product_id A2BP1.jAug10; exon_number 12 +16 AceView exon 7703817 7703848 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.jAug10; exon_number 12 +16 AceView start_codon 7354385 7354387 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; product_id A2BP1.kAug10; +16 AceView CDS 7354385 7354486 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; product_id A2BP1.kAug10; exon_number 1 +16 AceView exon 7354223 7354486 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; exon_number 1 +16 AceView intron 7354487 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; type gt_ag +16 AceView CDS 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; product_id A2BP1.kAug10; exon_number 2 +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; exon_number 2 +16 AceView intron 7568392 7629778 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; type gt_ag +16 AceView CDS 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; product_id A2BP1.kAug10; exon_number 3 +16 AceView exon 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; exon_number 3 +16 AceView intron 7629923 7637248 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; type gt_ag +16 AceView CDS 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; product_id A2BP1.kAug10; exon_number 4 +16 AceView exon 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; exon_number 4 +16 AceView intron 7637303 7647372 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; type gt_ag +16 AceView CDS 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; product_id A2BP1.kAug10; exon_number 5 +16 AceView exon 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; exon_number 5 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; product_id A2BP1.kAug10; exon_number 6 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; exon_number 6 +16 AceView intron 7657341 7680604 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; type gt_ag +16 AceView CDS 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; product_id A2BP1.kAug10; exon_number 7 +16 AceView exon 7680605 7680685 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; exon_number 7 +16 AceView intron 7680686 7703816 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; type gt_ag +16 AceView CDS 7703817 7703848 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; product_id A2BP1.kAug10; exon_number 8 +16 AceView exon 7703817 7703848 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.kAug10; exon_number 8 +16 AceView start_codon 7532750 7532752 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; product_id A2BP1.lAug10; +16 AceView CDS 7532750 7532767 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; product_id A2BP1.lAug10; exon_number 1 +16 AceView exon 7532642 7532767 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; exon_number 1 +16 AceView intron 7532768 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; type gt_ag +16 AceView CDS 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; product_id A2BP1.lAug10; exon_number 2 +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; exon_number 2 +16 AceView intron 7568392 7629778 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; type gt_ag +16 AceView CDS 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; product_id A2BP1.lAug10; exon_number 3 +16 AceView exon 7629779 7629922 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; exon_number 3 +16 AceView intron 7629923 7637248 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; type gt_ag +16 AceView CDS 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; product_id A2BP1.lAug10; exon_number 4 +16 AceView exon 7637249 7637302 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; exon_number 4 +16 AceView intron 7637303 7645550 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; type gt_ag +16 AceView CDS 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; product_id A2BP1.lAug10; exon_number 5 +16 AceView exon 7645551 7645643 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; exon_number 5 +16 AceView intron 7645644 7647372 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; type gt_ag +16 AceView CDS 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; product_id A2BP1.lAug10; exon_number 6 +16 AceView exon 7647373 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; exon_number 6 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; product_id A2BP1.lAug10; exon_number 7 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; exon_number 7 +16 AceView intron 7657341 7703816 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; type gt_ag +16 AceView CDS 7703817 7703836 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; product_id A2BP1.lAug10; exon_number 8 +16 AceView exon 7703817 7703837 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.lAug10; exon_number 8 +16 AceView CDS 7703851 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.mAug10; product_id A2BP1.mAug10; exon_number 1 +16 AceView exon 7703849 7703949 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.mAug10; exon_number 1 +16 AceView intron 7703950 7726775 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.mAug10; type gt_ag +16 AceView CDS 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.mAug10; product_id A2BP1.mAug10; exon_number 2 +16 AceView exon 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.mAug10; exon_number 2 +16 AceView intron 7726841 7759057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.mAug10; type gt_ag +16 AceView CDS 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.mAug10; product_id A2BP1.mAug10; exon_number 3 +16 AceView exon 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.mAug10; exon_number 3 +16 AceView intron 7759134 7760624 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.mAug10; type gt_ag +16 AceView CDS 7760625 7760744 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.mAug10; product_id A2BP1.mAug10; exon_number 4 +16 AceView exon 7760625 7760821 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.mAug10; exon_number 4 +16 AceView stop_codon 7760745 7760747 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.mAug10; product_id A2BP1.mAug10; +16 AceView start_codon 7714897 7714899 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.nAug10; product_id A2BP1.nAug10; +16 AceView CDS 7714897 7714970 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.nAug10; product_id A2BP1.nAug10; exon_number 1 +16 AceView exon 7714766 7714970 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.nAug10; exon_number 1 +16 AceView intron 7714971 7726775 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.nAug10; type gt_ag +16 AceView CDS 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.nAug10; product_id A2BP1.nAug10; exon_number 2 +16 AceView exon 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.nAug10; exon_number 2 +16 AceView intron 7726841 7759057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.nAug10; type gt_ag +16 AceView CDS 7759058 7759131 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.nAug10; product_id A2BP1.nAug10; exon_number 3 +16 AceView exon 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.nAug10; exon_number 3 +16 AceView intron 7759134 7760624 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.nAug10; type gt_ag +16 AceView exon 7760625 7760841 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.nAug10; exon_number 4 +16 AceView stop_codon 7760623 7760625 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.nAug10; product_id A2BP1.nAug10; +16 AceView start_codon 7647397 7647399 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.oAug10; product_id A2BP1.oAug10; +16 AceView CDS 7647397 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.oAug10; product_id A2BP1.oAug10; exon_number 1 +16 AceView exon 7647219 7647433 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.oAug10; exon_number 1 +16 AceView intron 7647434 7657286 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.oAug10; type gt_ag +16 AceView CDS 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.oAug10; product_id A2BP1.oAug10; exon_number 2 +16 AceView exon 7657287 7657340 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.oAug10; exon_number 2 +16 AceView intron 7657341 7680604 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.oAug10; type gt_ag +16 AceView CDS 7680605 7680627 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.oAug10; product_id A2BP1.oAug10; exon_number 3 +16 AceView exon 7680605 7680628 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.oAug10; exon_number 3 +16 AceView exon 7725433 7725858 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.pAug10; exon_number 1 +16 AceView exon 7726776 7726840 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.pAug10; exon_number 2 +16 AceView intron 7726841 7759057 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.pAug10; type gt_ag +16 AceView exon 7759058 7759133 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.pAug10; exon_number 3 +16 AceView intron 7759134 7760624 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.pAug10; type gt_ag +16 AceView exon 7760625 7760841 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.pAug10; exon_number 4 +16 AceView exon 7472779 7473029 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.uAug10; exon_number 1 +16 AceView intron 7473030 7568148 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.uAug10; type gt_ag +16 AceView exon 7568149 7568391 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.uAug10; exon_number 2 +16 AceView intron 7568392 7629778 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.uAug10; type gt_ag +16 AceView exon 7629779 7629787 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.uAug10; exon_number 3 +16 AceView exon 6519209 6519991 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.qAug10-unspliced; exon_number 1 +16 AceView exon 7711158 7711733 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.sAug10-unspliced; exon_number 1 +16 AceView exon 6521045 6521580 . + 0 gene_id A2BP1; Gene_type cDNA_supported; transcript_id A2BP1.tAug10-unspliced; exon_number 1 +13 AceView CDS 101185817 101185923 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.aAug10; product_id A2LD1.aAug10; exon_number 1 +13 AceView exon 101185817 101185923 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.aAug10; exon_number 1 +13 AceView intron 101185623 101185816 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.aAug10; type gt_ag +13 AceView CDS 101185541 101185622 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.aAug10; product_id A2LD1.aAug10; exon_number 2 +13 AceView exon 101185541 101185622 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.aAug10; exon_number 2 +13 AceView intron 101184856 101185540 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.aAug10; type gt_ag +13 AceView CDS 101184742 101184855 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.aAug10; product_id A2LD1.aAug10; exon_number 3 +13 AceView exon 101184742 101184855 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.aAug10; exon_number 3 +13 AceView exon 101240995 101241040 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.bAug10; exon_number 1 +13 AceView intron 101236252 101240994 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.bAug10; type gt_ag +13 AceView exon 101236079 101236251 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.bAug10; exon_number 2 +13 AceView intron 101184856 101236078 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.bAug10; type gt_ag +13 AceView exon 101182342 101184855 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.bAug10; exon_number 3 +13 AceView exon 101236079 101236251 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.cAug10; exon_number 1 +13 AceView intron 101186029 101236078 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.cAug10; type gt_ag +13 AceView exon 101185817 101186028 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.cAug10; exon_number 2 +13 AceView intron 101184856 101185816 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.cAug10; type gt_ag +13 AceView exon 101183811 101184855 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.cAug10; exon_number 3 +13 AceView exon 101185817 101186437 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.dAug10; exon_number 1 +13 AceView intron 101184856 101185816 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.dAug10; type gt_ag +13 AceView start_codon 101184843 101184845 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.dAug10; product_id A2LD1.dAug10; +13 AceView CDS 101184387 101184845 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.dAug10; product_id A2LD1.dAug10; exon_number 2 +13 AceView exon 101184284 101184855 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.dAug10; exon_number 2 +13 AceView stop_codon 101184384 101184386 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.dAug10; product_id A2LD1.dAug10; +13 AceView exon 101241565 101241782 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.eAug10; exon_number 1 +13 AceView intron 101236252 101241564 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.eAug10; type gt_ag +13 AceView exon 101236079 101236251 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.eAug10; exon_number 2 +13 AceView intron 101184856 101236078 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.eAug10; type gt_ag +13 AceView exon 101184728 101184855 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.eAug10; exon_number 3 +13 AceView exon 101185541 101185907 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.fAug10; exon_number 1 +13 AceView intron 101184856 101185540 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.fAug10; type gt_ag +13 AceView exon 101184765 101184855 . - 0 gene_id A2LD1; Gene_type cDNA_supported; transcript_id A2LD1.fAug10; exon_number 2 +12 AceView start_codon 9268443 9268445 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; +12 AceView CDS 9268360 9268445 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 1 +12 AceView exon 9268360 9268798 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 1 +12 AceView intron 9266140 9268359 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9265956 9266139 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 2 +12 AceView exon 9265956 9266139 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 2 +12 AceView intron 9265133 9265955 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9264973 9265132 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 3 +12 AceView exon 9264973 9265132 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 3 +12 AceView intron 9264808 9264972 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9264755 9264807 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 4 +12 AceView exon 9264755 9264807 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 4 +12 AceView intron 9262931 9264754 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9262910 9262930 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 5 +12 AceView exon 9262910 9262930 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 5 +12 AceView intron 9262632 9262909 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9262463 9262631 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 6 +12 AceView exon 9262463 9262631 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 6 +12 AceView intron 9262002 9262462 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9261917 9262001 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 7 +12 AceView exon 9261917 9262001 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 7 +12 AceView intron 9260241 9261916 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9260120 9260240 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 8 +12 AceView exon 9260120 9260240 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 8 +12 AceView intron 9259202 9260119 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9259087 9259201 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 9 +12 AceView exon 9259087 9259201 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 9 +12 AceView intron 9258942 9259086 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9258832 9258941 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 10 +12 AceView exon 9258832 9258941 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 10 +12 AceView intron 9256997 9258831 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9256835 9256996 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 11 +12 AceView exon 9256835 9256996 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 11 +12 AceView intron 9254271 9256834 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9254043 9254270 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 12 +12 AceView exon 9254043 9254270 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 12 +12 AceView intron 9253804 9254042 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9253740 9253803 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 13 +12 AceView exon 9253740 9253803 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 13 +12 AceView intron 9252120 9253739 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9251977 9252119 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 14 +12 AceView exon 9251977 9252119 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 14 +12 AceView intron 9251353 9251976 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9251203 9251352 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 15 +12 AceView exon 9251203 9251352 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 15 +12 AceView intron 9248297 9251202 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9248135 9248296 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 16 +12 AceView exon 9248135 9248296 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 16 +12 AceView intron 9247681 9248134 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9247569 9247680 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 17 +12 AceView exon 9247569 9247680 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 17 +12 AceView intron 9246176 9247568 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9246061 9246175 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 18 +12 AceView exon 9246061 9246175 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 18 +12 AceView intron 9244026 9246060 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9243797 9244025 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 19 +12 AceView exon 9243797 9244025 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 19 +12 AceView intron 9243079 9243796 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9242952 9243078 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 20 +12 AceView exon 9242952 9243078 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 20 +12 AceView intron 9242620 9242951 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9242498 9242619 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 21 +12 AceView exon 9242498 9242619 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 21 +12 AceView intron 9241848 9242497 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9241796 9241847 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 22 +12 AceView exon 9241796 9241847 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 22 +12 AceView intron 9232774 9241795 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9232690 9232773 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 23 +12 AceView exon 9232690 9232773 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 23 +12 AceView intron 9232412 9232689 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9232235 9232411 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 24 +12 AceView exon 9232235 9232411 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 24 +12 AceView intron 9231928 9232234 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9231840 9231927 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 25 +12 AceView exon 9231840 9231927 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 25 +12 AceView intron 9230454 9231839 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9230297 9230453 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 26 +12 AceView exon 9230297 9230453 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 26 +12 AceView intron 9230017 9230296 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9229942 9230016 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 27 +12 AceView exon 9229942 9230016 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 27 +12 AceView intron 9229533 9229941 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9229352 9229532 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 28 +12 AceView exon 9229352 9229532 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 28 +12 AceView intron 9227380 9229351 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9227156 9227379 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 29 +12 AceView exon 9227156 9227379 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 29 +12 AceView intron 9225468 9227155 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9225249 9225467 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 30 +12 AceView exon 9225249 9225467 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 30 +12 AceView intron 9225083 9225248 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9224955 9225082 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 31 +12 AceView exon 9224955 9225082 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 31 +12 AceView intron 9223175 9224954 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9223084 9223174 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 32 +12 AceView exon 9223084 9223174 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 32 +12 AceView intron 9222410 9223083 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9222341 9222409 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 33 +12 AceView exon 9222341 9222409 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 33 +12 AceView intron 9221439 9222340 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9221336 9221438 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 34 +12 AceView exon 9221336 9221438 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 34 +12 AceView intron 9220821 9221335 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9220779 9220820 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 35 +12 AceView exon 9220779 9220820 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 35 +12 AceView intron 9220436 9220778 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; type gt_ag +12 AceView CDS 9220422 9220435 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; exon_number 36 +12 AceView exon 9220302 9220435 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; exon_number 36 +12 AceView stop_codon 9220419 9220421 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.aAug10; product_id A2M.aAug10; +12 AceView exon 9268360 9268456 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 1 +12 AceView intron 9266140 9268359 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView exon 9265956 9266139 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 2 +12 AceView intron 9264808 9265955 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView start_codon 9264785 9264787 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; +12 AceView CDS 9264755 9264787 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 3 +12 AceView exon 9264755 9264807 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 3 +12 AceView intron 9262931 9264754 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9262910 9262930 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 4 +12 AceView exon 9262910 9262930 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 4 +12 AceView intron 9262632 9262909 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9262463 9262631 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 5 +12 AceView exon 9262463 9262631 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 5 +12 AceView intron 9262002 9262462 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9261917 9262001 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 6 +12 AceView exon 9261917 9262001 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 6 +12 AceView intron 9260241 9261916 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9260120 9260240 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 7 +12 AceView exon 9260120 9260240 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 7 +12 AceView intron 9259202 9260119 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9259087 9259201 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 8 +12 AceView exon 9259087 9259201 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 8 +12 AceView intron 9258942 9259086 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9258832 9258941 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 9 +12 AceView exon 9258832 9258941 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 9 +12 AceView intron 9256997 9258831 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9256835 9256996 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 10 +12 AceView exon 9256835 9256996 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 10 +12 AceView intron 9254271 9256834 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9254043 9254270 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 11 +12 AceView exon 9254043 9254270 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 11 +12 AceView intron 9253804 9254042 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9253740 9253803 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 12 +12 AceView exon 9253740 9253803 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 12 +12 AceView intron 9252120 9253739 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9251977 9252119 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 13 +12 AceView exon 9251977 9252119 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 13 +12 AceView intron 9251353 9251976 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9251203 9251352 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 14 +12 AceView exon 9251203 9251352 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 14 +12 AceView intron 9248297 9251202 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9248135 9248296 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 15 +12 AceView exon 9248135 9248296 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 15 +12 AceView intron 9247681 9248134 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9247569 9247680 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 16 +12 AceView exon 9247569 9247680 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 16 +12 AceView intron 9246176 9247568 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9246061 9246175 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 17 +12 AceView exon 9246061 9246175 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 17 +12 AceView intron 9244026 9246060 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9243797 9244025 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 18 +12 AceView exon 9243797 9244025 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 18 +12 AceView intron 9243079 9243796 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9242952 9243078 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 19 +12 AceView exon 9242952 9243078 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 19 +12 AceView intron 9242620 9242951 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9242498 9242619 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 20 +12 AceView exon 9242498 9242619 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 20 +12 AceView intron 9241848 9242497 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9241796 9241847 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 21 +12 AceView exon 9241796 9241847 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 21 +12 AceView intron 9232774 9241795 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9232690 9232773 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 22 +12 AceView exon 9232690 9232773 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 22 +12 AceView intron 9232412 9232689 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9232235 9232411 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 23 +12 AceView exon 9232235 9232411 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 23 +12 AceView intron 9231928 9232234 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9231840 9231927 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 24 +12 AceView exon 9231840 9231927 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 24 +12 AceView intron 9230454 9231839 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9230297 9230453 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 25 +12 AceView exon 9230297 9230453 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 25 +12 AceView intron 9230017 9230296 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9229942 9230016 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 26 +12 AceView exon 9229942 9230016 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 26 +12 AceView intron 9229533 9229941 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9229352 9229532 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 27 +12 AceView exon 9229352 9229532 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 27 +12 AceView intron 9227380 9229351 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9227156 9227379 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 28 +12 AceView exon 9227156 9227379 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 28 +12 AceView intron 9225468 9227155 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9225249 9225467 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 29 +12 AceView exon 9225249 9225467 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 29 +12 AceView intron 9225083 9225248 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9224955 9225082 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 30 +12 AceView exon 9224955 9225082 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 30 +12 AceView intron 9223175 9224954 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9223084 9223174 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 31 +12 AceView exon 9223084 9223174 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 31 +12 AceView intron 9222410 9223083 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9222341 9222409 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 32 +12 AceView exon 9222341 9222409 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 32 +12 AceView intron 9221439 9222340 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9221336 9221438 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 33 +12 AceView exon 9221336 9221438 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 33 +12 AceView intron 9220821 9221335 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9220779 9220820 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 34 +12 AceView exon 9220779 9220820 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 34 +12 AceView intron 9220436 9220778 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; type gt_ag +12 AceView CDS 9220422 9220435 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; exon_number 35 +12 AceView exon 9220371 9220435 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; exon_number 35 +12 AceView stop_codon 9220419 9220421 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.bAug10; product_id A2M.bAug10; +12 AceView exon 9268360 9268615 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 1 +12 AceView intron 9268033 9268359 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView exon 9267744 9268032 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 2 +12 AceView CDS 9259087 9259109 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 3 +12 AceView exon 9259087 9259109 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 3 +12 AceView intron 9258942 9259086 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9258832 9258941 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 4 +12 AceView exon 9258832 9258941 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 4 +12 AceView intron 9256997 9258831 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9256835 9256996 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 5 +12 AceView exon 9256835 9256996 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 5 +12 AceView intron 9254271 9256834 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9254043 9254270 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 6 +12 AceView exon 9254043 9254270 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 6 +12 AceView intron 9253804 9254042 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9253740 9253803 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 7 +12 AceView exon 9253740 9253803 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 7 +12 AceView intron 9252120 9253739 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9251977 9252119 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 8 +12 AceView exon 9251977 9252119 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 8 +12 AceView intron 9251353 9251976 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9251203 9251352 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 9 +12 AceView exon 9251203 9251352 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 9 +12 AceView intron 9248297 9251202 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9248135 9248296 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 10 +12 AceView exon 9248135 9248296 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 10 +12 AceView intron 9247681 9248134 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9247569 9247680 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 11 +12 AceView exon 9247569 9247680 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 11 +12 AceView intron 9246176 9247568 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9246061 9246175 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 12 +12 AceView exon 9246061 9246175 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 12 +12 AceView intron 9244026 9246060 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9243797 9244025 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 13 +12 AceView exon 9243797 9244025 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 13 +12 AceView intron 9243079 9243796 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9242952 9243078 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 14 +12 AceView exon 9242952 9243078 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 14 +12 AceView intron 9242620 9242951 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9242498 9242619 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 15 +12 AceView exon 9242498 9242619 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 15 +12 AceView intron 9241848 9242497 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9241796 9241847 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 16 +12 AceView exon 9241796 9241847 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 16 +12 AceView intron 9232774 9241795 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9232690 9232773 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 17 +12 AceView exon 9232690 9232773 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 17 +12 AceView intron 9232412 9232689 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9232235 9232411 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 18 +12 AceView exon 9232235 9232411 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 18 +12 AceView intron 9231928 9232234 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9231840 9231927 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 19 +12 AceView exon 9231840 9231927 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 19 +12 AceView intron 9230454 9231839 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9230297 9230453 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 20 +12 AceView exon 9230297 9230453 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 20 +12 AceView intron 9230017 9230296 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9229942 9230016 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 21 +12 AceView exon 9229942 9230016 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 21 +12 AceView intron 9229533 9229941 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9229352 9229532 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 22 +12 AceView exon 9229352 9229532 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 22 +12 AceView intron 9227380 9229351 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9227156 9227379 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 23 +12 AceView exon 9227156 9227379 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 23 +12 AceView intron 9225468 9227155 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9225249 9225467 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 24 +12 AceView exon 9225249 9225467 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 24 +12 AceView intron 9225083 9225248 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9224955 9225082 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 25 +12 AceView exon 9224955 9225082 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 25 +12 AceView intron 9223175 9224954 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9223084 9223174 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 26 +12 AceView exon 9223084 9223174 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 26 +12 AceView intron 9222410 9223083 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9222341 9222409 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 27 +12 AceView exon 9222341 9222409 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 27 +12 AceView intron 9221439 9222340 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9221336 9221438 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 28 +12 AceView exon 9221336 9221438 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 28 +12 AceView intron 9220821 9221335 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9220779 9220820 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 29 +12 AceView exon 9220779 9220820 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 29 +12 AceView intron 9220436 9220778 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; type gt_ag +12 AceView CDS 9220422 9220435 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; exon_number 30 +12 AceView exon 9220338 9220435 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; exon_number 30 +12 AceView stop_codon 9220419 9220421 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.cAug10; product_id A2M.cAug10; +12 AceView CDS 9232235 9232424 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 1 +12 AceView exon 9232235 9232424 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 1 +12 AceView intron 9231928 9232234 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; type gt_ag +12 AceView CDS 9231840 9231927 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 2 +12 AceView exon 9231840 9231927 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 2 +12 AceView intron 9230454 9231839 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; type gt_ag +12 AceView CDS 9230297 9230453 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 3 +12 AceView exon 9230297 9230453 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 3 +12 AceView intron 9230017 9230296 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; type gt_ag +12 AceView CDS 9229942 9230016 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 4 +12 AceView exon 9229942 9230016 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 4 +12 AceView intron 9229533 9229941 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; type gt_ag +12 AceView CDS 9229352 9229532 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 5 +12 AceView exon 9229352 9229532 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 5 +12 AceView intron 9227380 9229351 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; type gt_ag +12 AceView CDS 9227156 9227379 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 6 +12 AceView exon 9227156 9227379 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 6 +12 AceView intron 9225468 9227155 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; type gt_ag +12 AceView CDS 9225249 9225467 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 7 +12 AceView exon 9225249 9225467 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 7 +12 AceView intron 9225083 9225248 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; type gt_ag +12 AceView CDS 9224955 9225082 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 8 +12 AceView exon 9224955 9225082 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 8 +12 AceView intron 9223175 9224954 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; type gt_ag +12 AceView CDS 9223084 9223174 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 9 +12 AceView exon 9223084 9223174 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 9 +12 AceView intron 9222410 9223083 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; type gt_ag +12 AceView CDS 9222341 9222409 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 10 +12 AceView exon 9222341 9222409 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 10 +12 AceView intron 9221439 9222340 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; type gt_ag +12 AceView CDS 9221336 9221438 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 11 +12 AceView exon 9221336 9221438 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 11 +12 AceView intron 9220821 9221335 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; type gt_ag +12 AceView CDS 9220779 9220820 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 12 +12 AceView exon 9220779 9220820 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 12 +12 AceView intron 9220436 9220778 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; type gt_ag +12 AceView CDS 9220422 9220435 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; exon_number 13 +12 AceView exon 9220347 9220435 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; exon_number 13 +12 AceView stop_codon 9220419 9220421 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.dAug10; product_id A2M.dAug10; +12 AceView CDS 9254043 9254150 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.eAug10; product_id A2M.eAug10; exon_number 1 +12 AceView exon 9254043 9254152 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.eAug10; exon_number 1 +12 AceView intron 9253804 9254042 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.eAug10; type gt_ag +12 AceView CDS 9253740 9253803 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.eAug10; product_id A2M.eAug10; exon_number 2 +12 AceView exon 9253740 9253803 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.eAug10; exon_number 2 +12 AceView intron 9252120 9253739 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.eAug10; type gt_ag +12 AceView CDS 9251977 9252119 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.eAug10; product_id A2M.eAug10; exon_number 3 +12 AceView exon 9251977 9252119 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.eAug10; exon_number 3 +12 AceView intron 9251353 9251976 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.eAug10; type gt_ag +12 AceView CDS 9251140 9251352 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.eAug10; product_id A2M.eAug10; exon_number 4 +12 AceView exon 9250980 9251352 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.eAug10; exon_number 4 +12 AceView stop_codon 9251137 9251139 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.eAug10; product_id A2M.eAug10; +12 AceView exon 9268724 9268825 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; exon_number 1 +12 AceView intron 9268463 9268723 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; type gt_ag +12 AceView start_codon 9268443 9268445 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; product_id A2M.fAug10; +12 AceView CDS 9268360 9268445 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; product_id A2M.fAug10; exon_number 2 +12 AceView exon 9268360 9268462 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; exon_number 2 +12 AceView intron 9266140 9268359 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; type gt_ag +12 AceView CDS 9265956 9266139 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; product_id A2M.fAug10; exon_number 3 +12 AceView exon 9265956 9266139 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; exon_number 3 +12 AceView intron 9265133 9265955 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; type gt_ag +12 AceView CDS 9264973 9265132 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; product_id A2M.fAug10; exon_number 4 +12 AceView exon 9264973 9265132 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; exon_number 4 +12 AceView intron 9264808 9264972 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; type gt_ag +12 AceView CDS 9264755 9264807 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; product_id A2M.fAug10; exon_number 5 +12 AceView exon 9264755 9264807 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; exon_number 5 +12 AceView intron 9262931 9264754 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; type gt_ag +12 AceView CDS 9262910 9262930 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; product_id A2M.fAug10; exon_number 6 +12 AceView exon 9262910 9262930 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; exon_number 6 +12 AceView intron 9262632 9262909 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; type gt_ag +12 AceView CDS 9262623 9262631 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; product_id A2M.fAug10; exon_number 7 +12 AceView exon 9262622 9262631 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.fAug10; exon_number 7 +12 AceView CDS 9242952 9243126 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.gAug10; product_id A2M.gAug10; exon_number 1 +12 AceView exon 9242952 9243127 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.gAug10; exon_number 1 +12 AceView intron 9242620 9242951 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.gAug10; type gt_ag +12 AceView CDS 9242498 9242619 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.gAug10; product_id A2M.gAug10; exon_number 2 +12 AceView exon 9242498 9242619 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.gAug10; exon_number 2 +12 AceView intron 9241848 9242497 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.gAug10; type gt_ag +12 AceView CDS 9241796 9241847 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.gAug10; product_id A2M.gAug10; exon_number 3 +12 AceView exon 9241796 9241847 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.gAug10; exon_number 3 +12 AceView intron 9232774 9241795 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.gAug10; type gt_ag +12 AceView CDS 9232658 9232773 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.gAug10; product_id A2M.gAug10; exon_number 4 +12 AceView exon 9231967 9232773 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.gAug10; exon_number 4 +12 AceView stop_codon 9232655 9232657 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.gAug10; product_id A2M.gAug10; +12 AceView start_codon 9221421 9221423 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.hAug10; product_id A2M.hAug10; +12 AceView CDS 9221336 9221423 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.hAug10; product_id A2M.hAug10; exon_number 1 +12 AceView exon 9221336 9221551 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.hAug10; exon_number 1 +12 AceView intron 9220821 9221335 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.hAug10; type gt_ag +12 AceView CDS 9220651 9220820 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.hAug10; product_id A2M.hAug10; exon_number 2 +12 AceView exon 9220311 9220820 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.hAug10; exon_number 2 +12 AceView stop_codon 9220648 9220650 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.hAug10; product_id A2M.hAug10; +12 AceView start_codon 9221351 9221353 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.iAug10; product_id A2M.iAug10; +12 AceView CDS 9221336 9221353 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.iAug10; product_id A2M.iAug10; exon_number 1 +12 AceView exon 9221336 9221674 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.iAug10; exon_number 1 +12 AceView intron 9220821 9221335 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.iAug10; type gt_ag +12 AceView CDS 9220779 9220820 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.iAug10; product_id A2M.iAug10; exon_number 2 +12 AceView exon 9220779 9220820 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.iAug10; exon_number 2 +12 AceView intron 9220436 9220778 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.iAug10; type gt_ag +12 AceView CDS 9220343 9220435 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.iAug10; product_id A2M.iAug10; exon_number 3 +12 AceView exon 9220308 9220435 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.iAug10; exon_number 3 +12 AceView stop_codon 9220340 9220342 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.iAug10; product_id A2M.iAug10; +12 AceView exon 9267168 9268562 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.kAug10-unspliced; exon_number 1 +12 AceView exon 9279666 9280190 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.pAug10; exon_number 1 +12 AceView intron 9278040 9279665 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.pAug10; type gt_ag +12 AceView exon 9277938 9278039 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.pAug10; exon_number 2 +12 AceView intron 9266140 9277937 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.pAug10; type gt_ag +12 AceView exon 9266039 9266139 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.pAug10; exon_number 3 +12 AceView exon 9220303 9220835 . - 0 gene_id A2M; Gene_type cDNA_supported; transcript_id A2M.qAug10-unspliced; exon_number 1 +12 AceView start_codon 8975248 8975250 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; +12 AceView CDS 8975248 8975309 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 1 +12 AceView exon 8975175 8975309 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 1 +12 AceView intron 8975310 8975777 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8975778 8975961 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 2 +12 AceView exon 8975778 8975961 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 2 +12 AceView intron 8975962 8976315 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8976316 8976478 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 3 +12 AceView exon 8976316 8976478 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 3 +12 AceView intron 8976479 8982322 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8982323 8982375 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 4 +12 AceView exon 8982323 8982375 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 4 +12 AceView intron 8982376 8987257 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8987258 8987278 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 5 +12 AceView exon 8987258 8987278 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 5 +12 AceView intron 8987279 8988102 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8988103 8988262 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 6 +12 AceView exon 8988103 8988262 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 6 +12 AceView intron 8988263 8988850 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8988851 8988935 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 7 +12 AceView exon 8988851 8988935 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 7 +12 AceView intron 8988936 8990035 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8990036 8990162 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 8 +12 AceView exon 8990036 8990162 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 8 +12 AceView intron 8990163 8990931 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8990932 8991046 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 9 +12 AceView exon 8990932 8991046 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 9 +12 AceView intron 8991047 8991708 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8991709 8991818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 10 +12 AceView exon 8991709 8991818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 10 +12 AceView intron 8991819 8993964 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8993965 8994132 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 11 +12 AceView exon 8993965 8994132 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 11 +12 AceView intron 8994133 8995729 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8995730 8995957 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 12 +12 AceView exon 8995730 8995957 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 12 +12 AceView intron 8995958 8998037 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8998038 8998098 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 13 +12 AceView exon 8998038 8998098 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 13 +12 AceView intron 8998099 8998672 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 8998673 8998818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 14 +12 AceView exon 8998673 8998818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 14 +12 AceView intron 8998819 9000144 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9000145 9000294 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 15 +12 AceView exon 9000145 9000294 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 15 +12 AceView intron 9000295 9001315 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9001316 9001510 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 16 +12 AceView exon 9001316 9001510 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 16 +12 AceView intron 9001511 9002264 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9002265 9002355 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 17 +12 AceView exon 9002265 9002355 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 17 +12 AceView intron 9002356 9002755 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9002756 9002870 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 18 +12 AceView exon 9002756 9002870 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 18 +12 AceView intron 9002871 9004379 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9004380 9004608 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 19 +12 AceView exon 9004380 9004608 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 19 +12 AceView intron 9004609 9004805 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9004806 9004932 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 20 +12 AceView exon 9004806 9004932 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 20 +12 AceView intron 9004933 9006723 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9006724 9006845 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 21 +12 AceView exon 9006724 9006845 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 21 +12 AceView intron 9006846 9007375 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9007376 9007427 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 22 +12 AceView exon 9007376 9007427 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 22 +12 AceView intron 9007428 9008104 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9008105 9008188 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 23 +12 AceView exon 9008105 9008188 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 23 +12 AceView intron 9008189 9009759 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9009760 9009936 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 24 +12 AceView exon 9009760 9009936 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 24 +12 AceView intron 9009937 9010102 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9010103 9010184 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 25 +12 AceView exon 9010103 9010184 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 25 +12 AceView intron 9010185 9010541 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9010542 9010698 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 26 +12 AceView exon 9010542 9010698 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 26 +12 AceView intron 9010699 9013476 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9013477 9013551 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 27 +12 AceView exon 9013477 9013551 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 27 +12 AceView intron 9013552 9013730 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9013731 9013893 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 28 +12 AceView exon 9013731 9013893 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 28 +12 AceView intron 9013894 9016389 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9016390 9016604 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 29 +12 AceView exon 9016390 9016604 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 29 +12 AceView intron 9016605 9020437 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9020438 9020653 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 30 +12 AceView exon 9020438 9020653 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 30 +12 AceView intron 9020654 9020825 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9020826 9020953 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 31 +12 AceView exon 9020826 9020953 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 31 +12 AceView intron 9020954 9021132 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9021133 9021223 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 32 +12 AceView exon 9021133 9021223 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 32 +12 AceView intron 9021224 9021730 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9021731 9021799 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 33 +12 AceView exon 9021731 9021799 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 33 +12 AceView intron 9021800 9027020 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9027021 9027123 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 34 +12 AceView exon 9027021 9027123 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 34 +12 AceView intron 9027124 9027566 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView CDS 9027567 9027604 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; exon_number 35 +12 AceView exon 9027567 9027608 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 35 +12 AceView stop_codon 9027605 9027607 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; product_id A2ML1.aAug10; +12 AceView intron 9027609 9028056 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; type gt_ag +12 AceView exon 9028057 9028414 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.aAug10; exon_number 36 +12 AceView start_codon 8975248 8975250 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; +12 AceView CDS 8975248 8975309 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 1 +12 AceView exon 8975069 8975309 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 1 +12 AceView intron 8975310 8975777 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8975778 8975961 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 2 +12 AceView exon 8975778 8975961 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 2 +12 AceView intron 8975962 8976315 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8976316 8976478 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 3 +12 AceView exon 8976316 8976478 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 3 +12 AceView intron 8976479 8982322 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8982323 8982375 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 4 +12 AceView exon 8982323 8982375 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 4 +12 AceView intron 8982376 8987257 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8987258 8987278 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 5 +12 AceView exon 8987258 8987278 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 5 +12 AceView intron 8987279 8988102 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8988103 8988262 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 6 +12 AceView exon 8988103 8988262 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 6 +12 AceView intron 8988263 8988850 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8988851 8988935 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 7 +12 AceView exon 8988851 8988935 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 7 +12 AceView intron 8988936 8990035 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8990036 8990162 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 8 +12 AceView exon 8990036 8990162 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 8 +12 AceView intron 8990163 8990931 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8990932 8991046 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 9 +12 AceView exon 8990932 8991046 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 9 +12 AceView intron 8991047 8991708 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8991709 8991818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 10 +12 AceView exon 8991709 8991818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 10 +12 AceView intron 8991819 8993964 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8993965 8994132 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 11 +12 AceView exon 8993965 8994132 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 11 +12 AceView intron 8994133 8995729 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8995730 8995957 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 12 +12 AceView exon 8995730 8995957 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 12 +12 AceView intron 8995958 8998037 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8998038 8998098 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 13 +12 AceView exon 8998038 8998098 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 13 +12 AceView intron 8998099 8998672 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 8998673 8998818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 14 +12 AceView exon 8998673 8998818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 14 +12 AceView intron 8998819 9000144 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9000145 9000294 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 15 +12 AceView exon 9000145 9000294 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 15 +12 AceView intron 9000295 9001315 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9001316 9001510 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 16 +12 AceView exon 9001316 9001510 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 16 +12 AceView intron 9001511 9002264 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9002265 9002355 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 17 +12 AceView exon 9002265 9002355 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 17 +12 AceView intron 9002356 9002755 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9002756 9002870 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 18 +12 AceView exon 9002756 9002870 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 18 +12 AceView intron 9002871 9004379 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9004380 9004608 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 19 +12 AceView exon 9004380 9004608 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 19 +12 AceView intron 9004609 9004805 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9004806 9004932 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 20 +12 AceView exon 9004806 9004932 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 20 +12 AceView intron 9004933 9006723 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9006724 9006845 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 21 +12 AceView exon 9006724 9006845 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 21 +12 AceView intron 9006846 9007375 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9007376 9007427 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 22 +12 AceView exon 9007376 9007427 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 22 +12 AceView intron 9007428 9008104 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9008105 9008188 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 23 +12 AceView exon 9008105 9008188 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 23 +12 AceView intron 9008189 9009759 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9009760 9009936 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 24 +12 AceView exon 9009760 9009936 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 24 +12 AceView intron 9009937 9010102 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9010103 9010184 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 25 +12 AceView exon 9010103 9010184 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 25 +12 AceView intron 9010185 9010541 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9010542 9010698 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 26 +12 AceView exon 9010542 9010698 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 26 +12 AceView intron 9010699 9013476 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9013477 9013551 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 27 +12 AceView exon 9013477 9013551 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 27 +12 AceView intron 9013552 9013730 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9013731 9013893 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 28 +12 AceView exon 9013731 9013893 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 28 +12 AceView intron 9013894 9016389 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9016390 9016604 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 29 +12 AceView exon 9016390 9016604 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 29 +12 AceView intron 9016605 9020437 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9020438 9020653 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 30 +12 AceView exon 9020438 9020653 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 30 +12 AceView intron 9020654 9020825 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9020826 9020953 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 31 +12 AceView exon 9020826 9020953 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 31 +12 AceView intron 9020954 9021132 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9021133 9021223 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 32 +12 AceView exon 9021133 9021223 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 32 +12 AceView intron 9021224 9021730 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9021731 9021799 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 33 +12 AceView exon 9021731 9021799 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 33 +12 AceView intron 9021800 9027020 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9027021 9027123 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 34 +12 AceView exon 9027021 9027123 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 34 +12 AceView intron 9027124 9027566 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView CDS 9027567 9027604 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; exon_number 35 +12 AceView exon 9027567 9027608 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 35 +12 AceView stop_codon 9027605 9027607 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; product_id A2ML1.bAug10; +12 AceView intron 9027609 9028653 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; type gt_ag +12 AceView exon 9028654 9029381 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.bAug10; exon_number 36 +12 AceView start_codon 8997768 8997770 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; +12 AceView CDS 8997768 8997770 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 1 +12 AceView exon 8997600 8997770 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 1 +12 AceView intron 8997771 8998037 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 8998038 8998098 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 2 +12 AceView exon 8998038 8998098 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 2 +12 AceView intron 8998099 8998672 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 8998673 8998818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 3 +12 AceView exon 8998673 8998818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 3 +12 AceView intron 8998819 9000144 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9000145 9000294 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 4 +12 AceView exon 9000145 9000294 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 4 +12 AceView intron 9000295 9001315 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9001316 9001510 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 5 +12 AceView exon 9001316 9001510 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 5 +12 AceView intron 9001511 9002264 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9002265 9002355 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 6 +12 AceView exon 9002265 9002355 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 6 +12 AceView intron 9002356 9002755 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9002756 9002870 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 7 +12 AceView exon 9002756 9002870 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 7 +12 AceView intron 9002871 9004379 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9004380 9004608 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 8 +12 AceView exon 9004380 9004608 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 8 +12 AceView intron 9004609 9004805 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9004806 9004932 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 9 +12 AceView exon 9004806 9004932 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 9 +12 AceView intron 9004933 9006723 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9006724 9006845 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 10 +12 AceView exon 9006724 9006845 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 10 +12 AceView intron 9006846 9007375 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9007376 9007427 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 11 +12 AceView exon 9007376 9007427 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 11 +12 AceView intron 9007428 9008104 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9008105 9008188 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 12 +12 AceView exon 9008105 9008188 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 12 +12 AceView intron 9008189 9009759 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9009760 9009936 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 13 +12 AceView exon 9009760 9009936 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 13 +12 AceView intron 9009937 9010102 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9010103 9010184 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 14 +12 AceView exon 9010103 9010184 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 14 +12 AceView intron 9010185 9010541 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9010542 9010698 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 15 +12 AceView exon 9010542 9010698 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 15 +12 AceView intron 9010699 9013476 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9013477 9013551 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 16 +12 AceView exon 9013477 9013551 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 16 +12 AceView intron 9013552 9013730 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9013731 9013893 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 17 +12 AceView exon 9013731 9013893 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 17 +12 AceView intron 9013894 9016389 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9016390 9016604 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 18 +12 AceView exon 9016390 9016604 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 18 +12 AceView intron 9016605 9020437 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9020438 9020653 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 19 +12 AceView exon 9020438 9020653 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 19 +12 AceView intron 9020654 9020825 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9020826 9020953 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 20 +12 AceView exon 9020826 9020953 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 20 +12 AceView intron 9020954 9021132 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9021133 9021223 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 21 +12 AceView exon 9021133 9021223 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 21 +12 AceView intron 9021224 9021730 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9021731 9021799 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 22 +12 AceView exon 9021731 9021799 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 22 +12 AceView intron 9021800 9027020 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9027021 9027123 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 23 +12 AceView exon 9027021 9027123 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 23 +12 AceView intron 9027124 9027566 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView CDS 9027567 9027604 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; exon_number 24 +12 AceView exon 9027567 9027608 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 24 +12 AceView stop_codon 9027605 9027607 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; product_id A2ML1.cAug10; +12 AceView intron 9027609 9028653 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; type gt_ag +12 AceView exon 9028654 9029052 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.cAug10; exon_number 25 +12 AceView start_codon 8997896 8997898 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; product_id A2ML1.dAug10; +12 AceView CDS 8997896 8997907 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; product_id A2ML1.dAug10; exon_number 1 +12 AceView exon 8997878 8997907 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; exon_number 1 +12 AceView intron 8997908 8998037 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; type gt_ag +12 AceView CDS 8998038 8998098 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; product_id A2ML1.dAug10; exon_number 2 +12 AceView exon 8998038 8998098 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; exon_number 2 +12 AceView intron 8998099 8998672 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; type gt_ag +12 AceView CDS 8998673 8998818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; product_id A2ML1.dAug10; exon_number 3 +12 AceView exon 8998673 8998818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; exon_number 3 +12 AceView intron 8998819 9000144 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; type gt_ag +12 AceView CDS 9000145 9000294 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; product_id A2ML1.dAug10; exon_number 4 +12 AceView exon 9000145 9000294 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; exon_number 4 +12 AceView intron 9000295 9001315 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; type gt_ag +12 AceView CDS 9001316 9001510 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; product_id A2ML1.dAug10; exon_number 5 +12 AceView exon 9001316 9001510 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; exon_number 5 +12 AceView intron 9001511 9002264 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; type gt_ag +12 AceView CDS 9002265 9002355 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; product_id A2ML1.dAug10; exon_number 6 +12 AceView exon 9002265 9002355 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; exon_number 6 +12 AceView intron 9002356 9002758 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; type gt_ag +12 AceView CDS 9002759 9002870 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; product_id A2ML1.dAug10; exon_number 7 +12 AceView exon 9002759 9002870 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; exon_number 7 +12 AceView intron 9002871 9004379 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; type gt_ag +12 AceView CDS 9004380 9004608 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; product_id A2ML1.dAug10; exon_number 8 +12 AceView exon 9004380 9004608 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; exon_number 8 +12 AceView intron 9004609 9004805 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; type gt_ag +12 AceView CDS 9004806 9004931 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; product_id A2ML1.dAug10; exon_number 9 +12 AceView exon 9004806 9004932 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.dAug10; exon_number 9 +12 AceView CDS 9020540 9020653 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; product_id A2ML1.eAug10; exon_number 1 +12 AceView exon 9020539 9020653 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; exon_number 1 +12 AceView intron 9020654 9020825 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; type gt_ag +12 AceView CDS 9020826 9020953 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; product_id A2ML1.eAug10; exon_number 2 +12 AceView exon 9020826 9020953 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; exon_number 2 +12 AceView intron 9020954 9021132 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; type gt_ag +12 AceView CDS 9021133 9021223 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; product_id A2ML1.eAug10; exon_number 3 +12 AceView exon 9021133 9021223 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; exon_number 3 +12 AceView intron 9021224 9021730 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; type gt_ag +12 AceView CDS 9021731 9021799 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; product_id A2ML1.eAug10; exon_number 4 +12 AceView exon 9021731 9021799 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; exon_number 4 +12 AceView intron 9021800 9027020 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; type gt_ag +12 AceView CDS 9027021 9027123 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; product_id A2ML1.eAug10; exon_number 5 +12 AceView exon 9027021 9027123 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; exon_number 5 +12 AceView intron 9027124 9027566 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; type gt_ag +12 AceView CDS 9027567 9027604 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; product_id A2ML1.eAug10; exon_number 6 +12 AceView exon 9027567 9027608 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; exon_number 6 +12 AceView stop_codon 9027605 9027607 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; product_id A2ML1.eAug10; +12 AceView intron 9027609 9033119 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; type gt_ag +12 AceView exon 9033120 9033212 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; exon_number 7 +12 AceView intron 9033213 9039102 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; type gt_ag +12 AceView exon 9039103 9039597 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.eAug10; exon_number 8 +12 AceView start_codon 8998062 8998064 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.fAug10; product_id A2ML1.fAug10; +12 AceView CDS 8998062 8998098 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.fAug10; product_id A2ML1.fAug10; exon_number 1 +12 AceView exon 8997879 8998098 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.fAug10; exon_number 1 +12 AceView intron 8998099 8998672 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.fAug10; type gt_ag +12 AceView CDS 8998673 8998818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.fAug10; product_id A2ML1.fAug10; exon_number 2 +12 AceView exon 8998673 8998818 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.fAug10; exon_number 2 +12 AceView intron 8998819 9000144 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.fAug10; type gt_ag +12 AceView CDS 9000145 9000294 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.fAug10; product_id A2ML1.fAug10; exon_number 3 +12 AceView exon 9000145 9000294 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.fAug10; exon_number 3 +12 AceView intron 9000295 9001315 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.fAug10; type gt_ag +12 AceView CDS 9001316 9001390 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.fAug10; product_id A2ML1.fAug10; exon_number 4 +12 AceView exon 9001316 9001391 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.fAug10; exon_number 4 +12 AceView CDS 8976253 8976564 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.gAug10-unspliced; product_id A2ML1.gAug10-unspliced; exon_number 1 +12 AceView exon 8976251 8976564 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.gAug10-unspliced; exon_number 1 +12 AceView start_codon 8997768 8997770 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.hAug10; product_id A2ML1.hAug10; +12 AceView CDS 8997768 8997902 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.hAug10; product_id A2ML1.hAug10; exon_number 1 +12 AceView exon 8997550 8997902 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.hAug10; exon_number 1 +12 AceView intron 8997903 8998037 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.hAug10; type gt_ag +12 AceView CDS 8998038 8998098 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.hAug10; product_id A2ML1.hAug10; exon_number 2 +12 AceView exon 8998038 8998098 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.hAug10; exon_number 2 +12 AceView intron 8998099 8998672 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.hAug10; type gt_ag +12 AceView CDS 8998673 8998719 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.hAug10; product_id A2ML1.hAug10; exon_number 3 +12 AceView exon 8998673 8998720 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.hAug10; exon_number 3 +12 AceView CDS 9009833 9009936 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.iAug10; product_id A2ML1.iAug10; exon_number 1 +12 AceView exon 9009831 9009936 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.iAug10; exon_number 1 +12 AceView intron 9009937 9010102 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.iAug10; type gt_ag +12 AceView CDS 9010103 9010205 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.iAug10; product_id A2ML1.iAug10; exon_number 2 +12 AceView exon 9010103 9010460 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.iAug10; exon_number 2 +12 AceView stop_codon 9010206 9010208 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.iAug10; product_id A2ML1.iAug10; +12 AceView exon 8976109 8976178 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.jAug10; exon_number 1 +12 AceView intron 8976179 8976315 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.jAug10; type gt_ag +12 AceView exon 8976316 8976478 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.jAug10; exon_number 2 +12 AceView intron 8976479 8982322 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.jAug10; type gt_ag +12 AceView exon 8982323 8982375 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.jAug10; exon_number 3 +12 AceView intron 8982376 8987257 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.jAug10; type gt_ag +12 AceView exon 8987258 8987566 . + 0 gene_id A2ML1; Gene_type cDNA_supported; transcript_id A2ML1.jAug10; exon_number 4 +12 AceView exon 9386731 9386803 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; exon_number 1 +12 AceView intron 9386289 9386730 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; type gt_ag +12 AceView start_codon 9386222 9386224 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; product_id A2MP1.aAug10; +12 AceView CDS 9385982 9386224 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; product_id A2MP1.aAug10; exon_number 2 +12 AceView exon 9385982 9386288 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; exon_number 2 +12 AceView intron 9385177 9385981 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; type gt_ag +12 AceView CDS 9384958 9385176 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; product_id A2MP1.aAug10; exon_number 3 +12 AceView exon 9384958 9385176 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; exon_number 3 +12 AceView intron 9384782 9384957 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; type gt_ag +12 AceView CDS 9384651 9384781 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; product_id A2MP1.aAug10; exon_number 4 +12 AceView exon 9384651 9384781 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; exon_number 4 +12 AceView intron 9384293 9384650 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; type gt_ag +12 AceView CDS 9384280 9384292 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; product_id A2MP1.aAug10; exon_number 5 +12 AceView exon 9384202 9384292 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; exon_number 5 +12 AceView stop_codon 9384277 9384279 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; product_id A2MP1.aAug10; +12 AceView intron 9383675 9384201 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; type gt_ag +12 AceView exon 9383639 9383674 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.aAug10; exon_number 6 +12 AceView exon 9411964 9412153 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; exon_number 1 +12 AceView intron 9409383 9411963 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; type gt_ag +12 AceView exon 9409240 9409382 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; exon_number 2 +12 AceView intron 9406351 9409239 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; type gt_ag +12 AceView exon 9406201 9406350 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; exon_number 3 +12 AceView intron 9400309 9406200 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; type gt_ag +12 AceView exon 9400252 9400308 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; exon_number 4 +12 AceView exon 9384651 9384709 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; exon_number 5 +12 AceView intron 9384293 9384650 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; type gt_ag +12 AceView exon 9384202 9384292 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; exon_number 6 +12 AceView intron 9383675 9384201 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; type gt_ag +12 AceView exon 9383606 9383674 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; exon_number 7 +12 AceView intron 9382952 9383605 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; type gt_ag +12 AceView exon 9382849 9382951 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; exon_number 8 +12 AceView intron 9382010 9382848 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; type gt_ag +12 AceView exon 9381968 9382009 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; exon_number 9 +12 AceView intron 9381295 9381967 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; type gt_ag +12 AceView exon 9381129 9381294 . - 0 gene_id A2MP1; Gene_type cDNA_supported; transcript_id A2MP1.bAug10; exon_number 10 +22 AceView exon 43117171 43117299 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.aAug10; exon_number 1 +22 AceView intron 43091638 43117170 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.aAug10; type gt_ag +22 AceView exon 43091497 43091637 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.aAug10; exon_number 2 +22 AceView intron 43090004 43091496 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.aAug10; type gt_ag +22 AceView start_codon 43089955 43089957 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.aAug10; product_id A4GALT.aAug10; +22 AceView CDS 43088899 43089957 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.aAug10; product_id A4GALT.aAug10; exon_number 3 +22 AceView exon 43088896 43090003 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.aAug10; exon_number 3 +22 AceView stop_codon 43088896 43088898 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.aAug10; product_id A4GALT.aAug10; +22 AceView exon 43117171 43117306 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.bAug10; exon_number 1 +22 AceView intron 43091638 43117170 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.bAug10; type gt_ag +22 AceView start_codon 43090709 43090711 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.bAug10; product_id A4GALT.b1Aug10; +22 AceView CDS 43090549 43090711 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.bAug10; product_id A4GALT.b1Aug10; exon_number 2 +22 AceView exon 43090549 43091637 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.bAug10; exon_number 2 +22 AceView intron 43090004 43090548 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.bAug10; type gt_ag +22 AceView CDS 43089849 43090003 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.bAug10; product_id A4GALT.b1Aug10; exon_number 3 +22 AceView exon 43088118 43090003 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.bAug10; exon_number 3 +22 AceView stop_codon 43089846 43089848 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.bAug10; product_id A4GALT.b1Aug10; +22 AceView exon 43116803 43116875 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.cAug10; exon_number 1 +22 AceView intron 43091638 43116802 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.cAug10; type gt_ag +22 AceView exon 43091497 43091637 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.cAug10; exon_number 2 +22 AceView intron 43090004 43091496 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.cAug10; type gt_ag +22 AceView start_codon 43089955 43089957 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.cAug10; product_id A4GALT.cAug10; +22 AceView CDS 43088899 43089957 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.cAug10; product_id A4GALT.cAug10; exon_number 3 +22 AceView exon 43088128 43090003 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.cAug10; exon_number 3 +22 AceView stop_codon 43088896 43088898 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.cAug10; product_id A4GALT.cAug10; +22 AceView CDS 43117171 43117248 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.dAug10; product_id A4GALT.dAug10; exon_number 1 +22 AceView exon 43117171 43117249 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.dAug10; exon_number 1 +22 AceView intron 43090004 43117170 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.dAug10; type gt_ag +22 AceView CDS 43089800 43090003 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.dAug10; product_id A4GALT.dAug10; exon_number 2 +22 AceView exon 43089188 43090003 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.dAug10; exon_number 2 +22 AceView stop_codon 43089797 43089799 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.dAug10; product_id A4GALT.dAug10; +22 AceView start_codon 43116872 43116874 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.eAug10; product_id A4GALT.eAug10; +22 AceView CDS 43116803 43116874 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.eAug10; product_id A4GALT.eAug10; exon_number 1 +22 AceView exon 43116803 43116875 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.eAug10; exon_number 1 +22 AceView intron 43090004 43116802 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.eAug10; type gt_ag +22 AceView CDS 43089800 43090003 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.eAug10; product_id A4GALT.eAug10; exon_number 2 +22 AceView exon 43089470 43090003 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.eAug10; exon_number 2 +22 AceView stop_codon 43089797 43089799 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.eAug10; product_id A4GALT.eAug10; +22 AceView start_codon 43117251 43117253 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.fAug10; product_id A4GALT.fAug10; +22 AceView CDS 43117171 43117253 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.fAug10; product_id A4GALT.fAug10; exon_number 1 +22 AceView exon 43117171 43117281 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.fAug10; exon_number 1 +22 AceView intron 43091638 43117170 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.fAug10; type gt_ag +22 AceView CDS 43091581 43091637 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.fAug10; product_id A4GALT.fAug10; exon_number 2 +22 AceView exon 43091581 43091637 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.fAug10; exon_number 2 +22 AceView intron 43090004 43091580 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.fAug10; type gt_ag +22 AceView CDS 43089973 43090003 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.fAug10; product_id A4GALT.fAug10; exon_number 3 +22 AceView exon 43089598 43090003 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.fAug10; exon_number 3 +22 AceView stop_codon 43089970 43089972 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.fAug10; product_id A4GALT.fAug10; +22 AceView exon 43116803 43116875 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.gAug10; exon_number 1 +22 AceView intron 43091638 43116802 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.gAug10; type gt_ag +22 AceView exon 43091152 43091637 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.gAug10; exon_number 2 +22 AceView intron 43090004 43091151 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.gAug10; type gt_ag +22 AceView exon 43089977 43090003 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.gAug10; exon_number 3 +22 AceView exon 43116803 43116875 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.hAug10; exon_number 1 +22 AceView intron 43091638 43116802 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.hAug10; type gt_ag +22 AceView exon 43091581 43091637 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.hAug10; exon_number 2 +22 AceView intron 43090004 43091580 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.hAug10; type gt_ag +22 AceView exon 43089551 43090003 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.hAug10; exon_number 3 +22 AceView exon 43116803 43116875 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.jAug10; exon_number 1 +22 AceView intron 43091638 43116802 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.jAug10; type gt_ag +22 AceView exon 43091497 43091637 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.jAug10; exon_number 2 +22 AceView intron 43089999 43091496 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.jAug10; type gt_ag +22 AceView exon 43089851 43089998 . - 0 gene_id A4GALT; Gene_type cDNA_supported; transcript_id A4GALT.jAug10; exon_number 3 +3 AceView exon 137851054 137851229 . - 0 gene_id A4GNT; Gene_type cDNA_supported; transcript_id A4GNT.aAug10; exon_number 1 +3 AceView intron 137850125 137851053 . - 0 gene_id A4GNT; Gene_type cDNA_supported; transcript_id A4GNT.aAug10; type gt_ag +3 AceView start_codon 137850096 137850098 . - 0 gene_id A4GNT; Gene_type cDNA_supported; transcript_id A4GNT.aAug10; product_id A4GNT.aAug10; +3 AceView CDS 137849691 137850098 . - 0 gene_id A4GNT; Gene_type cDNA_supported; transcript_id A4GNT.aAug10; product_id A4GNT.aAug10; exon_number 2 +3 AceView exon 137849691 137850124 . - 0 gene_id A4GNT; Gene_type cDNA_supported; transcript_id A4GNT.aAug10; exon_number 2 +3 AceView intron 137843721 137849690 . - 0 gene_id A4GNT; Gene_type cDNA_supported; transcript_id A4GNT.aAug10; type gt_ag +3 AceView CDS 137843109 137843720 . - 0 gene_id A4GNT; Gene_type cDNA_supported; transcript_id A4GNT.aAug10; product_id A4GNT.aAug10; exon_number 3 +3 AceView exon 137842560 137843720 . - 0 gene_id A4GNT; Gene_type cDNA_supported; transcript_id A4GNT.aAug10; exon_number 3 +3 AceView stop_codon 137843106 137843108 . - 0 gene_id A4GNT; Gene_type cDNA_supported; transcript_id A4GNT.aAug10; product_id A4GNT.aAug10; +7 AceView start_codon 34797708 34797710 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.aAug10; product_id AAA1.aAug10; +7 AceView CDS 34797686 34797710 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.aAug10; product_id AAA1.aAug10; exon_number 1 +7 AceView exon 34797686 34797884 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.aAug10; exon_number 1 +7 AceView intron 34768429 34797685 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.aAug10; type gt_ag +7 AceView CDS 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.aAug10; product_id AAA1.aAug10; exon_number 2 +7 AceView exon 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.aAug10; exon_number 2 +7 AceView intron 34609474 34768348 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.aAug10; type gt_ag +7 AceView CDS 34609387 34609473 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.aAug10; product_id AAA1.aAug10; exon_number 3 +7 AceView exon 34609324 34609473 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.aAug10; exon_number 3 +7 AceView stop_codon 34609384 34609386 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.aAug10; product_id AAA1.aAug10; +7 AceView intron 34607985 34609323 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.aAug10; type gt_ag +7 AceView exon 34607864 34607984 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.aAug10; exon_number 4 +7 AceView start_codon 34797708 34797710 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.bAug10; product_id AAA1.bAug10; +7 AceView CDS 34797686 34797710 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.bAug10; product_id AAA1.bAug10; exon_number 1 +7 AceView exon 34797686 34797884 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.bAug10; exon_number 1 +7 AceView intron 34768429 34797685 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.bAug10; type gt_ag +7 AceView CDS 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.bAug10; product_id AAA1.bAug10; exon_number 2 +7 AceView exon 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.bAug10; exon_number 2 +7 AceView intron 34457285 34768348 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.bAug10; type gt_ag +7 AceView CDS 34457201 34457284 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.bAug10; product_id AAA1.bAug10; exon_number 3 +7 AceView exon 34457191 34457284 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.bAug10; exon_number 3 +7 AceView stop_codon 34457198 34457200 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.bAug10; product_id AAA1.bAug10; +7 AceView intron 34390460 34457190 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.bAug10; type gt_ag +7 AceView exon 34386126 34390459 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.bAug10; exon_number 4 +7 AceView CDS 34800724 34800802 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.cAug10; product_id AAA1.cAug10; exon_number 1 +7 AceView exon 34800724 34800803 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.cAug10; exon_number 1 +7 AceView intron 34768429 34800723 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.cAug10; type gt_ag +7 AceView CDS 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.cAug10; product_id AAA1.cAug10; exon_number 2 +7 AceView exon 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.cAug10; exon_number 2 +7 AceView intron 34743812 34768348 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.cAug10; type gt_ag +7 AceView CDS 34743800 34743811 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.cAug10; product_id AAA1.cAug10; exon_number 3 +7 AceView exon 34743462 34743811 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.cAug10; exon_number 3 +7 AceView stop_codon 34743797 34743799 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.cAug10; product_id AAA1.cAug10; +7 AceView CDS 34800724 34800802 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.dAug10; product_id AAA1.dAug10; exon_number 1 +7 AceView exon 34800724 34800803 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.dAug10; exon_number 1 +7 AceView intron 34768429 34800723 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.dAug10; type gt_ag +7 AceView CDS 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.dAug10; product_id AAA1.dAug10; exon_number 2 +7 AceView exon 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.dAug10; exon_number 2 +7 AceView intron 34682964 34768348 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.dAug10; type gt_ag +7 AceView CDS 34682961 34682963 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.dAug10; product_id AAA1.dAug10; exon_number 3 +7 AceView exon 34682839 34682963 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.dAug10; exon_number 3 +7 AceView stop_codon 34682958 34682960 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.dAug10; product_id AAA1.dAug10; +7 AceView exon 34797686 34797884 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.eAug10; exon_number 1 +7 AceView intron 34768429 34797685 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.eAug10; type gt_ag +7 AceView exon 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.eAug10; exon_number 2 +7 AceView intron 34609474 34768348 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.eAug10; type gt_ag +7 AceView exon 34609324 34609473 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.eAug10; exon_number 3 +7 AceView intron 34457285 34609323 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.eAug10; type gt_ag +7 AceView exon 34457191 34457284 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.eAug10; exon_number 4 +7 AceView intron 34390460 34457190 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.eAug10; type gt_ag +7 AceView exon 34386126 34390459 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.eAug10; exon_number 5 +7 AceView exon 34873749 34873941 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.fAug10; exon_number 1 +7 AceView intron 34800804 34873748 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.fAug10; type gt_ag +7 AceView exon 34800724 34800803 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.fAug10; exon_number 2 +7 AceView intron 34768429 34800723 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.fAug10; type gt_ag +7 AceView exon 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.fAug10; exon_number 3 +7 AceView intron 34763008 34768348 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.fAug10; type gt_ag +7 AceView exon 34762896 34763007 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.fAug10; exon_number 4 +7 AceView intron 34760398 34762895 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.fAug10; type gt_ag +7 AceView exon 34760254 34760397 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.fAug10; exon_number 5 +7 AceView intron 34759421 34760253 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.fAug10; type Fuzzy_gt_ag +7 AceView exon 34758474 34759420 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.fAug10; exon_number 6 +7 AceView exon 34873773 34873948 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.gAug10; exon_number 1 +7 AceView intron 34800804 34873772 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.gAug10; type gt_ag +7 AceView exon 34800724 34800803 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.gAug10; exon_number 2 +7 AceView intron 34768429 34800723 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.gAug10; type gt_ag +7 AceView exon 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.gAug10; exon_number 3 +7 AceView intron 34763008 34768348 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.gAug10; type gt_ag +7 AceView exon 34762896 34763007 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.gAug10; exon_number 4 +7 AceView intron 34760398 34762895 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.gAug10; type gt_ag +7 AceView exon 34760254 34760397 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.gAug10; exon_number 5 +7 AceView intron 34759421 34760253 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.gAug10; type Fuzzy_gt_ag +7 AceView exon 34758479 34759420 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.gAug10; exon_number 6 +7 AceView exon 34873773 34873943 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.hAug10; exon_number 1 +7 AceView intron 34808053 34873772 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.hAug10; type gt_ag +7 AceView exon 34807954 34808052 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.hAug10; exon_number 2 +7 AceView intron 34768429 34807953 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.hAug10; type gt_ag +7 AceView exon 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.hAug10; exon_number 3 +7 AceView intron 34763008 34768348 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.hAug10; type gt_ag +7 AceView exon 34762896 34763007 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.hAug10; exon_number 4 +7 AceView intron 34759421 34762895 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.hAug10; type gt_ag +7 AceView exon 34758474 34759420 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.hAug10; exon_number 5 +7 AceView exon 34800724 34800803 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.iAug10; exon_number 1 +7 AceView intron 34768429 34800723 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.iAug10; type gt_ag +7 AceView exon 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.iAug10; exon_number 2 +7 AceView intron 34609474 34768348 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.iAug10; type gt_ag +7 AceView exon 34609324 34609473 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.iAug10; exon_number 3 +7 AceView intron 34457285 34609323 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.iAug10; type gt_ag +7 AceView exon 34457191 34457284 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.iAug10; exon_number 4 +7 AceView intron 34390460 34457190 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.iAug10; type gt_ag +7 AceView exon 34390034 34390459 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.iAug10; exon_number 5 +7 AceView exon 34797686 34797884 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.jAug10; exon_number 1 +7 AceView intron 34768429 34797685 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.jAug10; type gt_ag +7 AceView exon 34768349 34768428 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.jAug10; exon_number 2 +7 AceView intron 34743812 34768348 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.jAug10; type gt_ag +7 AceView exon 34743692 34743811 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.jAug10; exon_number 3 +7 AceView intron 34609474 34743691 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.jAug10; type gt_ag +7 AceView exon 34609324 34609473 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.jAug10; exon_number 4 +7 AceView intron 34606764 34609323 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.jAug10; type gt_ag +7 AceView exon 34606693 34606763 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.jAug10; exon_number 5 +7 AceView intron 34606425 34606692 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.jAug10; type gt_ag +7 AceView exon 34606334 34606424 . - 0 gene_id AAA1; Gene_type cDNA_supported; transcript_id AAA1.jAug10; exon_number 6 +12 AceView start_codon 53715247 53715249 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; +12 AceView CDS 53715127 53715249 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 1 +12 AceView exon 53715127 53715412 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 1 +12 AceView intron 53714477 53715126 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 2 +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 3 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 4 +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 4 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 5 +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 5 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 6 +12 AceView exon 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 6 +12 AceView intron 53708226 53708534 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 7 +12 AceView exon 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 7 +12 AceView intron 53703506 53708081 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 8 +12 AceView exon 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 8 +12 AceView intron 53703066 53703384 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 9 +12 AceView exon 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 9 +12 AceView intron 53702805 53702940 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 10 +12 AceView exon 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 10 +12 AceView intron 53702600 53702743 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 11 +12 AceView exon 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 11 +12 AceView intron 53702313 53702508 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 12 +12 AceView exon 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 12 +12 AceView intron 53702134 53702218 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 13 +12 AceView exon 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 13 +12 AceView intron 53701918 53702065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 14 +12 AceView exon 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 14 +12 AceView intron 53701714 53701835 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53701629 53701713 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 15 +12 AceView exon 53701629 53701713 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 15 +12 AceView intron 53701498 53701628 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; type gt_ag +12 AceView CDS 53701276 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; exon_number 16 +12 AceView exon 53701240 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; exon_number 16 +12 AceView stop_codon 53701273 53701275 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.aAug10; product_id AAAS.aAug10; +12 AceView CDS 53715661 53715780 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 1 +12 AceView exon 53715661 53715781 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 1 +12 AceView intron 53714477 53715660 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 2 +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 3 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 4 +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 4 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 5 +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 5 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 6 +12 AceView exon 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 6 +12 AceView intron 53708226 53708534 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 7 +12 AceView exon 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 7 +12 AceView intron 53703506 53708081 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 8 +12 AceView exon 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 8 +12 AceView intron 53703066 53703384 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 9 +12 AceView exon 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 9 +12 AceView intron 53702805 53702940 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 10 +12 AceView exon 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 10 +12 AceView intron 53702600 53702743 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 11 +12 AceView exon 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 11 +12 AceView intron 53702313 53702508 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 12 +12 AceView exon 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 12 +12 AceView intron 53702134 53702218 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 13 +12 AceView exon 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 13 +12 AceView intron 53701918 53702065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 14 +12 AceView exon 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 14 +12 AceView intron 53701498 53701835 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; type gt_ag +12 AceView CDS 53701266 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; exon_number 15 +12 AceView exon 53701240 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; exon_number 15 +12 AceView stop_codon 53701263 53701265 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.bAug10; product_id AAAS.bAug10; +12 AceView start_codon 53715247 53715249 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; +12 AceView CDS 53715127 53715249 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 1 +12 AceView exon 53715127 53715416 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 1 +12 AceView intron 53714477 53715126 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 2 +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 3 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 4 +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 4 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 5 +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 5 +12 AceView intron 53708226 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 6 +12 AceView exon 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 6 +12 AceView intron 53703506 53708081 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 7 +12 AceView exon 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 7 +12 AceView intron 53703066 53703384 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 8 +12 AceView exon 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 8 +12 AceView intron 53702805 53702940 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 9 +12 AceView exon 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 9 +12 AceView intron 53702600 53702743 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 10 +12 AceView exon 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 10 +12 AceView intron 53702313 53702508 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 11 +12 AceView exon 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 11 +12 AceView intron 53702134 53702218 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 12 +12 AceView exon 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 12 +12 AceView intron 53701918 53702065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 13 +12 AceView exon 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 13 +12 AceView intron 53701714 53701835 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53701629 53701713 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 14 +12 AceView exon 53701629 53701713 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 14 +12 AceView intron 53701498 53701628 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; type gt_ag +12 AceView CDS 53701276 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; exon_number 15 +12 AceView exon 53701240 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; exon_number 15 +12 AceView stop_codon 53701273 53701275 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.cAug10; product_id AAAS.cAug10; +12 AceView exon 53715255 53715369 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 1 +12 AceView intron 53714477 53715254 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gc_ag +12 AceView start_codon 53714444 53714446 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; +12 AceView CDS 53714349 53714446 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 2 +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 3 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 4 +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 4 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 5 +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 5 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 6 +12 AceView exon 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 6 +12 AceView intron 53708226 53708534 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 7 +12 AceView exon 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 7 +12 AceView intron 53703506 53708081 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 8 +12 AceView exon 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 8 +12 AceView intron 53703066 53703384 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 9 +12 AceView exon 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 9 +12 AceView intron 53702805 53702940 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 10 +12 AceView exon 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 10 +12 AceView intron 53702600 53702743 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 11 +12 AceView exon 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 11 +12 AceView intron 53702313 53702508 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 12 +12 AceView exon 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 12 +12 AceView intron 53702134 53702218 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 13 +12 AceView exon 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 13 +12 AceView intron 53701918 53702065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 14 +12 AceView exon 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 14 +12 AceView intron 53701498 53701835 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; type gt_ag +12 AceView CDS 53701266 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; exon_number 15 +12 AceView exon 53701240 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; exon_number 15 +12 AceView stop_codon 53701263 53701265 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.dAug10; product_id AAAS.dAug10; +12 AceView start_codon 53708979 53708981 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; +12 AceView CDS 53708878 53708981 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; exon_number 1 +12 AceView exon 53708878 53709028 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; exon_number 1 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; type gt_ag +12 AceView CDS 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; exon_number 2 +12 AceView exon 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; exon_number 2 +12 AceView intron 53708226 53708534 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; type gt_ag +12 AceView CDS 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; exon_number 3 +12 AceView exon 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; exon_number 3 +12 AceView intron 53703506 53708081 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; type gt_ag +12 AceView CDS 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; exon_number 4 +12 AceView exon 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; exon_number 4 +12 AceView intron 53703066 53703384 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; type gt_ag +12 AceView CDS 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; exon_number 5 +12 AceView exon 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; exon_number 5 +12 AceView intron 53702805 53702940 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; type gt_ag +12 AceView CDS 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; exon_number 6 +12 AceView exon 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; exon_number 6 +12 AceView intron 53702600 53702743 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; type gt_ag +12 AceView CDS 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; exon_number 7 +12 AceView exon 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; exon_number 7 +12 AceView intron 53702313 53702508 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; type gt_ag +12 AceView CDS 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; exon_number 8 +12 AceView exon 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; exon_number 8 +12 AceView intron 53702134 53702218 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; type gt_ag +12 AceView CDS 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; exon_number 9 +12 AceView exon 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; exon_number 9 +12 AceView intron 53701918 53702065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; type gt_ag +12 AceView CDS 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; exon_number 10 +12 AceView exon 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; exon_number 10 +12 AceView intron 53701701 53701835 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; type gt_ag +12 AceView CDS 53701629 53701700 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; exon_number 11 +12 AceView exon 53701629 53701700 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; exon_number 11 +12 AceView intron 53701498 53701628 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; type gt_ag +12 AceView CDS 53701266 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; exon_number 12 +12 AceView exon 53701241 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; exon_number 12 +12 AceView stop_codon 53701263 53701265 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.eAug10; product_id AAAS.eAug10; +12 AceView exon 53718346 53718496 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 1 +12 AceView intron 53714477 53718345 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 4 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 5 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView start_codon 53708183 53708185 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; product_id AAAS.fAug10; +12 AceView CDS 53708082 53708185 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; product_id AAAS.fAug10; exon_number 6 +12 AceView exon 53708082 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 6 +12 AceView intron 53703506 53708081 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView CDS 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; product_id AAAS.fAug10; exon_number 7 +12 AceView exon 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 7 +12 AceView intron 53703066 53703384 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView CDS 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; product_id AAAS.fAug10; exon_number 8 +12 AceView exon 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 8 +12 AceView intron 53702805 53702940 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView CDS 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; product_id AAAS.fAug10; exon_number 9 +12 AceView exon 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 9 +12 AceView intron 53702600 53702743 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView CDS 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; product_id AAAS.fAug10; exon_number 10 +12 AceView exon 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 10 +12 AceView intron 53702313 53702508 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView CDS 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; product_id AAAS.fAug10; exon_number 11 +12 AceView exon 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 11 +12 AceView intron 53702134 53702218 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView CDS 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; product_id AAAS.fAug10; exon_number 12 +12 AceView exon 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 12 +12 AceView intron 53701918 53702065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView CDS 53701835 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; product_id AAAS.fAug10; exon_number 13 +12 AceView exon 53701629 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 13 +12 AceView stop_codon 53701832 53701834 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; product_id AAAS.fAug10; +12 AceView intron 53701498 53701628 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; type gt_ag +12 AceView exon 53701241 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.fAug10; exon_number 14 +12 AceView exon 53714349 53715363 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 1 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 2 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 3 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 4 +12 AceView intron 53708226 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView exon 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 5 +12 AceView intron 53703506 53708081 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView exon 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 6 +12 AceView intron 53703066 53703384 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView exon 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 7 +12 AceView intron 53702805 53702940 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView start_codon 53702786 53702788 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; product_id AAAS.gAug10; +12 AceView CDS 53702744 53702788 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; product_id AAAS.gAug10; exon_number 8 +12 AceView exon 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 8 +12 AceView intron 53702600 53702743 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView CDS 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; product_id AAAS.gAug10; exon_number 9 +12 AceView exon 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 9 +12 AceView intron 53702313 53702508 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView CDS 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; product_id AAAS.gAug10; exon_number 10 +12 AceView exon 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 10 +12 AceView intron 53702134 53702218 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView CDS 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; product_id AAAS.gAug10; exon_number 11 +12 AceView exon 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 11 +12 AceView intron 53701918 53702065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView CDS 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; product_id AAAS.gAug10; exon_number 12 +12 AceView exon 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 12 +12 AceView intron 53701714 53701835 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView CDS 53701629 53701713 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; product_id AAAS.gAug10; exon_number 13 +12 AceView exon 53701629 53701713 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 13 +12 AceView intron 53701498 53701628 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; type gt_ag +12 AceView CDS 53701276 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; product_id AAAS.gAug10; exon_number 14 +12 AceView exon 53701241 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; exon_number 14 +12 AceView stop_codon 53701273 53701275 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.gAug10; product_id AAAS.gAug10; +12 AceView exon 53715255 53715399 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 1 +12 AceView intron 53714477 53715254 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gc_ag +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 4 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 5 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView exon 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 6 +12 AceView intron 53708226 53708534 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView exon 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 7 +12 AceView intron 53703506 53708081 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView exon 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 8 +12 AceView intron 53703066 53703384 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView exon 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 9 +12 AceView intron 53702805 53702940 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView start_codon 53702786 53702788 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; product_id AAAS.hAug10; +12 AceView CDS 53702744 53702788 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; product_id AAAS.hAug10; exon_number 10 +12 AceView exon 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 10 +12 AceView intron 53702600 53702743 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView CDS 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; product_id AAAS.hAug10; exon_number 11 +12 AceView exon 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 11 +12 AceView intron 53702313 53702508 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView CDS 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; product_id AAAS.hAug10; exon_number 12 +12 AceView exon 53702219 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 12 +12 AceView intron 53702134 53702218 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView CDS 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; product_id AAAS.hAug10; exon_number 13 +12 AceView exon 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 13 +12 AceView intron 53701918 53702065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView CDS 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; product_id AAAS.hAug10; exon_number 14 +12 AceView exon 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 14 +12 AceView intron 53701714 53701835 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView CDS 53701629 53701713 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; product_id AAAS.hAug10; exon_number 15 +12 AceView exon 53701629 53701713 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 15 +12 AceView intron 53701498 53701628 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; type gt_ag +12 AceView CDS 53701306 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; product_id AAAS.hAug10; exon_number 16 +12 AceView exon 53701304 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.hAug10; exon_number 16 +12 AceView exon 53715661 53715767 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; exon_number 1 +12 AceView intron 53714477 53715660 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; type gt_ag +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; type gt_ag +12 AceView start_codon 53709535 53709537 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; product_id AAAS.iAug10; +12 AceView CDS 53709511 53709537 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; product_id AAAS.iAug10; exon_number 3 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; exon_number 3 +12 AceView intron 53708925 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; type gt_ag +12 AceView CDS 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; product_id AAAS.iAug10; exon_number 4 +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; exon_number 4 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; type gt_ag +12 AceView CDS 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; product_id AAAS.iAug10; exon_number 5 +12 AceView exon 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; exon_number 5 +12 AceView intron 53708226 53708534 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; type gt_ag +12 AceView CDS 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; product_id AAAS.iAug10; exon_number 6 +12 AceView exon 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; exon_number 6 +12 AceView intron 53703506 53708081 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; type gt_ag +12 AceView CDS 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; product_id AAAS.iAug10; exon_number 7 +12 AceView exon 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; exon_number 7 +12 AceView intron 53703066 53703384 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; type gt_ag +12 AceView CDS 53702943 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; product_id AAAS.iAug10; exon_number 8 +12 AceView exon 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.iAug10; exon_number 8 +12 AceView start_codon 53701824 53701826 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.jAug10-unspliced; product_id AAAS.jAug10-unspliced; +12 AceView CDS 53701266 53701826 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.jAug10-unspliced; product_id AAAS.jAug10-unspliced; exon_number 1 +12 AceView exon 53701241 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.jAug10-unspliced; exon_number 1 +12 AceView stop_codon 53701263 53701265 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.jAug10-unspliced; product_id AAAS.jAug10-unspliced; +12 AceView start_codon 53715018 53715020 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; product_id AAAS.kAug10; +12 AceView CDS 53714985 53715020 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; product_id AAAS.kAug10; exon_number 1 +12 AceView exon 53714985 53715028 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; exon_number 1 +12 AceView intron 53714477 53714984 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; type gc_ag +12 AceView CDS 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; product_id AAAS.kAug10; exon_number 2 +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; type gt_ag +12 AceView CDS 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; product_id AAAS.kAug10; exon_number 3 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; type gt_ag +12 AceView CDS 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; product_id AAAS.kAug10; exon_number 4 +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; exon_number 4 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; type gt_ag +12 AceView CDS 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; product_id AAAS.kAug10; exon_number 5 +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; exon_number 5 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; type gt_ag +12 AceView CDS 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; product_id AAAS.kAug10; exon_number 6 +12 AceView exon 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; exon_number 6 +12 AceView intron 53708226 53708534 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; type gt_ag +12 AceView CDS 53708132 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; product_id AAAS.kAug10; exon_number 7 +12 AceView exon 53708131 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.kAug10; exon_number 7 +12 AceView start_codon 53715247 53715249 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; product_id AAAS.lAug10; +12 AceView CDS 53715127 53715249 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; product_id AAAS.lAug10; exon_number 1 +12 AceView exon 53715127 53715402 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; exon_number 1 +12 AceView intron 53714477 53715126 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; type gt_ag +12 AceView CDS 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; product_id AAAS.lAug10; exon_number 2 +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; type gt_ag +12 AceView CDS 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; product_id AAAS.lAug10; exon_number 3 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; type gt_ag +12 AceView CDS 53708981 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; product_id AAAS.lAug10; exon_number 4 +12 AceView exon 53708634 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; exon_number 4 +12 AceView stop_codon 53708978 53708980 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.lAug10; product_id AAAS.lAug10; +12 AceView CDS 53714955 53714984 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; product_id AAAS.mAug10; exon_number 1 +12 AceView exon 53714955 53714984 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; exon_number 1 +12 AceView intron 53714477 53714954 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; type gt_ag +12 AceView CDS 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; product_id AAAS.mAug10; exon_number 2 +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; type gt_ag +12 AceView CDS 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; product_id AAAS.mAug10; exon_number 3 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; type gt_ag +12 AceView CDS 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; product_id AAAS.mAug10; exon_number 4 +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; exon_number 4 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; type gt_ag +12 AceView CDS 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; product_id AAAS.mAug10; exon_number 5 +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; exon_number 5 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; type gt_ag +12 AceView CDS 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; product_id AAAS.mAug10; exon_number 6 +12 AceView exon 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; exon_number 6 +12 AceView intron 53708226 53708534 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; type gt_ag +12 AceView CDS 53708144 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; product_id AAAS.mAug10; exon_number 7 +12 AceView exon 53708143 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.mAug10; exon_number 7 +12 AceView CDS 53715127 53715324 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; product_id AAAS.nAug10; exon_number 1 +12 AceView exon 53715127 53715324 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; exon_number 1 +12 AceView intron 53714477 53715126 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; type gt_ag +12 AceView CDS 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; product_id AAAS.nAug10; exon_number 2 +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; type gt_ag +12 AceView CDS 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; product_id AAAS.nAug10; exon_number 3 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; type gt_ag +12 AceView CDS 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; product_id AAAS.nAug10; exon_number 4 +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; exon_number 4 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; type gt_ag +12 AceView CDS 53708877 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; product_id AAAS.nAug10; exon_number 5 +12 AceView exon 53708248 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; exon_number 5 +12 AceView stop_codon 53708874 53708876 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.nAug10; product_id AAAS.nAug10; +12 AceView exon 53715255 53715351 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; exon_number 1 +12 AceView intron 53714477 53715254 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; type gc_ag +12 AceView start_codon 53714444 53714446 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; product_id AAAS.oAug10; +12 AceView CDS 53714349 53714446 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; product_id AAAS.oAug10; exon_number 2 +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; type gt_ag +12 AceView CDS 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; product_id AAAS.oAug10; exon_number 3 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; type gt_ag +12 AceView CDS 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; product_id AAAS.oAug10; exon_number 4 +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; exon_number 4 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; type gt_ag +12 AceView CDS 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; product_id AAAS.oAug10; exon_number 5 +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; exon_number 5 +12 AceView intron 53708226 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; type gt_ag +12 AceView CDS 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; product_id AAAS.oAug10; exon_number 6 +12 AceView exon 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; exon_number 6 +12 AceView intron 53703506 53708081 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; type gt_ag +12 AceView CDS 53703424 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; product_id AAAS.oAug10; exon_number 7 +12 AceView exon 53703423 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.oAug10; exon_number 7 +12 AceView exon 53715127 53715363 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; exon_number 1 +12 AceView intron 53714477 53715126 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; type gt_ag +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; type gt_ag +12 AceView start_codon 53709535 53709537 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; product_id AAAS.pAug10; +12 AceView CDS 53709511 53709537 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; product_id AAAS.pAug10; exon_number 3 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; exon_number 3 +12 AceView intron 53708925 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; type gt_ag +12 AceView CDS 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; product_id AAAS.pAug10; exon_number 4 +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; exon_number 4 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; type gt_ag +12 AceView CDS 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; product_id AAAS.pAug10; exon_number 5 +12 AceView exon 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; exon_number 5 +12 AceView intron 53708226 53708534 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; type gt_ag +12 AceView CDS 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; product_id AAAS.pAug10; exon_number 6 +12 AceView exon 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; exon_number 6 +12 AceView intron 53703506 53708081 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; type gt_ag +12 AceView CDS 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; product_id AAAS.pAug10; exon_number 7 +12 AceView exon 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; exon_number 7 +12 AceView intron 53703066 53703384 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; type gt_ag +12 AceView CDS 53703009 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; product_id AAAS.pAug10; exon_number 8 +12 AceView exon 53703008 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.pAug10; exon_number 8 +12 AceView start_codon 53714444 53714446 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; product_id AAAS.qAug10; +12 AceView CDS 53714349 53714446 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; product_id AAAS.qAug10; exon_number 1 +12 AceView exon 53714349 53714810 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; exon_number 1 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; type gt_ag +12 AceView CDS 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; product_id AAAS.qAug10; exon_number 2 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; exon_number 2 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; type gt_ag +12 AceView CDS 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; product_id AAAS.qAug10; exon_number 3 +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; exon_number 3 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; type gt_ag +12 AceView CDS 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; product_id AAAS.qAug10; exon_number 4 +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; exon_number 4 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; type gt_ag +12 AceView CDS 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; product_id AAAS.qAug10; exon_number 5 +12 AceView exon 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; exon_number 5 +12 AceView intron 53708226 53708534 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; type gt_ag +12 AceView CDS 53708147 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; product_id AAAS.qAug10; exon_number 6 +12 AceView exon 53708145 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.qAug10; exon_number 6 +12 AceView start_codon 53715247 53715249 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.rAug10; product_id AAAS.rAug10; +12 AceView CDS 53715127 53715249 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.rAug10; product_id AAAS.rAug10; exon_number 1 +12 AceView exon 53715127 53715343 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.rAug10; exon_number 1 +12 AceView intron 53714477 53715126 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.rAug10; type gt_ag +12 AceView CDS 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.rAug10; product_id AAAS.rAug10; exon_number 2 +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.rAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.rAug10; type gt_ag +12 AceView CDS 53709416 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.rAug10; product_id AAAS.rAug10; exon_number 3 +12 AceView exon 53709336 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.rAug10; exon_number 3 +12 AceView stop_codon 53709413 53709415 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.rAug10; product_id AAAS.rAug10; +12 AceView start_codon 53703552 53703554 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.sAug10; product_id AAAS.sAug10; +12 AceView CDS 53703385 53703554 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.sAug10; product_id AAAS.sAug10; exon_number 1 +12 AceView exon 53703385 53703768 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.sAug10; exon_number 1 +12 AceView intron 53703066 53703384 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.sAug10; type gt_ag +12 AceView CDS 53703008 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.sAug10; product_id AAAS.sAug10; exon_number 2 +12 AceView exon 53702746 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.sAug10; exon_number 2 +12 AceView stop_codon 53703005 53703007 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.sAug10; product_id AAAS.sAug10; +12 AceView exon 53715236 53715369 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.tAug10; exon_number 1 +12 AceView intron 53714477 53715235 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.tAug10; type gt_ag +12 AceView start_codon 53714444 53714446 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.tAug10; product_id AAAS.tAug10; +12 AceView CDS 53714349 53714446 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.tAug10; product_id AAAS.tAug10; exon_number 2 +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.tAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.tAug10; type gt_ag +12 AceView CDS 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.tAug10; product_id AAAS.tAug10; exon_number 3 +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.tAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.tAug10; type gt_ag +12 AceView CDS 53709167 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.tAug10; product_id AAAS.tAug10; exon_number 4 +12 AceView exon 53709165 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.tAug10; exon_number 4 +12 AceView exon 53718476 53718648 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 1 +12 AceView intron 53714477 53718475 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 3 +12 AceView intron 53709211 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView exon 53709119 53709210 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 4 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 5 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView exon 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 6 +12 AceView intron 53708226 53708534 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView exon 53708082 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 7 +12 AceView intron 53703506 53708081 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView exon 53703385 53703505 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 8 +12 AceView intron 53703066 53703384 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView exon 53702941 53703065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 9 +12 AceView intron 53702805 53702940 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView exon 53702744 53702804 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 10 +12 AceView intron 53702600 53702743 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView exon 53702509 53702599 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 11 +12 AceView intron 53702313 53702508 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView exon 53702229 53702312 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 12 +12 AceView intron 53702134 53702228 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView start_codon 53702109 53702111 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; product_id AAAS.uAug10; +12 AceView CDS 53702066 53702111 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; product_id AAAS.uAug10; exon_number 13 +12 AceView exon 53702066 53702133 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 13 +12 AceView intron 53701918 53702065 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView CDS 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; product_id AAAS.uAug10; exon_number 14 +12 AceView exon 53701836 53701917 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 14 +12 AceView intron 53701714 53701835 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView CDS 53701629 53701713 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; product_id AAAS.uAug10; exon_number 15 +12 AceView exon 53701629 53701713 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 15 +12 AceView intron 53701498 53701628 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; type gt_ag +12 AceView CDS 53701276 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; product_id AAAS.uAug10; exon_number 16 +12 AceView exon 53701245 53701497 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; exon_number 16 +12 AceView stop_codon 53701273 53701275 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.uAug10; product_id AAAS.uAug10; +12 AceView exon 53715255 53715393 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vaAug10; exon_number 1 +12 AceView intron 53714477 53715254 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vaAug10; type gc_ag +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vaAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vaAug10; type gt_ag +12 AceView exon 53708738 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vaAug10; exon_number 3 +12 AceView exon 53714985 53715042 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; exon_number 1 +12 AceView intron 53714477 53714984 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; type gc_ag +12 AceView exon 53714349 53714476 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; exon_number 2 +12 AceView intron 53709567 53714348 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; type gt_ag +12 AceView exon 53709511 53709566 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; exon_number 3 +12 AceView intron 53709271 53709510 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; type gt_ag +12 AceView exon 53709119 53709270 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; exon_number 4 +12 AceView intron 53708925 53709118 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; type gt_ag +12 AceView exon 53708878 53708924 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; exon_number 5 +12 AceView intron 53708634 53708877 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; type gt_ag +12 AceView exon 53708535 53708633 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; exon_number 6 +12 AceView intron 53708226 53708534 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; type gt_ag +12 AceView exon 53708184 53708225 . - 0 gene_id AAAS; Gene_type cDNA_supported; transcript_id AAAS.vbAug10; exon_number 7 +12 AceView start_codon 125550131 125550133 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; +12 AceView CDS 125550131 125550263 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 1 +12 AceView exon 125549918 125550263 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 1 +12 AceView intron 125550264 125558421 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125558422 125558525 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 2 +12 AceView exon 125558422 125558525 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 2 +12 AceView intron 125558526 125561036 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125561037 125561157 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 3 +12 AceView exon 125561037 125561157 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 3 +12 AceView intron 125561158 125570875 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125570876 125570989 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 4 +12 AceView exon 125570876 125570989 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 4 +12 AceView intron 125570990 125575971 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125575972 125576069 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 5 +12 AceView exon 125575972 125576069 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 5 +12 AceView intron 125576070 125587224 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125587225 125587339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 6 +12 AceView exon 125587225 125587339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 6 +12 AceView intron 125587340 125587545 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125587546 125587627 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 7 +12 AceView exon 125587546 125587627 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 7 +12 AceView intron 125587628 125591666 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125591667 125591814 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 8 +12 AceView exon 125591667 125591814 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 8 +12 AceView intron 125591815 125599022 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125599023 125599103 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 9 +12 AceView exon 125599023 125599103 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 9 +12 AceView intron 125599104 125603186 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125603187 125603311 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 10 +12 AceView exon 125603187 125603311 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 10 +12 AceView intron 125603312 125609250 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125609251 125609315 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 11 +12 AceView exon 125609251 125609315 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 11 +12 AceView intron 125609316 125609447 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125609448 125609570 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 12 +12 AceView exon 125609448 125609570 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 12 +12 AceView intron 125609571 125612706 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125612707 125612820 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 13 +12 AceView exon 125612707 125612820 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 13 +12 AceView intron 125612821 125613880 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125613881 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 14 +12 AceView exon 125613881 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 14 +12 AceView intron 125614007 125618548 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 15 +12 AceView exon 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 15 +12 AceView intron 125618619 125619339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 16 +12 AceView exon 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 16 +12 AceView intron 125619399 125621207 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125621208 125621410 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 17 +12 AceView exon 125621208 125621410 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 17 +12 AceView intron 125621411 125626637 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; type gt_ag +12 AceView CDS 125626638 125626772 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; exon_number 18 +12 AceView exon 125626638 125627871 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; exon_number 18 +12 AceView stop_codon 125626773 125626775 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.aAug10; product_id AACS.aAug10; +12 AceView CDS 125549930 125550263 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 1 +12 AceView exon 125549930 125550263 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 1 +12 AceView intron 125550264 125558421 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125558422 125558525 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 2 +12 AceView exon 125558422 125558525 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 2 +12 AceView intron 125558526 125561036 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125561037 125561157 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 3 +12 AceView exon 125561037 125561157 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 3 +12 AceView intron 125561158 125570875 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125570876 125570989 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 4 +12 AceView exon 125570876 125570989 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 4 +12 AceView intron 125570990 125575971 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125575972 125576069 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 5 +12 AceView exon 125575972 125576069 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 5 +12 AceView intron 125576070 125587224 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125587225 125587339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 6 +12 AceView exon 125587225 125587339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 6 +12 AceView intron 125587340 125587545 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125587546 125587627 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 7 +12 AceView exon 125587546 125587627 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 7 +12 AceView intron 125587628 125591666 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125591667 125591814 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 8 +12 AceView exon 125591667 125591814 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 8 +12 AceView intron 125591815 125599022 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125599023 125599103 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 9 +12 AceView exon 125599023 125599103 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 9 +12 AceView intron 125599104 125603186 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125603187 125603311 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 10 +12 AceView exon 125603187 125603311 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 10 +12 AceView intron 125603312 125609250 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125609251 125609315 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 11 +12 AceView exon 125609251 125609315 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 11 +12 AceView intron 125609316 125609447 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125609448 125609570 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 12 +12 AceView exon 125609448 125609570 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 12 +12 AceView intron 125609571 125612706 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125612707 125612820 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 13 +12 AceView exon 125612707 125612820 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 13 +12 AceView intron 125612821 125613880 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125613881 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 14 +12 AceView exon 125613881 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 14 +12 AceView intron 125614007 125618548 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 15 +12 AceView exon 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 15 +12 AceView intron 125618619 125619339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 16 +12 AceView exon 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 16 +12 AceView intron 125619399 125626637 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; type gt_ag +12 AceView CDS 125626638 125626756 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; exon_number 17 +12 AceView exon 125626638 125627860 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; exon_number 17 +12 AceView stop_codon 125626757 125626759 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.bAug10; product_id AACS.bAug10; +12 AceView CDS 125561043 125561157 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; product_id AACS.cAug10; exon_number 1 +12 AceView exon 125561042 125561157 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; exon_number 1 +12 AceView intron 125561158 125570875 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; type gt_ag +12 AceView CDS 125570876 125570989 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; product_id AACS.cAug10; exon_number 2 +12 AceView exon 125570876 125570989 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; exon_number 2 +12 AceView intron 125570990 125575971 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; type gt_ag +12 AceView CDS 125575972 125576069 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; product_id AACS.cAug10; exon_number 3 +12 AceView exon 125575972 125576069 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; exon_number 3 +12 AceView intron 125576070 125587224 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; type gt_ag +12 AceView CDS 125587225 125587339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; product_id AACS.cAug10; exon_number 4 +12 AceView exon 125587225 125587339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; exon_number 4 +12 AceView intron 125587340 125587545 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; type gt_ag +12 AceView CDS 125587546 125587627 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; product_id AACS.cAug10; exon_number 5 +12 AceView exon 125587546 125587627 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; exon_number 5 +12 AceView intron 125587628 125591666 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; type gt_ag +12 AceView CDS 125591667 125591814 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; product_id AACS.cAug10; exon_number 6 +12 AceView exon 125591667 125591814 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; exon_number 6 +12 AceView intron 125591815 125599022 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; type gt_ag +12 AceView CDS 125599023 125599103 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; product_id AACS.cAug10; exon_number 7 +12 AceView exon 125599023 125599103 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; exon_number 7 +12 AceView intron 125599104 125603186 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; type gt_ag +12 AceView CDS 125603187 125603311 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; product_id AACS.cAug10; exon_number 8 +12 AceView exon 125603187 125603311 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; exon_number 8 +12 AceView intron 125603312 125618548 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; type gt_ag +12 AceView CDS 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; product_id AACS.cAug10; exon_number 9 +12 AceView exon 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; exon_number 9 +12 AceView intron 125618619 125619339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; type gt_ag +12 AceView exon 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; exon_number 10 +12 AceView stop_codon 125619340 125619342 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; product_id AACS.cAug10; +12 AceView intron 125619399 125621207 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; type gt_ag +12 AceView exon 125621208 125621410 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; exon_number 11 +12 AceView intron 125621411 125626637 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; type gt_ag +12 AceView exon 125626638 125627861 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.cAug10; exon_number 12 +12 AceView exon 125589685 125590340 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; exon_number 1 +12 AceView intron 125590341 125591666 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; type gt_ag +12 AceView exon 125591667 125591814 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; exon_number 2 +12 AceView intron 125591815 125599022 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; type gt_ag +12 AceView exon 125599023 125599103 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; exon_number 3 +12 AceView intron 125599104 125603186 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; type gt_ag +12 AceView exon 125603187 125603311 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; exon_number 4 +12 AceView intron 125603312 125609250 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; type gt_ag +12 AceView start_codon 125609468 125609470 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; product_id AACS.dAug10; +12 AceView CDS 125609468 125609570 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; product_id AACS.dAug10; exon_number 5 +12 AceView exon 125609251 125609570 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; exon_number 5 +12 AceView intron 125609571 125612706 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; type gt_ag +12 AceView CDS 125612707 125612820 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; product_id AACS.dAug10; exon_number 6 +12 AceView exon 125612707 125612820 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; exon_number 6 +12 AceView intron 125612821 125613880 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; type gt_ag +12 AceView CDS 125613881 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; product_id AACS.dAug10; exon_number 7 +12 AceView exon 125613881 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; exon_number 7 +12 AceView intron 125614007 125618548 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; type gt_ag +12 AceView CDS 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; product_id AACS.dAug10; exon_number 8 +12 AceView exon 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; exon_number 8 +12 AceView intron 125618619 125619339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; type gt_ag +12 AceView CDS 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; product_id AACS.dAug10; exon_number 9 +12 AceView exon 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; exon_number 9 +12 AceView intron 125619399 125621207 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; type gt_ag +12 AceView CDS 125621208 125621410 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; product_id AACS.dAug10; exon_number 10 +12 AceView exon 125621208 125621410 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; exon_number 10 +12 AceView intron 125621411 125626637 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; type gt_ag +12 AceView CDS 125626638 125626772 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; product_id AACS.dAug10; exon_number 11 +12 AceView exon 125626638 125627861 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; exon_number 11 +12 AceView stop_codon 125626773 125626775 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.dAug10; product_id AACS.dAug10; +12 AceView exon 125575559 125575658 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; exon_number 1 +12 AceView intron 125575659 125575971 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; type gt_ag +12 AceView start_codon 125576007 125576009 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; product_id AACS.eAug10; +12 AceView CDS 125576007 125576069 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; product_id AACS.eAug10; exon_number 2 +12 AceView exon 125575972 125576069 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; exon_number 2 +12 AceView intron 125576070 125587224 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; type gt_ag +12 AceView CDS 125587225 125587339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; product_id AACS.eAug10; exon_number 3 +12 AceView exon 125587225 125587339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; exon_number 3 +12 AceView intron 125587340 125587545 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; type gt_ag +12 AceView CDS 125587546 125587627 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; product_id AACS.eAug10; exon_number 4 +12 AceView exon 125587546 125587627 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; exon_number 4 +12 AceView intron 125587628 125591666 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; type gt_ag +12 AceView CDS 125591667 125591814 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; product_id AACS.eAug10; exon_number 5 +12 AceView exon 125591667 125591814 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; exon_number 5 +12 AceView intron 125591815 125599022 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; type gt_ag +12 AceView CDS 125599023 125599103 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; product_id AACS.eAug10; exon_number 6 +12 AceView exon 125599023 125599103 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; exon_number 6 +12 AceView intron 125599104 125618548 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; type gt_ag +12 AceView CDS 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; product_id AACS.eAug10; exon_number 7 +12 AceView exon 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; exon_number 7 +12 AceView intron 125618619 125619339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; type gt_ag +12 AceView CDS 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; product_id AACS.eAug10; exon_number 8 +12 AceView exon 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; exon_number 8 +12 AceView intron 125619399 125626637 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; type gt_ag +12 AceView CDS 125626638 125626772 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; product_id AACS.eAug10; exon_number 9 +12 AceView exon 125626638 125626866 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; exon_number 9 +12 AceView stop_codon 125626773 125626775 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.eAug10; product_id AACS.eAug10; +12 AceView start_codon 125612733 125612735 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; product_id AACS.fAug10; +12 AceView CDS 125612733 125612820 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; product_id AACS.fAug10; exon_number 1 +12 AceView exon 125611984 125612820 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; exon_number 1 +12 AceView intron 125612821 125613880 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; type gt_ag +12 AceView CDS 125613881 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; product_id AACS.fAug10; exon_number 2 +12 AceView exon 125613881 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; exon_number 2 +12 AceView intron 125614007 125618548 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; type gt_ag +12 AceView CDS 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; product_id AACS.fAug10; exon_number 3 +12 AceView exon 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; exon_number 3 +12 AceView intron 125618619 125619339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; type gt_ag +12 AceView CDS 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; product_id AACS.fAug10; exon_number 4 +12 AceView exon 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; exon_number 4 +12 AceView intron 125619399 125621207 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; type gt_ag +12 AceView CDS 125621208 125621410 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; product_id AACS.fAug10; exon_number 5 +12 AceView exon 125621208 125621410 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; exon_number 5 +12 AceView intron 125621411 125626637 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; type gt_ag +12 AceView CDS 125626638 125626772 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; product_id AACS.fAug10; exon_number 6 +12 AceView exon 125626638 125627861 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; exon_number 6 +12 AceView stop_codon 125626773 125626775 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.fAug10; product_id AACS.fAug10; +12 AceView start_codon 125612733 125612735 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; product_id AACS.gAug10; +12 AceView CDS 125612733 125612820 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; product_id AACS.gAug10; exon_number 1 +12 AceView exon 125612527 125612820 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; exon_number 1 +12 AceView intron 125612821 125613880 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; type gt_ag +12 AceView CDS 125613881 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; product_id AACS.gAug10; exon_number 2 +12 AceView exon 125613881 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; exon_number 2 +12 AceView intron 125614007 125618548 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; type gt_ag +12 AceView CDS 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; product_id AACS.gAug10; exon_number 3 +12 AceView exon 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; exon_number 3 +12 AceView intron 125618619 125619339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; type gt_ag +12 AceView CDS 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; product_id AACS.gAug10; exon_number 4 +12 AceView exon 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; exon_number 4 +12 AceView intron 125619399 125621207 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; type gt_ag +12 AceView CDS 125621208 125621485 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; product_id AACS.gAug10; exon_number 5 +12 AceView exon 125621208 125626257 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; exon_number 5 +12 AceView stop_codon 125621486 125621488 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.gAug10; product_id AACS.gAug10; +12 AceView start_codon 125609306 125609308 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; product_id AACS.hAug10; +12 AceView CDS 125609306 125609315 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; product_id AACS.hAug10; exon_number 1 +12 AceView exon 125607467 125609315 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; exon_number 1 +12 AceView intron 125609316 125609447 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; type gt_ag +12 AceView CDS 125609448 125609570 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; product_id AACS.hAug10; exon_number 2 +12 AceView exon 125609448 125609570 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; exon_number 2 +12 AceView intron 125609571 125612706 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; type gt_ag +12 AceView CDS 125612707 125612820 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; product_id AACS.hAug10; exon_number 3 +12 AceView exon 125612707 125612820 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; exon_number 3 +12 AceView intron 125612821 125613880 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; type gt_ag +12 AceView CDS 125613881 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; product_id AACS.hAug10; exon_number 4 +12 AceView exon 125613881 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; exon_number 4 +12 AceView intron 125614007 125618548 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; type gt_ag +12 AceView CDS 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; product_id AACS.hAug10; exon_number 5 +12 AceView exon 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; exon_number 5 +12 AceView intron 125618619 125619339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; type gt_ag +12 AceView CDS 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; product_id AACS.hAug10; exon_number 6 +12 AceView exon 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; exon_number 6 +12 AceView intron 125619399 125626637 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; type gt_ag +12 AceView CDS 125626638 125626756 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; product_id AACS.hAug10; exon_number 7 +12 AceView exon 125626638 125627878 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; exon_number 7 +12 AceView stop_codon 125626757 125626759 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.hAug10; product_id AACS.hAug10; +12 AceView exon 125549980 125550263 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; exon_number 1 +12 AceView intron 125550264 125558421 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; type gt_ag +12 AceView exon 125558422 125558525 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; exon_number 2 +12 AceView intron 125558526 125561036 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; type gt_ag +12 AceView exon 125561037 125561157 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; exon_number 3 +12 AceView intron 125561158 125562641 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; type gt_ag +12 AceView start_codon 125562883 125562885 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; product_id AACS.iAug10; +12 AceView CDS 125562883 125562916 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; product_id AACS.iAug10; exon_number 4 +12 AceView exon 125562642 125562916 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; exon_number 4 +12 AceView intron 125562917 125570875 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; type gt_ag +12 AceView CDS 125570876 125570989 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; product_id AACS.iAug10; exon_number 5 +12 AceView exon 125570876 125570989 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; exon_number 5 +12 AceView intron 125570990 125575971 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; type gt_ag +12 AceView CDS 125575972 125576069 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; product_id AACS.iAug10; exon_number 6 +12 AceView exon 125575972 125576069 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; exon_number 6 +12 AceView intron 125576070 125587224 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; type gt_ag +12 AceView CDS 125587225 125587339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; product_id AACS.iAug10; exon_number 7 +12 AceView exon 125587225 125587339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; exon_number 7 +12 AceView intron 125587340 125587545 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; type gt_ag +12 AceView CDS 125587546 125587627 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; product_id AACS.iAug10; exon_number 8 +12 AceView exon 125587546 125587627 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; exon_number 8 +12 AceView intron 125587628 125591666 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; type gt_ag +12 AceView CDS 125591667 125591706 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; product_id AACS.iAug10; exon_number 9 +12 AceView exon 125591667 125591708 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.iAug10; exon_number 9 +12 AceView exon 125598968 125599103 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; exon_number 1 +12 AceView intron 125599104 125618548 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; type gt_ag +12 AceView start_codon 125618605 125618607 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; product_id AACS.jAug10; +12 AceView CDS 125618605 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; product_id AACS.jAug10; exon_number 2 +12 AceView exon 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; exon_number 2 +12 AceView intron 125618619 125619339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; type gt_ag +12 AceView CDS 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; product_id AACS.jAug10; exon_number 3 +12 AceView exon 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; exon_number 3 +12 AceView intron 125619399 125621207 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; type gt_ag +12 AceView CDS 125621208 125621410 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; product_id AACS.jAug10; exon_number 4 +12 AceView exon 125621208 125621410 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; exon_number 4 +12 AceView intron 125621411 125626637 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; type gt_ag +12 AceView CDS 125626638 125626721 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; product_id AACS.jAug10; exon_number 5 +12 AceView exon 125626638 125626723 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.jAug10; exon_number 5 +12 AceView start_codon 125613959 125613961 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; product_id AACS.kAug10; +12 AceView CDS 125613959 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; product_id AACS.kAug10; exon_number 1 +12 AceView exon 125613322 125614006 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; exon_number 1 +12 AceView intron 125614007 125618548 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; type gt_ag +12 AceView CDS 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; product_id AACS.kAug10; exon_number 2 +12 AceView exon 125618549 125618618 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; exon_number 2 +12 AceView intron 125618619 125619339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; type gt_ag +12 AceView CDS 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; product_id AACS.kAug10; exon_number 3 +12 AceView exon 125619340 125619398 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; exon_number 3 +12 AceView intron 125619399 125626637 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; type gt_ag +12 AceView CDS 125626638 125626772 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; product_id AACS.kAug10; exon_number 4 +12 AceView exon 125626638 125627865 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; exon_number 4 +12 AceView stop_codon 125626773 125626775 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.kAug10; product_id AACS.kAug10; +12 AceView exon 125577027 125577253 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; exon_number 1 +12 AceView intron 125577254 125587224 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; type gt_ag +12 AceView start_codon 125587312 125587314 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; product_id AACS.lAug10; +12 AceView CDS 125587312 125587339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; product_id AACS.lAug10; exon_number 2 +12 AceView exon 125587225 125587339 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; exon_number 2 +12 AceView intron 125587340 125587545 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; type gt_ag +12 AceView CDS 125587546 125587627 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; product_id AACS.lAug10; exon_number 3 +12 AceView exon 125587546 125587627 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; exon_number 3 +12 AceView intron 125587628 125591666 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; type gt_ag +12 AceView CDS 125591667 125591814 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; product_id AACS.lAug10; exon_number 4 +12 AceView exon 125591667 125591814 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; exon_number 4 +12 AceView intron 125591815 125599022 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; type gt_ag +12 AceView CDS 125599023 125599025 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; product_id AACS.lAug10; exon_number 5 +12 AceView exon 125599023 125599027 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.lAug10; exon_number 5 +12 AceView exon 125620334 125620738 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.nAug10; exon_number 1 +12 AceView intron 125620739 125621207 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.nAug10; type gt_ag +12 AceView exon 125621208 125621286 . + 0 gene_id AACS; Gene_type cDNA_supported; transcript_id AACS.nAug10; exon_number 2 +5 AceView exon 178245095 178245387 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; exon_number 1 +5 AceView intron 178242010 178245094 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; type gt_ag +5 AceView exon 178241899 178242009 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; exon_number 2 +5 AceView intron 178238288 178241898 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; type gt_ag +5 AceView exon 178238175 178238287 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; exon_number 3 +5 AceView intron 178224613 178238174 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; type gt_ag +5 AceView start_codon 178224565 178224567 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; product_id AACSL.aAug10; +5 AceView CDS 178224532 178224567 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; product_id AACSL.aAug10; exon_number 4 +5 AceView exon 178224532 178224612 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; exon_number 4 +5 AceView intron 178203278 178224531 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; type gt_ag +5 AceView CDS 178203143 178203277 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; product_id AACSL.aAug10; exon_number 5 +5 AceView exon 178203143 178203277 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; exon_number 5 +5 AceView intron 178202338 178203142 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; type gt_ag +5 AceView CDS 178202268 178202337 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; product_id AACSL.aAug10; exon_number 6 +5 AceView exon 178202268 178202337 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; exon_number 6 +5 AceView intron 178201550 178202267 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; type gt_ag +5 AceView CDS 178201499 178201549 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; product_id AACSL.aAug10; exon_number 7 +5 AceView exon 178201499 178201549 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; exon_number 7 +5 AceView intron 178199633 178201498 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; type gt_ag +5 AceView CDS 178199430 178199632 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; product_id AACSL.aAug10; exon_number 8 +5 AceView exon 178199430 178199632 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; exon_number 8 +5 AceView intron 178195669 178199429 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; type gt_ag +5 AceView CDS 178195543 178195668 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; product_id AACSL.aAug10; exon_number 9 +5 AceView exon 178195471 178195668 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; exon_number 9 +5 AceView stop_codon 178195540 178195542 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; product_id AACSL.aAug10; +5 AceView intron 178194337 178195470 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; type gt_ag +5 AceView exon 178194131 178194336 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; exon_number 10 +5 AceView intron 178193177 178194130 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; type gc_ag +5 AceView exon 178193085 178193176 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.aAug10; exon_number 11 +5 AceView exon 178245095 178245436 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; exon_number 1 +5 AceView intron 178242010 178245094 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; type gt_ag +5 AceView exon 178241899 178242009 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; exon_number 2 +5 AceView intron 178238288 178241898 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; type gt_ag +5 AceView exon 178238175 178238287 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; exon_number 3 +5 AceView intron 178224613 178238174 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; type gt_ag +5 AceView start_codon 178224565 178224567 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; product_id AACSL.bAug10; +5 AceView CDS 178224532 178224567 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; product_id AACSL.bAug10; exon_number 4 +5 AceView exon 178224532 178224612 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; exon_number 4 +5 AceView intron 178203278 178224531 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; type gt_ag +5 AceView CDS 178203143 178203277 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; product_id AACSL.bAug10; exon_number 5 +5 AceView exon 178203143 178203277 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; exon_number 5 +5 AceView intron 178202338 178203142 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; type gt_ag +5 AceView CDS 178202268 178202337 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; product_id AACSL.bAug10; exon_number 6 +5 AceView exon 178202268 178202337 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; exon_number 6 +5 AceView intron 178201550 178202267 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; type gt_ag +5 AceView CDS 178201499 178201549 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; product_id AACSL.bAug10; exon_number 7 +5 AceView exon 178201499 178201549 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; exon_number 7 +5 AceView intron 178199633 178201498 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; type gt_ag +5 AceView CDS 178199430 178199632 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; product_id AACSL.bAug10; exon_number 8 +5 AceView exon 178199430 178199632 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; exon_number 8 +5 AceView intron 178195666 178199429 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; type gt_ag +5 AceView CDS 178195543 178195665 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; product_id AACSL.bAug10; exon_number 9 +5 AceView exon 178195471 178195665 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; exon_number 9 +5 AceView stop_codon 178195540 178195542 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; product_id AACSL.bAug10; +5 AceView intron 178194337 178195470 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; type gt_ag +5 AceView exon 178194131 178194336 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; exon_number 10 +5 AceView intron 178193177 178194130 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; type gc_ag +5 AceView exon 178191862 178193176 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.bAug10; exon_number 11 +5 AceView CDS 178203143 178203187 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; product_id AACSL.cAug10; exon_number 1 +5 AceView exon 178203143 178203188 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; exon_number 1 +5 AceView intron 178202338 178203142 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; type gt_ag +5 AceView CDS 178202268 178202337 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; product_id AACSL.cAug10; exon_number 2 +5 AceView exon 178202268 178202337 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; exon_number 2 +5 AceView intron 178201550 178202267 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; type gt_ag +5 AceView CDS 178201499 178201549 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; product_id AACSL.cAug10; exon_number 3 +5 AceView exon 178201499 178201549 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; exon_number 3 +5 AceView intron 178199633 178201498 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; type gt_ag +5 AceView CDS 178199430 178199632 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; product_id AACSL.cAug10; exon_number 4 +5 AceView exon 178199430 178199632 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; exon_number 4 +5 AceView intron 178194337 178199429 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; type gt_ag +5 AceView CDS 178194262 178194336 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; product_id AACSL.cAug10; exon_number 5 +5 AceView exon 178194262 178194336 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.cAug10; exon_number 5 +5 AceView exon 178195471 178195523 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.dAug10; exon_number 1 +5 AceView intron 178194337 178195470 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.dAug10; type gt_ag +5 AceView exon 178193362 178194336 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.dAug10; exon_number 2 +5 AceView exon 178191866 178192398 . - 0 gene_id AACSL; Gene_type cDNA_supported; transcript_id AACSL.dAug10; exon_number 3 +3 AceView exon 151531801 151531822 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; exon_number 1 +3 AceView intron 151531823 151531926 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; type gt_ag +3 AceView start_codon 151531951 151531953 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; product_id AADAC.aAug10; +3 AceView CDS 151531951 151532088 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; product_id AADAC.aAug10; exon_number 2 +3 AceView exon 151531927 151532088 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; exon_number 2 +3 AceView intron 151532089 151535153 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; type gt_ag +3 AceView CDS 151535154 151535376 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; product_id AADAC.aAug10; exon_number 3 +3 AceView exon 151535154 151535376 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; exon_number 3 +3 AceView intron 151535377 151538170 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; type gt_ag +3 AceView CDS 151538171 151538240 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; product_id AADAC.aAug10; exon_number 4 +3 AceView exon 151538171 151538240 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; exon_number 4 +3 AceView intron 151538241 151542450 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; type gt_ag +3 AceView CDS 151542451 151542622 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; product_id AADAC.aAug10; exon_number 5 +3 AceView exon 151542451 151542622 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; exon_number 5 +3 AceView intron 151542623 151545363 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; type gt_ag +3 AceView CDS 151545364 151545957 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; product_id AADAC.aAug10; exon_number 6 +3 AceView exon 151545364 151546276 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; exon_number 6 +3 AceView stop_codon 151545958 151545960 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.aAug10; product_id AADAC.aAug10; +3 AceView start_codon 151531951 151531953 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; product_id AADAC.bAug10; +3 AceView CDS 151531951 151532088 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; product_id AADAC.bAug10; exon_number 1 +3 AceView exon 151531830 151532088 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; exon_number 1 +3 AceView intron 151532089 151535153 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; type gt_ag +3 AceView CDS 151535154 151535376 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; product_id AADAC.bAug10; exon_number 2 +3 AceView exon 151535154 151535376 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; exon_number 2 +3 AceView intron 151535377 151538170 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; type gt_ag +3 AceView CDS 151538171 151538240 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; product_id AADAC.bAug10; exon_number 3 +3 AceView exon 151538171 151538240 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; exon_number 3 +3 AceView intron 151538241 151542450 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; type gt_ag +3 AceView CDS 151542451 151542622 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; product_id AADAC.bAug10; exon_number 4 +3 AceView exon 151542451 151542622 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; exon_number 4 +3 AceView intron 151542623 151545363 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; type gt_ag +3 AceView CDS 151545364 151545957 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; product_id AADAC.bAug10; exon_number 5 +3 AceView exon 151545364 151546276 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; exon_number 5 +3 AceView stop_codon 151545958 151545960 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.bAug10; product_id AADAC.bAug10; +3 AceView exon 151526027 151526028 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; exon_number 1 +3 AceView intron 151526029 151531926 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; type gt_ag +3 AceView CDS 151531927 151532088 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; product_id AADAC.cAug10; exon_number 2 +3 AceView exon 151531927 151532088 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; exon_number 2 +3 AceView intron 151532089 151535153 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; type gt_ag +3 AceView CDS 151535154 151535376 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; product_id AADAC.cAug10; exon_number 3 +3 AceView exon 151535154 151535376 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; exon_number 3 +3 AceView intron 151535377 151538170 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; type gt_ag +3 AceView CDS 151538171 151538240 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; product_id AADAC.cAug10; exon_number 4 +3 AceView exon 151538171 151538240 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; exon_number 4 +3 AceView intron 151538241 151542450 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; type gt_ag +3 AceView CDS 151542451 151542622 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; product_id AADAC.cAug10; exon_number 5 +3 AceView exon 151542451 151542622 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; exon_number 5 +3 AceView intron 151542623 151545363 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; type gt_ag +3 AceView CDS 151545364 151545615 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; product_id AADAC.cAug10; exon_number 6 +3 AceView exon 151545364 151545616 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.cAug10; exon_number 6 +3 AceView exon 151515270 151515335 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; exon_number 1 +3 AceView intron 151515336 151521493 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; type gt_ag +3 AceView exon 151521494 151521713 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; exon_number 2 +3 AceView intron 151521714 151525931 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; type gt_ag +3 AceView exon 151525932 151526028 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; exon_number 3 +3 AceView intron 151526029 151531926 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; type gt_ag +3 AceView start_codon 151531951 151531953 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; product_id AADAC.eAug10; +3 AceView CDS 151531951 151532088 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; product_id AADAC.eAug10; exon_number 4 +3 AceView exon 151531927 151532088 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; exon_number 4 +3 AceView intron 151532089 151535153 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; type gt_ag +3 AceView CDS 151535154 151535376 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; product_id AADAC.eAug10; exon_number 5 +3 AceView exon 151535154 151535376 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; exon_number 5 +3 AceView intron 151535377 151538170 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; type gt_ag +3 AceView CDS 151538171 151538240 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; product_id AADAC.eAug10; exon_number 6 +3 AceView exon 151538171 151538240 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; exon_number 6 +3 AceView intron 151538241 151542450 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; type gt_ag +3 AceView CDS 151542451 151542631 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; product_id AADAC.eAug10; exon_number 7 +3 AceView exon 151542451 151542997 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; exon_number 7 +3 AceView stop_codon 151542632 151542634 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.eAug10; product_id AADAC.eAug10; +3 AceView exon 151544253 151544696 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.dAug10-unspliced; exon_number 1 +3 AceView start_codon 151545328 151545330 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.dAug10-unspliced; product_id AADAC.dAug10-unspliced; +3 AceView CDS 151545328 151545957 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.dAug10-unspliced; product_id AADAC.dAug10-unspliced; exon_number 2 +3 AceView exon 151545122 151546279 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.dAug10-unspliced; exon_number 2 +3 AceView stop_codon 151545958 151545960 . + 0 gene_id AADAC; Gene_type cDNA_supported; transcript_id AADAC.dAug10-unspliced; product_id AADAC.dAug10-unspliced; +3 AceView start_codon 151451824 151451826 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; product_id AADACL2.aAug10; +3 AceView CDS 151451824 151451961 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; product_id AADACL2.aAug10; exon_number 1 +3 AceView exon 151451704 151451961 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; exon_number 1 +3 AceView intron 151451962 151458433 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; type gt_ag +3 AceView CDS 151458434 151458656 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; product_id AADACL2.aAug10; exon_number 2 +3 AceView exon 151458434 151458656 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; exon_number 2 +3 AceView intron 151458657 151461880 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; type gt_ag +3 AceView CDS 151461881 151461950 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; product_id AADACL2.aAug10; exon_number 3 +3 AceView exon 151461881 151461950 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; exon_number 3 +3 AceView intron 151461951 151463296 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; type gt_ag +3 AceView CDS 151463297 151463468 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; product_id AADACL2.aAug10; exon_number 4 +3 AceView exon 151463297 151463468 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; exon_number 4 +3 AceView intron 151463469 151474779 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; type gt_ag +3 AceView CDS 151474780 151475379 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; product_id AADACL2.aAug10; exon_number 5 +3 AceView exon 151474780 151475667 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; exon_number 5 +3 AceView stop_codon 151475380 151475382 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.aAug10; product_id AADACL2.aAug10; +3 AceView start_codon 151451949 151451951 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; product_id AADACL2.bAug10; +3 AceView CDS 151451949 151451961 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; product_id AADACL2.bAug10; exon_number 1 +3 AceView exon 151451704 151451961 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; exon_number 1 +3 AceView intron 151451962 151461880 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; type gt_ag +3 AceView CDS 151461881 151461950 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; product_id AADACL2.bAug10; exon_number 2 +3 AceView exon 151461881 151461950 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; exon_number 2 +3 AceView intron 151461951 151463296 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; type gt_ag +3 AceView CDS 151463297 151463468 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; product_id AADACL2.bAug10; exon_number 3 +3 AceView exon 151463297 151463468 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; exon_number 3 +3 AceView intron 151463469 151474779 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; type gt_ag +3 AceView CDS 151474780 151475379 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; product_id AADACL2.bAug10; exon_number 4 +3 AceView exon 151474780 151479124 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; exon_number 4 +3 AceView stop_codon 151475380 151475382 . + 0 gene_id AADACL2; Gene_type cDNA_supported; transcript_id AADACL2.bAug10; product_id AADACL2.bAug10; +1 AceView exon 12776119 12776347 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.aAug10; exon_number 1 +1 AceView intron 12776348 12779476 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.aAug10; type gt_ag +1 AceView start_codon 12779480 12779482 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.aAug10; product_id AADACL3.aAug10; +1 AceView CDS 12779480 12779693 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.aAug10; product_id AADACL3.aAug10; exon_number 2 +1 AceView exon 12779477 12779693 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.aAug10; exon_number 2 +1 AceView intron 12779694 12780884 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.aAug10; type gt_ag +1 AceView CDS 12780885 12780948 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.aAug10; product_id AADACL3.aAug10; exon_number 3 +1 AceView exon 12780885 12780948 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.aAug10; exon_number 3 +1 AceView intron 12780949 12785188 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.aAug10; type gt_ag +1 AceView CDS 12785189 12785960 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.aAug10; product_id AADACL3.aAug10; exon_number 4 +1 AceView exon 12785189 12788726 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.aAug10; exon_number 4 +1 AceView stop_codon 12785961 12785963 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.aAug10; product_id AADACL3.aAug10; +1 AceView start_codon 12776344 12776346 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.bAug10; product_id AADACL3.bAug10; +1 AceView CDS 12776344 12776347 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.bAug10; product_id AADACL3.bAug10; exon_number 1 +1 AceView exon 12776119 12776347 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.bAug10; exon_number 1 +1 AceView intron 12776348 12780884 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.bAug10; type gt_ag +1 AceView CDS 12780885 12780948 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.bAug10; product_id AADACL3.bAug10; exon_number 2 +1 AceView exon 12780885 12780948 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.bAug10; exon_number 2 +1 AceView intron 12780949 12785188 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.bAug10; type gt_ag +1 AceView CDS 12785189 12785960 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.bAug10; product_id AADACL3.bAug10; exon_number 3 +1 AceView exon 12785189 12788726 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.bAug10; exon_number 3 +1 AceView stop_codon 12785961 12785963 . + 0 gene_id AADACL3; Gene_type cDNA_supported; transcript_id AADACL3.bAug10; product_id AADACL3.bAug10; +1 AceView CDS 12704566 12704733 . + 0 gene_id AADACL4; Gene_type cDNA_supported; transcript_id AADACL4.aAug10; product_id AADACL4.aAug10; exon_number 1 +1 AceView exon 12704566 12704733 . + 0 gene_id AADACL4; Gene_type cDNA_supported; transcript_id AADACL4.aAug10; exon_number 1 +1 AceView intron 12704734 12711141 . + 0 gene_id AADACL4; Gene_type cDNA_supported; transcript_id AADACL4.aAug10; type gt_ag +1 AceView CDS 12711142 12711358 . + 0 gene_id AADACL4; Gene_type cDNA_supported; transcript_id AADACL4.aAug10; product_id AADACL4.aAug10; exon_number 2 +1 AceView exon 12711142 12711358 . + 0 gene_id AADACL4; Gene_type cDNA_supported; transcript_id AADACL4.aAug10; exon_number 2 +1 AceView intron 12711359 12721801 . + 0 gene_id AADACL4; Gene_type cDNA_supported; transcript_id AADACL4.aAug10; type gt_ag +1 AceView CDS 12721802 12721865 . + 0 gene_id AADACL4; Gene_type cDNA_supported; transcript_id AADACL4.aAug10; product_id AADACL4.aAug10; exon_number 3 +1 AceView exon 12721802 12721865 . + 0 gene_id AADACL4; Gene_type cDNA_supported; transcript_id AADACL4.aAug10; exon_number 3 +1 AceView intron 12721866 12725971 . + 0 gene_id AADACL4; Gene_type cDNA_supported; transcript_id AADACL4.aAug10; type gt_ag +1 AceView CDS 12725972 12726743 . + 0 gene_id AADACL4; Gene_type cDNA_supported; transcript_id AADACL4.aAug10; product_id AADACL4.aAug10; exon_number 4 +1 AceView exon 12725972 12727097 . + 0 gene_id AADACL4; Gene_type cDNA_supported; transcript_id AADACL4.aAug10; exon_number 4 +1 AceView stop_codon 12726744 12726746 . + 0 gene_id AADACL4; Gene_type cDNA_supported; transcript_id AADACL4.aAug10; product_id AADACL4.aAug10; +4 AceView exon 171012745 171012823 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 1 +4 AceView intron 171011683 171012744 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView exon 171011295 171011682 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 2 +4 AceView intron 171010888 171011294 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView start_codon 171010839 171010841 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; +4 AceView CDS 171010763 171010841 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 3 +4 AceView exon 171010763 171010887 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 3 +4 AceView intron 171009716 171010762 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView CDS 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 4 +4 AceView exon 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 4 +4 AceView intron 171008400 171009546 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView CDS 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 5 +4 AceView exon 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 5 +4 AceView intron 170999735 171008266 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView CDS 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 6 +4 AceView exon 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 6 +4 AceView intron 170994497 170999659 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView CDS 170994287 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 7 +4 AceView exon 170994287 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 7 +4 AceView intron 170991804 170994286 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView CDS 170991738 170991803 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 8 +4 AceView exon 170991738 170991803 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 8 +4 AceView intron 170990382 170991737 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView CDS 170990299 170990381 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 9 +4 AceView exon 170990299 170990381 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 9 +4 AceView intron 170989839 170990298 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView CDS 170989742 170989838 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 10 +4 AceView exon 170989742 170989838 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 10 +4 AceView intron 170988540 170989741 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView CDS 170988478 170988539 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 11 +4 AceView exon 170988478 170988539 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 11 +4 AceView intron 170987630 170988477 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView CDS 170987565 170987629 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 12 +4 AceView exon 170987565 170987629 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 12 +4 AceView intron 170985977 170987564 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView CDS 170985870 170985976 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 13 +4 AceView exon 170985870 170985976 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 13 +4 AceView intron 170983145 170985869 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView CDS 170983043 170983144 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 14 +4 AceView exon 170983043 170983144 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 14 +4 AceView intron 170982121 170983042 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; type gt_ag +4 AceView CDS 170982082 170982120 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; exon_number 15 +4 AceView exon 170981374 170982120 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; exon_number 15 +4 AceView stop_codon 170982079 170982081 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.aAug10; product_id AADAT.aAug10; +4 AceView exon 171011376 171011538 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 1 +4 AceView intron 171010888 171011375 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView start_codon 171010839 171010841 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; +4 AceView CDS 171010775 171010841 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 2 +4 AceView exon 171010775 171010887 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 2 +4 AceView intron 171009716 171010774 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView CDS 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 3 +4 AceView exon 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 3 +4 AceView intron 171008400 171009546 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView CDS 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 4 +4 AceView exon 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 4 +4 AceView intron 170999735 171008266 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView CDS 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 5 +4 AceView exon 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 5 +4 AceView intron 170994497 170999659 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView CDS 170994287 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 6 +4 AceView exon 170994287 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 6 +4 AceView intron 170991804 170994286 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView CDS 170991738 170991803 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 7 +4 AceView exon 170991738 170991803 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 7 +4 AceView intron 170990382 170991737 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView CDS 170990299 170990381 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 8 +4 AceView exon 170990299 170990381 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 8 +4 AceView intron 170989839 170990298 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView CDS 170989742 170989838 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 9 +4 AceView exon 170989742 170989838 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 9 +4 AceView intron 170988540 170989741 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView CDS 170988478 170988539 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 10 +4 AceView exon 170988478 170988539 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 10 +4 AceView intron 170987630 170988477 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView CDS 170987565 170987629 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 11 +4 AceView exon 170987565 170987629 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 11 +4 AceView intron 170985977 170987564 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView CDS 170985870 170985976 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 12 +4 AceView exon 170985870 170985976 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 12 +4 AceView intron 170983145 170985869 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView CDS 170983043 170983144 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 13 +4 AceView exon 170983043 170983144 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 13 +4 AceView intron 170982121 170983042 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; type gt_ag +4 AceView CDS 170982082 170982120 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; exon_number 14 +4 AceView exon 170982079 170982120 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; exon_number 14 +4 AceView stop_codon 170982079 170982081 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.bAug10; product_id AADAT.bAug10; +4 AceView start_codon 171010839 171010841 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; +4 AceView CDS 171010775 171010841 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 1 +4 AceView exon 171010775 171011507 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 1 +4 AceView intron 171009716 171010774 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; type gt_ag +4 AceView CDS 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 2 +4 AceView exon 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 2 +4 AceView intron 171008400 171009546 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; type gt_ag +4 AceView CDS 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 3 +4 AceView exon 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 3 +4 AceView intron 170999735 171008266 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; type gt_ag +4 AceView CDS 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 4 +4 AceView exon 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 4 +4 AceView intron 170994497 170999659 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; type gt_ag +4 AceView CDS 170994287 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 5 +4 AceView exon 170994287 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 5 +4 AceView intron 170991804 170994286 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; type gt_ag +4 AceView CDS 170991738 170991803 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 6 +4 AceView exon 170991738 170991803 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 6 +4 AceView intron 170990382 170991737 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; type gt_ag +4 AceView CDS 170990299 170990381 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 7 +4 AceView exon 170990299 170990381 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 7 +4 AceView intron 170989839 170990298 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; type gt_ag +4 AceView CDS 170989742 170989838 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 8 +4 AceView exon 170989742 170989838 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 8 +4 AceView intron 170988540 170989741 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; type gt_ag +4 AceView CDS 170988478 170988539 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 9 +4 AceView exon 170988478 170988539 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 9 +4 AceView intron 170987630 170988477 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; type gt_ag +4 AceView CDS 170987565 170987629 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 10 +4 AceView exon 170987565 170987629 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 10 +4 AceView intron 170985977 170987564 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; type gt_ag +4 AceView CDS 170985870 170985976 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 11 +4 AceView exon 170985870 170985976 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 11 +4 AceView intron 170983145 170985869 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; type gt_ag +4 AceView CDS 170983043 170983144 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 12 +4 AceView exon 170983043 170983144 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 12 +4 AceView intron 170982121 170983042 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; type gt_ag +4 AceView CDS 170982082 170982120 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; exon_number 13 +4 AceView exon 170981367 170982120 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; exon_number 13 +4 AceView stop_codon 170982079 170982081 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.cAug10; product_id AADAT.cAug10; +4 AceView exon 171011295 171011372 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 1 +4 AceView intron 171010888 171011294 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView start_codon 171010839 171010841 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; +4 AceView CDS 171010775 171010841 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 2 +4 AceView exon 171010775 171010887 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 2 +4 AceView intron 171009716 171010774 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView CDS 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 3 +4 AceView exon 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 3 +4 AceView intron 171008400 171009546 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView CDS 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 4 +4 AceView exon 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 4 +4 AceView intron 170999735 171008266 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView CDS 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 5 +4 AceView exon 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 5 +4 AceView intron 170994497 170999659 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView CDS 170994287 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 6 +4 AceView exon 170994287 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 6 +4 AceView intron 170991804 170994286 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView CDS 170991738 170991803 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 7 +4 AceView exon 170991738 170991803 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 7 +4 AceView intron 170990382 170991737 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView CDS 170990299 170990381 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 8 +4 AceView exon 170990299 170990381 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 8 +4 AceView intron 170989839 170990298 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView CDS 170989742 170989838 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 9 +4 AceView exon 170989742 170989838 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 9 +4 AceView intron 170988540 170989741 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView CDS 170988478 170988539 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 10 +4 AceView exon 170988478 170988539 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 10 +4 AceView intron 170987630 170988477 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView CDS 170987565 170987629 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 11 +4 AceView exon 170987565 170987629 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 11 +4 AceView intron 170985977 170987564 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView CDS 170985870 170985976 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 12 +4 AceView exon 170985870 170985976 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 12 +4 AceView intron 170983145 170985869 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView CDS 170983043 170983144 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 13 +4 AceView exon 170983043 170983144 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 13 +4 AceView intron 170982121 170983042 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; type gt_ag +4 AceView CDS 170982082 170982120 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; exon_number 14 +4 AceView exon 170981373 170982120 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; exon_number 14 +4 AceView stop_codon 170982079 170982081 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.dAug10; product_id AADAT.dAug10; +4 AceView exon 171012745 171012849 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; exon_number 1 +4 AceView intron 171011683 171012744 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; type gt_ag +4 AceView start_codon 171011637 171011639 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; product_id AADAT.eAug10; +4 AceView CDS 171011569 171011639 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; product_id AADAT.eAug10; exon_number 2 +4 AceView exon 171011569 171011682 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; exon_number 2 +4 AceView intron 171010888 171011568 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; type gt_ag +4 AceView CDS 171010775 171010887 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; product_id AADAT.eAug10; exon_number 3 +4 AceView exon 171010775 171010887 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; exon_number 3 +4 AceView intron 171009716 171010774 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; type gt_ag +4 AceView CDS 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; product_id AADAT.eAug10; exon_number 4 +4 AceView exon 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; exon_number 4 +4 AceView intron 171008400 171009546 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; type gt_ag +4 AceView CDS 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; product_id AADAT.eAug10; exon_number 5 +4 AceView exon 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; exon_number 5 +4 AceView intron 170999735 171008266 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; type gt_ag +4 AceView CDS 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; product_id AADAT.eAug10; exon_number 6 +4 AceView exon 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; exon_number 6 +4 AceView intron 170994497 170999659 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; type gt_ag +4 AceView CDS 170994287 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; product_id AADAT.eAug10; exon_number 7 +4 AceView exon 170994287 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; exon_number 7 +4 AceView intron 170991804 170994286 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; type gt_ag +4 AceView CDS 170991708 170991803 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; product_id AADAT.eAug10; exon_number 8 +4 AceView exon 170991636 170991803 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; exon_number 8 +4 AceView stop_codon 170991705 170991707 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.eAug10; product_id AADAT.eAug10; +4 AceView start_codon 171010449 171010451 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; product_id AADAT.fAug10; +4 AceView CDS 171010412 171010451 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; product_id AADAT.fAug10; exon_number 1 +4 AceView exon 171010412 171010544 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; exon_number 1 +4 AceView intron 171009716 171010411 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; type gt_ag +4 AceView CDS 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; product_id AADAT.fAug10; exon_number 2 +4 AceView exon 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; exon_number 2 +4 AceView intron 171008400 171009546 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; type gt_ag +4 AceView CDS 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; product_id AADAT.fAug10; exon_number 3 +4 AceView exon 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; exon_number 3 +4 AceView intron 170999735 171008266 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; type gt_ag +4 AceView CDS 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; product_id AADAT.fAug10; exon_number 4 +4 AceView exon 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; exon_number 4 +4 AceView intron 170994497 170999659 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; type gt_ag +4 AceView CDS 170994287 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; product_id AADAT.fAug10; exon_number 5 +4 AceView exon 170994287 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; exon_number 5 +4 AceView intron 170991804 170994286 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; type gt_ag +4 AceView CDS 170991771 170991803 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; product_id AADAT.fAug10; exon_number 6 +4 AceView exon 170991770 170991803 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.fAug10; exon_number 6 +4 AceView exon 171011313 171011447 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; exon_number 1 +4 AceView intron 171010888 171011312 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; type gt_ag +4 AceView start_codon 171010839 171010841 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; product_id AADAT.gAug10; +4 AceView CDS 171010775 171010841 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; product_id AADAT.gAug10; exon_number 2 +4 AceView exon 171010775 171010887 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; exon_number 2 +4 AceView intron 171009716 171010774 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; type gt_ag +4 AceView CDS 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; product_id AADAT.gAug10; exon_number 3 +4 AceView exon 171009547 171009715 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; exon_number 3 +4 AceView intron 171008400 171009546 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; type gt_ag +4 AceView CDS 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; product_id AADAT.gAug10; exon_number 4 +4 AceView exon 171008267 171008399 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; exon_number 4 +4 AceView intron 170999735 171008266 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; type gt_ag +4 AceView CDS 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; product_id AADAT.gAug10; exon_number 5 +4 AceView exon 170999660 170999734 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; exon_number 5 +4 AceView intron 170994497 170999659 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; type gt_ag +4 AceView CDS 170994314 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; product_id AADAT.gAug10; exon_number 6 +4 AceView exon 170994312 170994496 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.gAug10; exon_number 6 +4 AceView exon 170983043 170983752 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.hAug10; exon_number 1 +4 AceView intron 170982121 170983042 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.hAug10; type gt_ag +4 AceView exon 170981457 170982120 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.hAug10; exon_number 2 +4 AceView exon 170999660 171000175 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.iAug10; exon_number 1 +4 AceView intron 170996613 170999659 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.iAug10; type gt_ag +4 AceView exon 170996424 170996612 . - 0 gene_id AADAT; Gene_type cDNA_supported; transcript_id AADAT.iAug10; exon_number 2 +15 AceView CDS 67546897 67546966 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; product_id AAGAB.aAug10; exon_number 1 +15 AceView exon 67546897 67546968 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; exon_number 1 +15 AceView intron 67529159 67546896 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; type gt_ag +15 AceView CDS 67528968 67529158 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; product_id AAGAB.aAug10; exon_number 2 +15 AceView exon 67528968 67529158 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; exon_number 2 +15 AceView intron 67528843 67528967 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; type gt_ag +15 AceView CDS 67528746 67528842 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; product_id AAGAB.aAug10; exon_number 3 +15 AceView exon 67528746 67528842 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; exon_number 3 +15 AceView intron 67528407 67528745 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; type gt_ag +15 AceView CDS 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; product_id AAGAB.aAug10; exon_number 4 +15 AceView exon 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; exon_number 4 +15 AceView intron 67524236 67528316 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; type gt_ag +15 AceView CDS 67524152 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; product_id AAGAB.aAug10; exon_number 5 +15 AceView exon 67524152 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; exon_number 5 +15 AceView intron 67501883 67524151 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; type gt_ag +15 AceView CDS 67501800 67501882 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; product_id AAGAB.aAug10; exon_number 6 +15 AceView exon 67501800 67501882 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; exon_number 6 +15 AceView intron 67500997 67501799 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; type gt_ag +15 AceView CDS 67500900 67500996 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; product_id AAGAB.aAug10; exon_number 7 +15 AceView exon 67500900 67500996 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; exon_number 7 +15 AceView intron 67496487 67500899 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; type gt_ag +15 AceView CDS 67496382 67496486 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; product_id AAGAB.aAug10; exon_number 8 +15 AceView exon 67496382 67496486 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; exon_number 8 +15 AceView intron 67495936 67496381 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; type gt_ag +15 AceView CDS 67495760 67495935 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; product_id AAGAB.aAug10; exon_number 9 +15 AceView exon 67494029 67495935 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; exon_number 9 +15 AceView stop_codon 67495757 67495759 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.aAug10; product_id AAGAB.aAug10; +15 AceView start_codon 67546967 67546969 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; product_id AAGAB.bAug10; +15 AceView CDS 67546897 67546969 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; product_id AAGAB.bAug10; exon_number 1 +15 AceView exon 67546897 67547073 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; exon_number 1 +15 AceView intron 67529159 67546896 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; type gt_ag +15 AceView CDS 67528968 67529158 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; product_id AAGAB.bAug10; exon_number 2 +15 AceView exon 67528968 67529158 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; exon_number 2 +15 AceView intron 67528843 67528967 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; type gt_ag +15 AceView CDS 67528746 67528842 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; product_id AAGAB.bAug10; exon_number 3 +15 AceView exon 67528746 67528842 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; exon_number 3 +15 AceView intron 67528407 67528745 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; type gt_ag +15 AceView CDS 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; product_id AAGAB.bAug10; exon_number 4 +15 AceView exon 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; exon_number 4 +15 AceView intron 67524236 67528316 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; type gt_ag +15 AceView CDS 67524152 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; product_id AAGAB.bAug10; exon_number 5 +15 AceView exon 67524152 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; exon_number 5 +15 AceView intron 67501883 67524151 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; type gt_ag +15 AceView CDS 67501800 67501882 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; product_id AAGAB.bAug10; exon_number 6 +15 AceView exon 67501800 67501882 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; exon_number 6 +15 AceView intron 67500997 67501799 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; type gt_ag +15 AceView CDS 67500900 67500996 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; product_id AAGAB.bAug10; exon_number 7 +15 AceView exon 67500900 67500996 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; exon_number 7 +15 AceView intron 67496487 67500899 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; type gt_ag +15 AceView CDS 67496382 67496486 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; product_id AAGAB.bAug10; exon_number 8 +15 AceView exon 67496382 67496486 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; exon_number 8 +15 AceView intron 67495936 67496381 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; type gt_ag +15 AceView CDS 67495886 67495935 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; product_id AAGAB.bAug10; exon_number 9 +15 AceView exon 67495886 67495935 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; exon_number 9 +15 AceView intron 67495237 67495885 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; type gt_ag +15 AceView CDS 67495162 67495236 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; product_id AAGAB.bAug10; exon_number 10 +15 AceView exon 67493369 67495236 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; exon_number 10 +15 AceView stop_codon 67495159 67495161 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.bAug10; product_id AAGAB.bAug10; +15 AceView exon 67546562 67546991 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; exon_number 1 +15 AceView intron 67529159 67546561 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; type gt_ag +15 AceView exon 67528968 67529158 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; exon_number 2 +15 AceView intron 67528843 67528967 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; type gt_ag +15 AceView start_codon 67528777 67528779 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; product_id AAGAB.cAug10; +15 AceView CDS 67528746 67528779 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; product_id AAGAB.cAug10; exon_number 3 +15 AceView exon 67528746 67528842 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; exon_number 3 +15 AceView intron 67528407 67528745 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; type gt_ag +15 AceView CDS 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; product_id AAGAB.cAug10; exon_number 4 +15 AceView exon 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; exon_number 4 +15 AceView intron 67524236 67528316 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; type gt_ag +15 AceView CDS 67524152 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; product_id AAGAB.cAug10; exon_number 5 +15 AceView exon 67524152 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; exon_number 5 +15 AceView intron 67501883 67524151 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; type gt_ag +15 AceView CDS 67501800 67501882 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; product_id AAGAB.cAug10; exon_number 6 +15 AceView exon 67501800 67501882 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; exon_number 6 +15 AceView intron 67500997 67501799 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; type gt_ag +15 AceView CDS 67500900 67500996 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; product_id AAGAB.cAug10; exon_number 7 +15 AceView exon 67500900 67500996 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; exon_number 7 +15 AceView intron 67496487 67500899 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; type gt_ag +15 AceView CDS 67496382 67496486 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; product_id AAGAB.cAug10; exon_number 8 +15 AceView exon 67496382 67496486 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; exon_number 8 +15 AceView intron 67495936 67496381 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; type gt_ag +15 AceView CDS 67495886 67495935 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; product_id AAGAB.cAug10; exon_number 9 +15 AceView exon 67495886 67495935 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; exon_number 9 +15 AceView intron 67495237 67495885 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; type gt_ag +15 AceView CDS 67495162 67495236 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; product_id AAGAB.cAug10; exon_number 10 +15 AceView exon 67494011 67495236 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; exon_number 10 +15 AceView stop_codon 67495159 67495161 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.cAug10; product_id AAGAB.cAug10; +15 AceView exon 67546752 67547013 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; exon_number 1 +15 AceView intron 67529159 67546751 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; type gt_ag +15 AceView exon 67528968 67529158 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; exon_number 2 +15 AceView intron 67528843 67528967 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; type gt_ag +15 AceView start_codon 67528777 67528779 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; product_id AAGAB.dAug10; +15 AceView CDS 67528746 67528779 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; product_id AAGAB.dAug10; exon_number 3 +15 AceView exon 67528746 67528842 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; exon_number 3 +15 AceView intron 67528407 67528745 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; type gt_ag +15 AceView CDS 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; product_id AAGAB.dAug10; exon_number 4 +15 AceView exon 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; exon_number 4 +15 AceView intron 67524236 67528316 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; type gt_ag +15 AceView CDS 67524152 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; product_id AAGAB.dAug10; exon_number 5 +15 AceView exon 67524152 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; exon_number 5 +15 AceView intron 67501883 67524151 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; type gt_ag +15 AceView CDS 67501800 67501882 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; product_id AAGAB.dAug10; exon_number 6 +15 AceView exon 67501800 67501882 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; exon_number 6 +15 AceView intron 67500997 67501799 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; type gt_ag +15 AceView CDS 67500900 67500996 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; product_id AAGAB.dAug10; exon_number 7 +15 AceView exon 67500900 67500996 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; exon_number 7 +15 AceView intron 67496487 67500899 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; type gt_ag +15 AceView CDS 67496382 67496486 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; product_id AAGAB.dAug10; exon_number 8 +15 AceView exon 67496382 67496486 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; exon_number 8 +15 AceView intron 67495936 67496381 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; type gt_ag +15 AceView CDS 67495886 67495935 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; product_id AAGAB.dAug10; exon_number 9 +15 AceView exon 67495886 67495935 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; exon_number 9 +15 AceView intron 67495237 67495885 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; type gt_ag +15 AceView CDS 67495162 67495236 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; product_id AAGAB.dAug10; exon_number 10 +15 AceView exon 67493250 67495236 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; exon_number 10 +15 AceView stop_codon 67495159 67495161 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.dAug10; product_id AAGAB.dAug10; +15 AceView exon 67547475 67547593 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; exon_number 1 +15 AceView intron 67529159 67547474 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; type gt_ag +15 AceView exon 67528968 67529158 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; exon_number 2 +15 AceView intron 67528843 67528967 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; type gt_ag +15 AceView start_codon 67528777 67528779 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; product_id AAGAB.eAug10; +15 AceView CDS 67528746 67528779 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; product_id AAGAB.eAug10; exon_number 3 +15 AceView exon 67528746 67528842 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; exon_number 3 +15 AceView intron 67528407 67528745 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; type gt_ag +15 AceView CDS 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; product_id AAGAB.eAug10; exon_number 4 +15 AceView exon 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; exon_number 4 +15 AceView intron 67524236 67528316 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; type gt_ag +15 AceView CDS 67524152 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; product_id AAGAB.eAug10; exon_number 5 +15 AceView exon 67524152 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; exon_number 5 +15 AceView intron 67501883 67524151 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; type gt_ag +15 AceView CDS 67501800 67501882 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; product_id AAGAB.eAug10; exon_number 6 +15 AceView exon 67501800 67501882 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; exon_number 6 +15 AceView intron 67500997 67501799 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; type gt_ag +15 AceView CDS 67500900 67500996 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; product_id AAGAB.eAug10; exon_number 7 +15 AceView exon 67500900 67500996 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; exon_number 7 +15 AceView intron 67496487 67500899 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; type gt_ag +15 AceView CDS 67496382 67496486 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; product_id AAGAB.eAug10; exon_number 8 +15 AceView exon 67496382 67496486 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; exon_number 8 +15 AceView intron 67495936 67496381 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; type gt_ag +15 AceView CDS 67495886 67495935 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; product_id AAGAB.eAug10; exon_number 9 +15 AceView exon 67495886 67495935 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; exon_number 9 +15 AceView intron 67495237 67495885 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; type gt_ag +15 AceView CDS 67495162 67495236 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; product_id AAGAB.eAug10; exon_number 10 +15 AceView exon 67495078 67495236 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; exon_number 10 +15 AceView stop_codon 67495159 67495161 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.eAug10; product_id AAGAB.eAug10; +15 AceView start_codon 67546967 67546969 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; product_id AAGAB.fAug10; +15 AceView CDS 67546897 67546969 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; product_id AAGAB.fAug10; exon_number 1 +15 AceView exon 67546897 67546991 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; exon_number 1 +15 AceView intron 67529159 67546896 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; type gt_ag +15 AceView CDS 67528968 67529158 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; product_id AAGAB.fAug10; exon_number 2 +15 AceView exon 67528968 67529158 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; exon_number 2 +15 AceView intron 67528843 67528967 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; type gt_ag +15 AceView CDS 67528746 67528842 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; product_id AAGAB.fAug10; exon_number 3 +15 AceView exon 67528746 67528842 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; exon_number 3 +15 AceView intron 67528407 67528745 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; type gt_ag +15 AceView CDS 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; product_id AAGAB.fAug10; exon_number 4 +15 AceView exon 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; exon_number 4 +15 AceView intron 67524236 67528316 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; type gt_ag +15 AceView CDS 67524152 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; product_id AAGAB.fAug10; exon_number 5 +15 AceView exon 67524152 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; exon_number 5 +15 AceView intron 67519289 67524151 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; type Fuzzy_gt_ag +15 AceView CDS 67519242 67519288 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; product_id AAGAB.fAug10; exon_number 6 +15 AceView exon 67519025 67519288 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; exon_number 6 +15 AceView stop_codon 67519239 67519241 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.fAug10; product_id AAGAB.fAug10; +15 AceView start_codon 67513428 67513430 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; product_id AAGAB.gAug10; +15 AceView CDS 67513377 67513430 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; product_id AAGAB.gAug10; exon_number 1 +15 AceView exon 67513377 67513545 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; exon_number 1 +15 AceView intron 67512879 67513376 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; type gt_ag +15 AceView CDS 67512827 67512878 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; product_id AAGAB.gAug10; exon_number 2 +15 AceView exon 67512827 67512878 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; exon_number 2 +15 AceView intron 67501883 67512826 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; type gt_ag +15 AceView CDS 67501800 67501882 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; product_id AAGAB.gAug10; exon_number 3 +15 AceView exon 67501800 67501882 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; exon_number 3 +15 AceView intron 67500997 67501799 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; type gt_ag +15 AceView CDS 67500900 67500996 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; product_id AAGAB.gAug10; exon_number 4 +15 AceView exon 67500900 67500996 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; exon_number 4 +15 AceView intron 67496487 67500899 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; type gt_ag +15 AceView CDS 67496382 67496486 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; product_id AAGAB.gAug10; exon_number 5 +15 AceView exon 67496382 67496486 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; exon_number 5 +15 AceView intron 67495936 67496381 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; type gt_ag +15 AceView CDS 67495886 67495935 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; product_id AAGAB.gAug10; exon_number 6 +15 AceView exon 67495886 67495935 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; exon_number 6 +15 AceView intron 67495237 67495885 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; type gt_ag +15 AceView CDS 67495162 67495236 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; product_id AAGAB.gAug10; exon_number 7 +15 AceView exon 67494011 67495236 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; exon_number 7 +15 AceView stop_codon 67495159 67495161 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.gAug10; product_id AAGAB.gAug10; +15 AceView start_codon 67499522 67499524 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.hAug10-unspliced; product_id AAGAB.hAug10-unspliced; +15 AceView CDS 67499225 67499524 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.hAug10-unspliced; product_id AAGAB.hAug10-unspliced; exon_number 1 +15 AceView exon 67493369 67500195 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.hAug10-unspliced; exon_number 1 +15 AceView stop_codon 67499222 67499224 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.hAug10-unspliced; product_id AAGAB.hAug10-unspliced; +15 AceView exon 67535075 67535208 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.kAug10; exon_number 1 +15 AceView intron 67529159 67535074 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.kAug10; type gt_ag +15 AceView exon 67528968 67529158 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.kAug10; exon_number 2 +15 AceView intron 67528843 67528967 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.kAug10; type gt_ag +15 AceView exon 67528746 67528842 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.kAug10; exon_number 3 +15 AceView intron 67528407 67528745 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.kAug10; type gt_ag +15 AceView exon 67528317 67528406 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.kAug10; exon_number 4 +15 AceView intron 67524236 67528316 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.kAug10; type gt_ag +15 AceView exon 67524186 67524235 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.kAug10; exon_number 5 +15 AceView exon 67546567 67546977 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.lAug10; exon_number 1 +15 AceView intron 67529159 67546566 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.lAug10; type gt_ag +15 AceView exon 67529041 67529158 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.lAug10; exon_number 2 +15 AceView exon 67516940 67517402 . - 0 gene_id AAGAB; Gene_type cDNA_supported; transcript_id AAGAB.mAug10-unspliced; exon_number 1 +2 AceView exon 69870707 69871060 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 1 +2 AceView intron 69870407 69870706 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView start_codon 69870170 69870172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; +2 AceView CDS 69870010 69870172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 2 +2 AceView exon 69870010 69870406 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 2 +2 AceView intron 69784111 69870009 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69783992 69784110 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 3 +2 AceView exon 69783992 69784110 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 3 +2 AceView intron 69771677 69783991 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69771568 69771676 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 4 +2 AceView exon 69771568 69771676 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 4 +2 AceView intron 69769798 69771567 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69769655 69769797 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 5 +2 AceView exon 69769655 69769797 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 5 +2 AceView intron 69759295 69769654 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69759173 69759294 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 6 +2 AceView exon 69759173 69759294 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 6 +2 AceView intron 69757839 69759172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69757757 69757838 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 7 +2 AceView exon 69757757 69757838 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 7 +2 AceView intron 69757273 69757756 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69757140 69757272 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 8 +2 AceView exon 69757140 69757272 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 8 +2 AceView intron 69754452 69757139 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69754348 69754451 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 9 +2 AceView exon 69754348 69754451 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 9 +2 AceView intron 69752245 69754347 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69752165 69752244 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 10 +2 AceView exon 69752165 69752244 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 10 +2 AceView intron 69748121 69752164 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69747966 69748120 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 11 +2 AceView exon 69747966 69748120 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 11 +2 AceView intron 69746373 69747965 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69746086 69746372 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 12 +2 AceView exon 69746086 69746372 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 12 +2 AceView intron 69741882 69746085 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69741603 69741881 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 13 +2 AceView exon 69741603 69741881 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 13 +2 AceView intron 69736593 69741602 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69736363 69736592 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 14 +2 AceView exon 69736363 69736592 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 14 +2 AceView intron 69734711 69736362 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69734553 69734710 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 15 +2 AceView exon 69734553 69734710 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 15 +2 AceView intron 69732806 69734552 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69732701 69732805 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 16 +2 AceView exon 69732701 69732805 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 16 +2 AceView intron 69723213 69732700 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69723117 69723212 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 17 +2 AceView exon 69723117 69723212 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 17 +2 AceView intron 69709945 69723116 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69709843 69709944 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 18 +2 AceView exon 69709843 69709944 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 18 +2 AceView intron 69708094 69709842 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69707992 69708093 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 19 +2 AceView exon 69707992 69708093 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 19 +2 AceView intron 69706194 69707991 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69706083 69706193 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 20 +2 AceView exon 69706083 69706193 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 20 +2 AceView intron 69704123 69706082 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69704012 69704122 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 21 +2 AceView exon 69704012 69704122 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 21 +2 AceView intron 69703096 69704011 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; type gt_ag +2 AceView CDS 69703004 69703095 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; exon_number 22 +2 AceView exon 69685127 69703095 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; exon_number 22 +2 AceView stop_codon 69703001 69703003 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.aAug10; product_id AAK1.aAug10; +2 AceView exon 69870924 69871092 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 1 +2 AceView intron 69870407 69870923 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView start_codon 69870170 69870172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; +2 AceView CDS 69870010 69870172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 2 +2 AceView exon 69870010 69870406 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 2 +2 AceView intron 69784111 69870009 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69783992 69784110 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 3 +2 AceView exon 69783992 69784110 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 3 +2 AceView intron 69771677 69783991 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69771568 69771676 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 4 +2 AceView exon 69771568 69771676 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 4 +2 AceView intron 69769798 69771567 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69769655 69769797 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 5 +2 AceView exon 69769655 69769797 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 5 +2 AceView intron 69759295 69769654 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69759173 69759294 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 6 +2 AceView exon 69759173 69759294 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 6 +2 AceView intron 69757839 69759172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69757757 69757838 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 7 +2 AceView exon 69757757 69757838 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 7 +2 AceView intron 69757273 69757756 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69757140 69757272 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 8 +2 AceView exon 69757140 69757272 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 8 +2 AceView intron 69754452 69757139 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69754348 69754451 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 9 +2 AceView exon 69754348 69754451 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 9 +2 AceView intron 69752245 69754347 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69752165 69752244 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 10 +2 AceView exon 69752165 69752244 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 10 +2 AceView intron 69748121 69752164 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69747966 69748120 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 11 +2 AceView exon 69747966 69748120 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 11 +2 AceView intron 69746373 69747965 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69746086 69746372 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 12 +2 AceView exon 69746086 69746372 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 12 +2 AceView intron 69741882 69746085 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69741603 69741881 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 13 +2 AceView exon 69741603 69741881 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 13 +2 AceView intron 69736596 69741602 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69736363 69736595 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 14 +2 AceView exon 69736363 69736595 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 14 +2 AceView intron 69734711 69736362 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69734553 69734710 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 15 +2 AceView exon 69734553 69734710 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 15 +2 AceView intron 69732806 69734552 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69732701 69732805 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 16 +2 AceView exon 69732701 69732805 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 16 +2 AceView intron 69723213 69732700 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69723117 69723212 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 17 +2 AceView exon 69723117 69723212 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 17 +2 AceView intron 69709945 69723116 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; type gt_ag +2 AceView CDS 69709721 69709944 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; exon_number 18 +2 AceView exon 69709670 69709944 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; exon_number 18 +2 AceView stop_codon 69709718 69709720 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.bAug10; product_id AAK1.bAug10; +2 AceView exon 69870707 69870849 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 1 +2 AceView intron 69870407 69870706 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView start_codon 69870170 69870172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; +2 AceView CDS 69870010 69870172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 2 +2 AceView exon 69870010 69870406 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 2 +2 AceView intron 69784111 69870009 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69783992 69784110 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 3 +2 AceView exon 69783992 69784110 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 3 +2 AceView intron 69771677 69783991 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69771568 69771676 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 4 +2 AceView exon 69771568 69771676 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 4 +2 AceView intron 69769798 69771567 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69769655 69769797 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 5 +2 AceView exon 69769655 69769797 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 5 +2 AceView intron 69759295 69769654 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69759173 69759294 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 6 +2 AceView exon 69759173 69759294 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 6 +2 AceView intron 69757839 69759172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69757757 69757838 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 7 +2 AceView exon 69757757 69757838 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 7 +2 AceView intron 69757273 69757756 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69757140 69757272 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 8 +2 AceView exon 69757140 69757272 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 8 +2 AceView intron 69754452 69757139 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69754348 69754451 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 9 +2 AceView exon 69754348 69754451 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 9 +2 AceView intron 69752245 69754347 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69752165 69752244 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 10 +2 AceView exon 69752165 69752244 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 10 +2 AceView intron 69748121 69752164 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69747966 69748120 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 11 +2 AceView exon 69747966 69748120 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 11 +2 AceView intron 69746373 69747965 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69746086 69746372 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 12 +2 AceView exon 69746086 69746372 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 12 +2 AceView intron 69741882 69746085 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69741603 69741881 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 13 +2 AceView exon 69741603 69741881 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 13 +2 AceView intron 69736593 69741602 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69736363 69736592 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 14 +2 AceView exon 69736363 69736592 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 14 +2 AceView intron 69734711 69736362 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69734553 69734710 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 15 +2 AceView exon 69734553 69734710 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 15 +2 AceView intron 69732806 69734552 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69732701 69732805 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 16 +2 AceView exon 69732701 69732805 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 16 +2 AceView intron 69723213 69732700 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69723117 69723212 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 17 +2 AceView exon 69723117 69723212 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 17 +2 AceView intron 69709945 69723116 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; type gt_ag +2 AceView CDS 69709721 69709944 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; exon_number 18 +2 AceView exon 69708188 69709944 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; exon_number 18 +2 AceView stop_codon 69709718 69709720 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.cAug10; product_id AAK1.cAug10; +2 AceView exon 69870707 69870785 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 1 +2 AceView intron 69870407 69870706 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView start_codon 69870170 69870172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; +2 AceView CDS 69870010 69870172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 2 +2 AceView exon 69870010 69870406 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 2 +2 AceView intron 69784111 69870009 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView CDS 69783992 69784110 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 3 +2 AceView exon 69783992 69784110 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 3 +2 AceView intron 69771677 69783991 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView CDS 69771568 69771676 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 4 +2 AceView exon 69771568 69771676 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 4 +2 AceView intron 69769798 69771567 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView CDS 69769655 69769797 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 5 +2 AceView exon 69769655 69769797 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 5 +2 AceView intron 69759295 69769654 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView CDS 69759173 69759294 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 6 +2 AceView exon 69759173 69759294 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 6 +2 AceView intron 69757839 69759172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView CDS 69757757 69757838 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 7 +2 AceView exon 69757757 69757838 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 7 +2 AceView intron 69757273 69757756 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView CDS 69757140 69757272 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 8 +2 AceView exon 69757140 69757272 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 8 +2 AceView intron 69754452 69757139 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView CDS 69754348 69754451 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 9 +2 AceView exon 69754348 69754451 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 9 +2 AceView intron 69752245 69754347 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView CDS 69752165 69752244 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 10 +2 AceView exon 69752165 69752244 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 10 +2 AceView intron 69748121 69752164 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView CDS 69747966 69748120 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 11 +2 AceView exon 69747966 69748120 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 11 +2 AceView intron 69746373 69747965 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView CDS 69746086 69746372 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 12 +2 AceView exon 69746086 69746372 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 12 +2 AceView intron 69741882 69746085 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView CDS 69741603 69741881 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 13 +2 AceView exon 69741603 69741881 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 13 +2 AceView intron 69736593 69741602 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gt_ag +2 AceView CDS 69736389 69736592 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 14 +2 AceView exon 69736389 69736592 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 14 +2 AceView intron 69688844 69736388 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; type gc_ag +2 AceView CDS 69688802 69688843 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; exon_number 15 +2 AceView exon 69688532 69688843 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; exon_number 15 +2 AceView stop_codon 69688799 69688801 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.dAug10; product_id AAK1.dAug10; +2 AceView CDS 69692560 69693663 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.eAug10; product_id AAK1.eAug10; exon_number 1 +2 AceView exon 69692432 69693664 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.eAug10; exon_number 1 +2 AceView stop_codon 69692557 69692559 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.eAug10; product_id AAK1.eAug10; +2 AceView intron 69688838 69692431 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.eAug10; type gc_ag +2 AceView exon 69685127 69688837 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.eAug10; exon_number 2 +2 AceView CDS 69870454 69871218 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.fAug10-unspliced; product_id AAK1.fAug10-unspliced; exon_number 1 +2 AceView exon 69870238 69871218 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.fAug10-unspliced; exon_number 1 +2 AceView stop_codon 69870451 69870453 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.fAug10-unspliced; product_id AAK1.fAug10-unspliced; +2 AceView exon 69771568 69771641 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; exon_number 1 +2 AceView intron 69769798 69771567 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; type gt_ag +2 AceView exon 69769655 69769797 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; exon_number 2 +2 AceView intron 69759295 69769654 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; type gt_ag +2 AceView exon 69758733 69759294 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; exon_number 3 +2 AceView intron 69757839 69758732 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; type gt_ag +2 AceView start_codon 69757805 69757807 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; product_id AAK1.gAug10; +2 AceView CDS 69757757 69757807 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; product_id AAK1.gAug10; exon_number 4 +2 AceView exon 69757757 69757838 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; exon_number 4 +2 AceView intron 69757273 69757756 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; type gt_ag +2 AceView CDS 69757140 69757272 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; product_id AAK1.gAug10; exon_number 5 +2 AceView exon 69757140 69757272 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; exon_number 5 +2 AceView intron 69754452 69757139 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; type gt_ag +2 AceView CDS 69754348 69754451 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; product_id AAK1.gAug10; exon_number 6 +2 AceView exon 69754348 69754451 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; exon_number 6 +2 AceView intron 69752245 69754347 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; type gt_ag +2 AceView CDS 69752165 69752244 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; product_id AAK1.gAug10; exon_number 7 +2 AceView exon 69752165 69752244 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; exon_number 7 +2 AceView intron 69748121 69752164 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; type gt_ag +2 AceView CDS 69748060 69748120 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; product_id AAK1.gAug10; exon_number 8 +2 AceView exon 69748060 69748120 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.gAug10; exon_number 8 +2 AceView exon 69870707 69870780 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.hAug10; exon_number 1 +2 AceView intron 69870407 69870706 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.hAug10; type gt_ag +2 AceView start_codon 69870170 69870172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.hAug10; product_id AAK1.hAug10; +2 AceView CDS 69870010 69870172 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.hAug10; product_id AAK1.hAug10; exon_number 2 +2 AceView exon 69870010 69870406 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.hAug10; exon_number 2 +2 AceView intron 69784111 69870009 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.hAug10; type gt_ag +2 AceView CDS 69783992 69784110 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.hAug10; product_id AAK1.hAug10; exon_number 3 +2 AceView exon 69783992 69784110 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.hAug10; exon_number 3 +2 AceView intron 69771677 69783991 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.hAug10; type gt_ag +2 AceView CDS 69771530 69771676 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.hAug10; product_id AAK1.hAug10; exon_number 4 +2 AceView exon 69771143 69771676 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.hAug10; exon_number 4 +2 AceView stop_codon 69771527 69771529 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.hAug10; product_id AAK1.hAug10; +2 AceView CDS 69901155 69901482 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.iAug10; product_id AAK1.iAug10; exon_number 1 +2 AceView exon 69901155 69901482 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.iAug10; exon_number 1 +2 AceView intron 69870407 69901154 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.iAug10; type gt_ag +2 AceView CDS 69870354 69870406 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.iAug10; product_id AAK1.iAug10; exon_number 2 +2 AceView exon 69870218 69870406 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.iAug10; exon_number 2 +2 AceView stop_codon 69870351 69870353 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.iAug10; product_id AAK1.iAug10; +2 AceView start_codon 69708053 69708055 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; product_id AAK1.jAug10; +2 AceView CDS 69707992 69708055 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; product_id AAK1.jAug10; exon_number 1 +2 AceView exon 69707992 69708174 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; exon_number 1 +2 AceView intron 69706194 69707991 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; type gt_ag +2 AceView CDS 69706083 69706193 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; product_id AAK1.jAug10; exon_number 2 +2 AceView exon 69706083 69706193 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; exon_number 2 +2 AceView intron 69704123 69706082 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; type gt_ag +2 AceView CDS 69704012 69704122 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; product_id AAK1.jAug10; exon_number 3 +2 AceView exon 69704012 69704122 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; exon_number 3 +2 AceView intron 69703096 69704011 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; type gt_ag +2 AceView CDS 69703004 69703095 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; product_id AAK1.jAug10; exon_number 4 +2 AceView exon 69702852 69703095 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; exon_number 4 +2 AceView stop_codon 69703001 69703003 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.jAug10; product_id AAK1.jAug10; +2 AceView CDS 69710261 69710563 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.kAug10-unspliced; product_id AAK1.kAug10-unspliced; exon_number 1 +2 AceView exon 69709896 69710563 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.kAug10-unspliced; exon_number 1 +2 AceView stop_codon 69710258 69710260 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.kAug10-unspliced; product_id AAK1.kAug10-unspliced; +2 AceView CDS 69870875 69871083 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.lAug10; product_id AAK1.lAug10; exon_number 1 +2 AceView exon 69870875 69871084 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.lAug10; exon_number 1 +2 AceView intron 69870407 69870874 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.lAug10; type gt_ag +2 AceView CDS 69870337 69870406 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.lAug10; product_id AAK1.lAug10; exon_number 2 +2 AceView exon 69870183 69870406 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.lAug10; exon_number 2 +2 AceView stop_codon 69870334 69870336 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.lAug10; product_id AAK1.lAug10; +2 AceView exon 69731836 69735403 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.mAug10-unspliced; exon_number 1 +2 AceView exon 69735378 69735420 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.nAug10; exon_number 1 +2 AceView intron 69734711 69735377 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.nAug10; type gt_ag +2 AceView exon 69734553 69734710 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.nAug10; exon_number 2 +2 AceView intron 69732806 69734552 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.nAug10; type gt_ag +2 AceView exon 69732701 69732805 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.nAug10; exon_number 3 +2 AceView intron 69723213 69732700 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.nAug10; type gt_ag +2 AceView exon 69722212 69723212 . - 0 gene_id AAK1; Gene_type cDNA_supported; transcript_id AAK1.nAug10; exon_number 4 +2 AceView start_codon 219134807 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; +2 AceView CDS 219134689 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; exon_number 1 +2 AceView exon 219134689 219134860 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; exon_number 1 +2 AceView intron 219134261 219134688 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; type gt_ag +2 AceView CDS 219134105 219134260 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; exon_number 2 +2 AceView exon 219134105 219134260 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; exon_number 2 +2 AceView intron 219132337 219134104 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; type gt_ag +2 AceView CDS 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; exon_number 3 +2 AceView exon 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; exon_number 3 +2 AceView intron 219131710 219132216 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; type gt_ag +2 AceView CDS 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; exon_number 4 +2 AceView exon 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; exon_number 4 +2 AceView intron 219131311 219131569 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; type gt_ag +2 AceView CDS 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; exon_number 5 +2 AceView exon 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; exon_number 5 +2 AceView intron 219130871 219131165 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; type gt_ag +2 AceView CDS 219130778 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; exon_number 6 +2 AceView exon 219130778 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; exon_number 6 +2 AceView intron 219130670 219130777 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; type gt_ag +2 AceView CDS 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; exon_number 7 +2 AceView exon 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; exon_number 7 +2 AceView intron 219130406 219130553 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; type gt_ag +2 AceView CDS 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; exon_number 8 +2 AceView exon 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; exon_number 8 +2 AceView intron 219130185 219130301 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; type gt_ag +2 AceView CDS 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; exon_number 9 +2 AceView exon 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; exon_number 9 +2 AceView intron 219129898 219130093 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; type gt_ag +2 AceView CDS 219129743 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; exon_number 10 +2 AceView exon 219129743 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; exon_number 10 +2 AceView intron 219129332 219129742 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; type gt_ag +2 AceView CDS 219129259 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; exon_number 11 +2 AceView exon 219129090 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; exon_number 11 +2 AceView stop_codon 219129256 219129258 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.aAug10; product_id AAMP.aAug10; +2 AceView start_codon 219134807 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; +2 AceView CDS 219134689 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; exon_number 1 +2 AceView exon 219134689 219134979 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; exon_number 1 +2 AceView intron 219134258 219134688 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; type gt_ag +2 AceView CDS 219134105 219134257 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; exon_number 2 +2 AceView exon 219134105 219134257 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; exon_number 2 +2 AceView intron 219132337 219134104 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; type gt_ag +2 AceView CDS 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; exon_number 3 +2 AceView exon 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; exon_number 3 +2 AceView intron 219131710 219132216 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; type gt_ag +2 AceView CDS 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; exon_number 4 +2 AceView exon 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; exon_number 4 +2 AceView intron 219131311 219131569 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; type gt_ag +2 AceView CDS 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; exon_number 5 +2 AceView exon 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; exon_number 5 +2 AceView intron 219130871 219131165 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; type gt_ag +2 AceView CDS 219130778 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; exon_number 6 +2 AceView exon 219130778 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; exon_number 6 +2 AceView intron 219130670 219130777 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; type gt_ag +2 AceView CDS 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; exon_number 7 +2 AceView exon 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; exon_number 7 +2 AceView intron 219130406 219130553 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; type gt_ag +2 AceView CDS 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; exon_number 8 +2 AceView exon 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; exon_number 8 +2 AceView intron 219130185 219130301 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; type gt_ag +2 AceView CDS 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; exon_number 9 +2 AceView exon 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; exon_number 9 +2 AceView intron 219129898 219130093 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; type gt_ag +2 AceView CDS 219129743 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; exon_number 10 +2 AceView exon 219129743 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; exon_number 10 +2 AceView intron 219129332 219129742 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; type gt_ag +2 AceView CDS 219129259 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; exon_number 11 +2 AceView exon 219129238 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; exon_number 11 +2 AceView stop_codon 219129256 219129258 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; product_id AAMP.bAug10; +2 AceView intron 219129090 219129237 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; type gt_ag +2 AceView exon 219128852 219129089 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.bAug10; exon_number 12 +2 AceView start_codon 219134807 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; +2 AceView CDS 219134689 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; exon_number 1 +2 AceView exon 219134689 219134882 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; exon_number 1 +2 AceView intron 219134261 219134688 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; type gt_ag +2 AceView CDS 219134105 219134260 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; exon_number 2 +2 AceView exon 219134105 219134260 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; exon_number 2 +2 AceView intron 219132337 219134104 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; type gt_ag +2 AceView CDS 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; exon_number 3 +2 AceView exon 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; exon_number 3 +2 AceView intron 219131710 219132216 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; type gt_ag +2 AceView CDS 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; exon_number 4 +2 AceView exon 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; exon_number 4 +2 AceView intron 219131311 219131569 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; type gt_ag +2 AceView CDS 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; exon_number 5 +2 AceView exon 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; exon_number 5 +2 AceView intron 219130871 219131165 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; type gt_ag +2 AceView CDS 219130787 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; exon_number 6 +2 AceView exon 219130787 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; exon_number 6 +2 AceView intron 219130670 219130786 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; type gt_ag +2 AceView CDS 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; exon_number 7 +2 AceView exon 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; exon_number 7 +2 AceView intron 219130406 219130553 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; type gt_ag +2 AceView CDS 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; exon_number 8 +2 AceView exon 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; exon_number 8 +2 AceView intron 219130185 219130301 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; type gt_ag +2 AceView CDS 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; exon_number 9 +2 AceView exon 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; exon_number 9 +2 AceView intron 219129898 219130093 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; type gt_ag +2 AceView CDS 219129743 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; exon_number 10 +2 AceView exon 219129743 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; exon_number 10 +2 AceView intron 219129332 219129742 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; type gt_ag +2 AceView CDS 219129259 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; exon_number 11 +2 AceView exon 219128851 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; exon_number 11 +2 AceView stop_codon 219129256 219129258 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.cAug10; product_id AAMP.cAug10; +2 AceView start_codon 219134807 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; +2 AceView CDS 219134689 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; exon_number 1 +2 AceView exon 219134689 219134893 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; exon_number 1 +2 AceView intron 219134258 219134688 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; type gt_ag +2 AceView CDS 219134105 219134257 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; exon_number 2 +2 AceView exon 219134105 219134257 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; exon_number 2 +2 AceView intron 219132337 219134104 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; type gt_ag +2 AceView CDS 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; exon_number 3 +2 AceView exon 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; exon_number 3 +2 AceView intron 219131710 219132216 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; type gt_ag +2 AceView CDS 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; exon_number 4 +2 AceView exon 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; exon_number 4 +2 AceView intron 219131311 219131569 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; type gt_ag +2 AceView CDS 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; exon_number 5 +2 AceView exon 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; exon_number 5 +2 AceView intron 219130871 219131165 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; type gt_ag +2 AceView CDS 219130787 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; exon_number 6 +2 AceView exon 219130787 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; exon_number 6 +2 AceView intron 219130670 219130786 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; type gt_ag +2 AceView CDS 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; exon_number 7 +2 AceView exon 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; exon_number 7 +2 AceView intron 219130406 219130553 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; type gt_ag +2 AceView CDS 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; exon_number 8 +2 AceView exon 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; exon_number 8 +2 AceView intron 219130185 219130301 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; type gt_ag +2 AceView CDS 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; exon_number 9 +2 AceView exon 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; exon_number 9 +2 AceView intron 219129898 219130093 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; type gt_ag +2 AceView CDS 219129743 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; exon_number 10 +2 AceView exon 219129743 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; exon_number 10 +2 AceView intron 219129332 219129742 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; type gt_ag +2 AceView CDS 219129259 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; exon_number 11 +2 AceView exon 219128853 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; exon_number 11 +2 AceView stop_codon 219129256 219129258 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.dAug10; product_id AAMP.dAug10; +2 AceView start_codon 219134319 219134321 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; product_id AAMP.eAug10; +2 AceView CDS 219134105 219134321 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; product_id AAMP.eAug10; exon_number 1 +2 AceView exon 219134105 219134860 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; exon_number 1 +2 AceView intron 219132337 219134104 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; type gt_ag +2 AceView CDS 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; product_id AAMP.eAug10; exon_number 2 +2 AceView exon 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; exon_number 2 +2 AceView intron 219131710 219132216 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; type gt_ag +2 AceView CDS 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; product_id AAMP.eAug10; exon_number 3 +2 AceView exon 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; exon_number 3 +2 AceView intron 219131311 219131569 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; type gt_ag +2 AceView CDS 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; product_id AAMP.eAug10; exon_number 4 +2 AceView exon 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; exon_number 4 +2 AceView intron 219130871 219131165 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; type gt_ag +2 AceView CDS 219130787 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; product_id AAMP.eAug10; exon_number 5 +2 AceView exon 219130787 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; exon_number 5 +2 AceView intron 219130670 219130786 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; type gt_ag +2 AceView CDS 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; product_id AAMP.eAug10; exon_number 6 +2 AceView exon 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; exon_number 6 +2 AceView intron 219130406 219130553 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; type gt_ag +2 AceView CDS 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; product_id AAMP.eAug10; exon_number 7 +2 AceView exon 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; exon_number 7 +2 AceView intron 219130185 219130301 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; type gt_ag +2 AceView CDS 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; product_id AAMP.eAug10; exon_number 8 +2 AceView exon 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; exon_number 8 +2 AceView intron 219129898 219130093 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; type gt_ag +2 AceView CDS 219129743 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; product_id AAMP.eAug10; exon_number 9 +2 AceView exon 219129743 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; exon_number 9 +2 AceView intron 219129332 219129742 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; type gt_ag +2 AceView CDS 219129259 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; product_id AAMP.eAug10; exon_number 10 +2 AceView exon 219128885 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; exon_number 10 +2 AceView stop_codon 219129256 219129258 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.eAug10; product_id AAMP.eAug10; +2 AceView start_codon 219134807 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; product_id AAMP.fAug10; +2 AceView CDS 219134689 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; product_id AAMP.fAug10; exon_number 1 +2 AceView exon 219134689 219134811 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; exon_number 1 +2 AceView intron 219134261 219134688 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; type gt_ag +2 AceView CDS 219134105 219134260 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; product_id AAMP.fAug10; exon_number 2 +2 AceView exon 219134105 219134260 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; exon_number 2 +2 AceView intron 219132337 219134104 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; type gt_ag +2 AceView CDS 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; product_id AAMP.fAug10; exon_number 3 +2 AceView exon 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; exon_number 3 +2 AceView intron 219131710 219132216 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; type gt_ag +2 AceView CDS 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; product_id AAMP.fAug10; exon_number 4 +2 AceView exon 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; exon_number 4 +2 AceView intron 219131311 219131569 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; type gt_ag +2 AceView CDS 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; product_id AAMP.fAug10; exon_number 5 +2 AceView exon 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; exon_number 5 +2 AceView intron 219130871 219131165 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; type gt_ag +2 AceView CDS 219130787 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; product_id AAMP.fAug10; exon_number 6 +2 AceView exon 219130787 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; exon_number 6 +2 AceView intron 219130670 219130786 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; type gt_ag +2 AceView CDS 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; product_id AAMP.fAug10; exon_number 7 +2 AceView exon 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; exon_number 7 +2 AceView intron 219130406 219130553 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; type gt_ag +2 AceView CDS 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; product_id AAMP.fAug10; exon_number 8 +2 AceView exon 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; exon_number 8 +2 AceView intron 219130185 219130301 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; type gt_ag +2 AceView CDS 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; product_id AAMP.fAug10; exon_number 9 +2 AceView exon 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; exon_number 9 +2 AceView intron 219129898 219130093 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; type gt_ag +2 AceView CDS 219129742 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; product_id AAMP.fAug10; exon_number 10 +2 AceView exon 219129739 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; exon_number 10 +2 AceView stop_codon 219129739 219129741 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; product_id AAMP.fAug10; +2 AceView intron 219129332 219129738 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; type gt_ag +2 AceView exon 219128883 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.fAug10; exon_number 11 +2 AceView start_codon 219134807 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; product_id AAMP.gAug10; +2 AceView CDS 219134689 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; product_id AAMP.gAug10; exon_number 1 +2 AceView exon 219134689 219134857 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; exon_number 1 +2 AceView intron 219134258 219134688 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; type gt_ag +2 AceView CDS 219134105 219134257 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; product_id AAMP.gAug10; exon_number 2 +2 AceView exon 219134105 219134257 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; exon_number 2 +2 AceView intron 219132337 219134104 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; type gt_ag +2 AceView CDS 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; product_id AAMP.gAug10; exon_number 3 +2 AceView exon 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; exon_number 3 +2 AceView intron 219131710 219132216 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; type gt_ag +2 AceView CDS 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; product_id AAMP.gAug10; exon_number 4 +2 AceView exon 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; exon_number 4 +2 AceView intron 219131311 219131569 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; type gt_ag +2 AceView CDS 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; product_id AAMP.gAug10; exon_number 5 +2 AceView exon 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; exon_number 5 +2 AceView intron 219130871 219131165 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; type gt_ag +2 AceView CDS 219130787 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; product_id AAMP.gAug10; exon_number 6 +2 AceView exon 219130787 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; exon_number 6 +2 AceView intron 219130670 219130786 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; type gt_ag +2 AceView CDS 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; product_id AAMP.gAug10; exon_number 7 +2 AceView exon 219130554 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; exon_number 7 +2 AceView intron 219130406 219130553 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; type gt_ag +2 AceView CDS 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; product_id AAMP.gAug10; exon_number 8 +2 AceView exon 219130302 219130405 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; exon_number 8 +2 AceView intron 219130185 219130301 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; type gt_ag +2 AceView CDS 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; product_id AAMP.gAug10; exon_number 9 +2 AceView exon 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; exon_number 9 +2 AceView intron 219129898 219130093 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; type gt_ag +2 AceView CDS 219129742 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; product_id AAMP.gAug10; exon_number 10 +2 AceView exon 219129739 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; exon_number 10 +2 AceView stop_codon 219129739 219129741 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; product_id AAMP.gAug10; +2 AceView intron 219129332 219129738 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; type gt_ag +2 AceView exon 219128853 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.gAug10; exon_number 11 +2 AceView start_codon 219134807 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; product_id AAMP.hAug10; +2 AceView CDS 219134689 219134809 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; product_id AAMP.hAug10; exon_number 1 +2 AceView exon 219134689 219134843 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; exon_number 1 +2 AceView intron 219134258 219134688 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; type gt_ag +2 AceView CDS 219134105 219134257 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; product_id AAMP.hAug10; exon_number 2 +2 AceView exon 219134105 219134257 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; exon_number 2 +2 AceView intron 219132337 219134104 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; type gt_ag +2 AceView CDS 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; product_id AAMP.hAug10; exon_number 3 +2 AceView exon 219132217 219132336 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; exon_number 3 +2 AceView intron 219131710 219132216 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; type gt_ag +2 AceView CDS 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; product_id AAMP.hAug10; exon_number 4 +2 AceView exon 219131570 219131709 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; exon_number 4 +2 AceView intron 219131311 219131569 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; type gt_ag +2 AceView CDS 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; product_id AAMP.hAug10; exon_number 5 +2 AceView exon 219131166 219131310 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; exon_number 5 +2 AceView intron 219130871 219131165 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; type gt_ag +2 AceView CDS 219130787 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; product_id AAMP.hAug10; exon_number 6 +2 AceView exon 219130787 219130870 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; exon_number 6 +2 AceView intron 219130670 219130786 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; type gt_ag +2 AceView CDS 219130392 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; product_id AAMP.hAug10; exon_number 7 +2 AceView exon 219130302 219130669 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; exon_number 7 +2 AceView stop_codon 219130389 219130391 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; product_id AAMP.hAug10; +2 AceView intron 219130185 219130301 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; type gt_ag +2 AceView exon 219130094 219130184 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; exon_number 8 +2 AceView intron 219129898 219130093 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; type gt_ag +2 AceView exon 219129743 219129897 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; exon_number 9 +2 AceView intron 219129332 219129742 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; type gt_ag +2 AceView exon 219128853 219129331 . - 0 gene_id AAMP; Gene_type cDNA_supported; transcript_id AAMP.hAug10; exon_number 10
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/ens_mm9_chr18.gff3 Thu Apr 23 17:57:49 2015 -0400 @@ -0,0 +1,1165 @@ +##gff-version 3 +18 lincRNA gene 3336414 3366861 . + . ID=ENSMUSG00000091488;Name=AC124336.2 +18 lincRNA transcript 3336414 3366861 . + . ID=ENSMUST00000171726;Parent=ENSMUSG00000091488;Name=AC124336.2-201 +18 lincRNA exon 3336414 3337176 . + . Parent=ENSMUST00000171726 +18 lincRNA exon 3365925 3366861 . + . Parent=ENSMUST00000171726 +18 protein_coding gene 9314042 9450148 . - . ID=ENSMUSG00000024286;Name=Ccny +18 protein_coding mRNA 9314042 9450148 . - . ID=ENSMUST00000053917;Parent=ENSMUSG00000024286;Name=Ccny-201 +18 protein_coding five_prime_UTR 9449670 9450148 . - . Parent=ENSMUST00000053917 +18 protein_coding CDS 9316554 9316670 . - 0 Parent=ENSMUST00000053917 +18 protein_coding CDS 9319407 9319569 . - 1 Parent=ENSMUST00000053917 +18 protein_coding CDS 9332782 9332948 . - 0 Parent=ENSMUST00000053917 +18 protein_coding CDS 9345192 9345311 . - 0 Parent=ENSMUST00000053917 +18 protein_coding CDS 9345412 9345469 . - 1 Parent=ENSMUST00000053917 +18 protein_coding CDS 9349386 9349421 . - 1 Parent=ENSMUST00000053917 +18 protein_coding CDS 9353405 9353505 . - 0 Parent=ENSMUST00000053917 +18 protein_coding CDS 9377792 9377826 . - 2 Parent=ENSMUST00000053917 +18 protein_coding CDS 9386733 9386807 . - 2 Parent=ENSMUST00000053917 +18 protein_coding CDS 9449516 9449669 . - 0 Parent=ENSMUST00000053917 +18 protein_coding three_prime_UTR 9314042 9316553 . - . Parent=ENSMUST00000053917 +18 protein_coding exon 9314042 9316670 . - . Parent=ENSMUST00000053917 +18 protein_coding exon 9319407 9319569 . - . Parent=ENSMUST00000053917 +18 protein_coding exon 9332782 9332948 . - . Parent=ENSMUST00000053917 +18 protein_coding exon 9345192 9345311 . - . Parent=ENSMUST00000053917 +18 protein_coding exon 9345412 9345469 . - . Parent=ENSMUST00000053917 +18 protein_coding exon 9349386 9349421 . - . Parent=ENSMUST00000053917 +18 protein_coding exon 9353405 9353505 . - . Parent=ENSMUST00000053917 +18 protein_coding exon 9377792 9377826 . - . Parent=ENSMUST00000053917 +18 protein_coding exon 9386733 9386807 . - . Parent=ENSMUST00000053917 +18 protein_coding exon 9449516 9450148 . - . Parent=ENSMUST00000053917 +18 protein_coding mRNA 9314042 9450148 . - . ID=ENSMUST00000115867;Parent=ENSMUSG00000024286;Name=Ccny-202 +18 protein_coding five_prime_UTR 9449670 9450148 . - . Parent=ENSMUST00000115867 +18 protein_coding CDS 9316554 9316670 . - 0 Parent=ENSMUST00000115867 +18 protein_coding CDS 9319407 9319569 . - 1 Parent=ENSMUST00000115867 +18 protein_coding CDS 9332782 9332948 . - 0 Parent=ENSMUST00000115867 +18 protein_coding CDS 9345192 9345311 . - 0 Parent=ENSMUST00000115867 +18 protein_coding CDS 9345412 9345469 . - 1 Parent=ENSMUST00000115867 +18 protein_coding CDS 9349386 9349421 . - 1 Parent=ENSMUST00000115867 +18 protein_coding CDS 9353405 9353505 . - 0 Parent=ENSMUST00000115867 +18 protein_coding CDS 9377792 9377826 . - 2 Parent=ENSMUST00000115867 +18 protein_coding CDS 9449516 9449669 . - 0 Parent=ENSMUST00000115867 +18 protein_coding three_prime_UTR 9314042 9316553 . - . Parent=ENSMUST00000115867 +18 protein_coding exon 9314042 9316670 . - . Parent=ENSMUST00000115867 +18 protein_coding exon 9319407 9319569 . - . Parent=ENSMUST00000115867 +18 protein_coding exon 9332782 9332948 . - . Parent=ENSMUST00000115867 +18 protein_coding exon 9345192 9345311 . - . Parent=ENSMUST00000115867 +18 protein_coding exon 9345412 9345469 . - . Parent=ENSMUST00000115867 +18 protein_coding exon 9349386 9349421 . - . Parent=ENSMUST00000115867 +18 protein_coding exon 9353405 9353505 . - . Parent=ENSMUST00000115867 +18 protein_coding exon 9377792 9377826 . - . Parent=ENSMUST00000115867 +18 protein_coding exon 9449516 9450148 . - . Parent=ENSMUST00000115867 +18 miRNA gene 10782897 10782983 . - . ID=ENSMUSG00000065399;Name=Mir133a-1 +18 miRNA transcript 10782897 10782983 . - . ID=ENSMUST00000083465;Parent=ENSMUSG00000065399;Name=Mir133a-1-201 +18 miRNA exon 10782897 10782983 . - . Parent=ENSMUST00000083465 +18 protein_coding gene 9726195 9726668 . - . ID=ENSMUSG00000091285;Name=AC163101.1 +18 protein_coding mRNA 9726195 9726668 . - . ID=ENSMUST00000171339;Parent=ENSMUSG00000091285;Name=AC163101.1-201 +18 protein_coding CDS 9726195 9726668 . - 0 Parent=ENSMUST00000171339 +18 protein_coding exon 9726195 9726668 . - . Parent=ENSMUST00000171339 +18 protein_coding gene 10064399 10181790 . - . ID=ENSMUSG00000024290;Name=Rock1 +18 protein_coding mRNA 10064399 10181790 . - . ID=ENSMUST00000067947;Parent=ENSMUSG00000024290;Name=Rock1-201 +18 protein_coding five_prime_UTR 10181316 10181790 . - . Parent=ENSMUST00000067947 +18 protein_coding CDS 10066046 10066049 . - 1 Parent=ENSMUST00000067947 +18 protein_coding CDS 10067469 10067676 . - 2 Parent=ENSMUST00000067947 +18 protein_coding CDS 10070217 10070478 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10070620 10070698 . - 1 Parent=ENSMUST00000067947 +18 protein_coding CDS 10072830 10072918 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10073113 10073183 . - 2 Parent=ENSMUST00000067947 +18 protein_coding CDS 10079113 10079272 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10080349 10080537 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10083120 10083208 . - 2 Parent=ENSMUST00000067947 +18 protein_coding CDS 10084316 10084409 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10090811 10090976 . - 1 Parent=ENSMUST00000067947 +18 protein_coding CDS 10092127 10092221 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10093906 10093975 . - 1 Parent=ENSMUST00000067947 +18 protein_coding CDS 10095411 10095595 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10097481 10097641 . - 2 Parent=ENSMUST00000067947 +18 protein_coding CDS 10099255 10099405 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10100920 10101026 . - 2 Parent=ENSMUST00000067947 +18 protein_coding CDS 10104072 10104318 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10104416 10104507 . - 2 Parent=ENSMUST00000067947 +18 protein_coding CDS 10106320 10106455 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10112342 10112390 . - 1 Parent=ENSMUST00000067947 +18 protein_coding CDS 10116772 10116860 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10119883 10119943 . - 1 Parent=ENSMUST00000067947 +18 protein_coding CDS 10122607 10122766 . - 2 Parent=ENSMUST00000067947 +18 protein_coding CDS 10129303 10129394 . - 1 Parent=ENSMUST00000067947 +18 protein_coding CDS 10131528 10131666 . - 2 Parent=ENSMUST00000067947 +18 protein_coding CDS 10132126 10132270 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10134414 10134498 . - 1 Parent=ENSMUST00000067947 +18 protein_coding CDS 10136094 10136269 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10140174 10140311 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10140786 10140886 . - 2 Parent=ENSMUST00000067947 +18 protein_coding CDS 10150233 10150314 . - 0 Parent=ENSMUST00000067947 +18 protein_coding CDS 10181223 10181315 . - 0 Parent=ENSMUST00000067947 +18 protein_coding three_prime_UTR 10064399 10066045 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10064399 10066049 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10067469 10067676 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10070217 10070478 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10070620 10070698 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10072830 10072918 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10073113 10073183 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10079113 10079272 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10080349 10080537 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10083120 10083208 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10084316 10084409 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10090811 10090976 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10092127 10092221 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10093906 10093975 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10095411 10095595 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10097481 10097641 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10099255 10099405 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10100920 10101026 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10104072 10104318 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10104416 10104507 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10106320 10106455 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10112342 10112390 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10116772 10116860 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10119883 10119943 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10122607 10122766 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10129303 10129394 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10131528 10131666 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10132126 10132270 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10134414 10134498 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10136094 10136269 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10140174 10140311 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10140786 10140886 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10150233 10150314 . - . Parent=ENSMUST00000067947 +18 protein_coding exon 10181223 10181790 . - . Parent=ENSMUST00000067947 +18 miRNA gene 3398783 3398904 . - . ID=ENSMUSG00000080475;Name=AC124336.1 +18 miRNA transcript 3398783 3398904 . - . ID=ENSMUST00000116825;Parent=ENSMUSG00000080475;Name=AC124336.1-201 +18 miRNA exon 3398783 3398904 . - . Parent=ENSMUST00000116825 +18 protein_coding gene 10725546 10755697 . + . ID=ENSMUSG00000024294;Name=Mib1 +18 protein_coding mRNA 10760807 10818702 . + . ID=ENSMUST00000124288;Parent=ENSMUSG00000024294;Name=Mib1-004 +18 protein_coding CDS 10760807 10760946 . + 0 Parent=ENSMUST00000124288 +18 protein_coding CDS 10763187 10763320 . + 1 Parent=ENSMUST00000124288 +18 protein_coding CDS 10768122 10768229 . + 2 Parent=ENSMUST00000124288 +18 protein_coding CDS 10775527 10775724 . + 2 Parent=ENSMUST00000124288 +18 protein_coding CDS 10778147 10778298 . + 2 Parent=ENSMUST00000124288 +18 protein_coding CDS 10792893 10793025 . + 0 Parent=ENSMUST00000124288 +18 protein_coding CDS 10794476 10794562 . + 2 Parent=ENSMUST00000124288 +18 protein_coding CDS 10795688 10795849 . + 2 Parent=ENSMUST00000124288 +18 protein_coding CDS 10798350 10798531 . + 2 Parent=ENSMUST00000124288 +18 protein_coding CDS 10800054 10800246 . + 0 Parent=ENSMUST00000124288 +18 protein_coding CDS 10802259 10802337 . + 2 Parent=ENSMUST00000124288 +18 protein_coding CDS 10804685 10804798 . + 1 Parent=ENSMUST00000124288 +18 protein_coding CDS 10808032 10808132 . + 1 Parent=ENSMUST00000124288 +18 protein_coding CDS 10811983 10812123 . + 2 Parent=ENSMUST00000124288 +18 protein_coding three_prime_UTR 10812124 10812154 . + . Parent=ENSMUST00000124288 +18 protein_coding three_prime_UTR 10817817 10818702 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10760807 10760946 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10763187 10763320 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10768122 10768229 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10775527 10775724 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10778147 10778298 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10792893 10793025 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10794476 10794562 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10795688 10795849 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10798350 10798531 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10800054 10800246 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10802259 10802337 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10804685 10804798 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10808032 10808132 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10811983 10812154 . + . Parent=ENSMUST00000124288 +18 protein_coding exon 10817817 10818702 . + . Parent=ENSMUST00000124288 +18 protein_coding mRNA 10798363 10817626 . + . ID=ENSMUST00000150000;Parent=ENSMUSG00000024294;Name=Mib1-002 +18 protein_coding CDS 10798363 10798531 . + 0 Parent=ENSMUST00000150000 +18 protein_coding CDS 10800054 10800246 . + 2 Parent=ENSMUST00000150000 +18 protein_coding CDS 10802259 10802337 . + 1 Parent=ENSMUST00000150000 +18 protein_coding CDS 10804685 10804798 . + 0 Parent=ENSMUST00000150000 +18 protein_coding CDS 10808032 10808132 . + 0 Parent=ENSMUST00000150000 +18 protein_coding CDS 10811983 10812123 . + 1 Parent=ENSMUST00000150000 +18 protein_coding three_prime_UTR 10812124 10812154 . + . Parent=ENSMUST00000150000 +18 protein_coding three_prime_UTR 10815734 10817626 . + . Parent=ENSMUST00000150000 +18 protein_coding exon 10798363 10798531 . + . Parent=ENSMUST00000150000 +18 protein_coding exon 10800054 10800246 . + . Parent=ENSMUST00000150000 +18 protein_coding exon 10802259 10802337 . + . Parent=ENSMUST00000150000 +18 protein_coding exon 10804685 10804798 . + . Parent=ENSMUST00000150000 +18 protein_coding exon 10808032 10808132 . + . Parent=ENSMUST00000150000 +18 protein_coding exon 10811983 10812154 . + . Parent=ENSMUST00000150000 +18 protein_coding exon 10815734 10817626 . + . Parent=ENSMUST00000150000 +18 protein_coding transcript 10725742 10755697 . + . ID=ENSMUST00000131073;Parent=ENSMUSG00000024294;Name=Mib1-003 +18 protein_coding exon 10725742 10726531 . + . Parent=ENSMUST00000131073 +18 protein_coding exon 10740981 10741152 . + . Parent=ENSMUST00000131073 +18 protein_coding exon 10743267 10743396 . + . Parent=ENSMUST00000131073 +18 protein_coding exon 10747354 10747458 . + . Parent=ENSMUST00000131073 +18 protein_coding exon 10749321 10749387 . + . Parent=ENSMUST00000131073 +18 protein_coding exon 10751821 10752025 . + . Parent=ENSMUST00000131073 +18 protein_coding exon 10755502 10755697 . + . Parent=ENSMUST00000131073 +18 protein_coding mRNA 10725546 10818576 . + . ID=ENSMUST00000052838;Parent=ENSMUSG00000024294;Name=Mib1-001 +18 protein_coding five_prime_UTR 10725546 10726302 . + . Parent=ENSMUST00000052838 +18 protein_coding CDS 10726303 10726531 . + 0 Parent=ENSMUST00000052838 +18 protein_coding CDS 10740981 10741152 . + 2 Parent=ENSMUST00000052838 +18 protein_coding CDS 10743267 10743396 . + 1 Parent=ENSMUST00000052838 +18 protein_coding CDS 10747354 10747458 . + 0 Parent=ENSMUST00000052838 +18 protein_coding CDS 10749321 10749387 . + 0 Parent=ENSMUST00000052838 +18 protein_coding CDS 10751821 10752025 . + 2 Parent=ENSMUST00000052838 +18 protein_coding CDS 10755502 10755685 . + 1 Parent=ENSMUST00000052838 +18 protein_coding CDS 10760802 10760946 . + 0 Parent=ENSMUST00000052838 +18 protein_coding CDS 10763187 10763320 . + 2 Parent=ENSMUST00000052838 +18 protein_coding CDS 10768122 10768229 . + 0 Parent=ENSMUST00000052838 +18 protein_coding CDS 10775527 10775724 . + 0 Parent=ENSMUST00000052838 +18 protein_coding CDS 10778147 10778298 . + 0 Parent=ENSMUST00000052838 +18 protein_coding CDS 10792893 10793025 . + 1 Parent=ENSMUST00000052838 +18 protein_coding CDS 10794476 10794562 . + 0 Parent=ENSMUST00000052838 +18 protein_coding CDS 10795688 10795849 . + 0 Parent=ENSMUST00000052838 +18 protein_coding CDS 10798350 10798531 . + 0 Parent=ENSMUST00000052838 +18 protein_coding CDS 10800054 10800246 . + 1 Parent=ENSMUST00000052838 +18 protein_coding CDS 10802259 10802337 . + 0 Parent=ENSMUST00000052838 +18 protein_coding CDS 10804685 10804798 . + 2 Parent=ENSMUST00000052838 +18 protein_coding CDS 10808032 10808132 . + 2 Parent=ENSMUST00000052838 +18 protein_coding CDS 10811983 10812123 . + 0 Parent=ENSMUST00000052838 +18 protein_coding three_prime_UTR 10812124 10818576 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10725546 10726531 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10740981 10741152 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10743267 10743396 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10747354 10747458 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10749321 10749387 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10751821 10752025 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10755502 10755685 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10760802 10760946 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10763187 10763320 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10768122 10768229 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10775527 10775724 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10778147 10778298 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10792893 10793025 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10794476 10794562 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10795688 10795849 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10798350 10798531 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10800054 10800246 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10802259 10802337 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10804685 10804798 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10808032 10808132 . + . Parent=ENSMUST00000052838 +18 protein_coding exon 10811983 10818576 . + . Parent=ENSMUST00000052838 +18 protein_coding mRNA 10725653 10812172 . + . ID=ENSMUST00000165555;Parent=ENSMUSG00000024294;Name=Mib1-201 +18 protein_coding five_prime_UTR 10725653 10725723 . + . Parent=ENSMUST00000165555 +18 protein_coding five_prime_UTR 10726228 10726302 . + . Parent=ENSMUST00000165555 +18 protein_coding CDS 10726303 10726531 . + 0 Parent=ENSMUST00000165555 +18 protein_coding CDS 10740981 10741152 . + 2 Parent=ENSMUST00000165555 +18 protein_coding CDS 10743267 10743396 . + 1 Parent=ENSMUST00000165555 +18 protein_coding CDS 10747354 10747458 . + 0 Parent=ENSMUST00000165555 +18 protein_coding CDS 10749321 10749387 . + 0 Parent=ENSMUST00000165555 +18 protein_coding CDS 10751821 10752025 . + 2 Parent=ENSMUST00000165555 +18 protein_coding CDS 10755502 10755685 . + 1 Parent=ENSMUST00000165555 +18 protein_coding CDS 10760802 10760946 . + 0 Parent=ENSMUST00000165555 +18 protein_coding CDS 10763187 10763320 . + 2 Parent=ENSMUST00000165555 +18 protein_coding CDS 10768122 10768229 . + 0 Parent=ENSMUST00000165555 +18 protein_coding CDS 10775527 10775724 . + 0 Parent=ENSMUST00000165555 +18 protein_coding CDS 10778147 10778298 . + 0 Parent=ENSMUST00000165555 +18 protein_coding CDS 10792893 10793025 . + 1 Parent=ENSMUST00000165555 +18 protein_coding CDS 10794476 10794562 . + 0 Parent=ENSMUST00000165555 +18 protein_coding CDS 10795688 10795849 . + 0 Parent=ENSMUST00000165555 +18 protein_coding CDS 10798350 10798531 . + 0 Parent=ENSMUST00000165555 +18 protein_coding CDS 10800054 10800246 . + 1 Parent=ENSMUST00000165555 +18 protein_coding CDS 10802259 10802337 . + 0 Parent=ENSMUST00000165555 +18 protein_coding CDS 10804685 10804798 . + 2 Parent=ENSMUST00000165555 +18 protein_coding CDS 10808032 10808132 . + 2 Parent=ENSMUST00000165555 +18 protein_coding CDS 10811983 10812123 . + 0 Parent=ENSMUST00000165555 +18 protein_coding three_prime_UTR 10812124 10812172 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10725653 10725723 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10726228 10726531 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10740981 10741152 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10743267 10743396 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10747354 10747458 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10749321 10749387 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10751821 10752025 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10755502 10755685 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10760802 10760946 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10763187 10763320 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10768122 10768229 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10775527 10775724 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10778147 10778298 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10792893 10793025 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10794476 10794562 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10795688 10795849 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10798350 10798531 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10800054 10800246 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10802259 10802337 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10804685 10804798 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10808032 10808132 . + . Parent=ENSMUST00000165555 +18 protein_coding exon 10811983 10812172 . + . Parent=ENSMUST00000165555 +18 protein_coding gene 9707646 9877993 . + . ID=ENSMUSG00000036103;Name=Colec12 +18 protein_coding mRNA 9707646 9877993 . + . ID=ENSMUST00000040069;Parent=ENSMUSG00000036103;Name=Colec12-201 +18 protein_coding five_prime_UTR 9707646 9707750 . + . Parent=ENSMUST00000040069 +18 protein_coding CDS 9707751 9707757 . + 0 Parent=ENSMUST00000040069 +18 protein_coding CDS 9720919 9720969 . + 2 Parent=ENSMUST00000040069 +18 protein_coding CDS 9840237 9840359 . + 2 Parent=ENSMUST00000040069 +18 protein_coding CDS 9846785 9846883 . + 2 Parent=ENSMUST00000040069 +18 protein_coding CDS 9848102 9849148 . + 2 Parent=ENSMUST00000040069 +18 protein_coding CDS 9858544 9859032 . + 2 Parent=ENSMUST00000040069 +18 protein_coding CDS 9859836 9859972 . + 2 Parent=ENSMUST00000040069 +18 protein_coding CDS 9866742 9866851 . + 0 Parent=ENSMUST00000040069 +18 protein_coding CDS 9874787 9874932 . + 1 Parent=ENSMUST00000040069 +18 protein_coding CDS 9876986 9877005 . + 2 Parent=ENSMUST00000040069 +18 protein_coding three_prime_UTR 9877006 9877993 . + . Parent=ENSMUST00000040069 +18 protein_coding exon 9707646 9707757 . + . Parent=ENSMUST00000040069 +18 protein_coding exon 9720919 9720969 . + . Parent=ENSMUST00000040069 +18 protein_coding exon 9840237 9840359 . + . Parent=ENSMUST00000040069 +18 protein_coding exon 9846785 9846883 . + . Parent=ENSMUST00000040069 +18 protein_coding exon 9848102 9849148 . + . Parent=ENSMUST00000040069 +18 protein_coding exon 9858544 9859032 . + . Parent=ENSMUST00000040069 +18 protein_coding exon 9859836 9859972 . + . Parent=ENSMUST00000040069 +18 protein_coding exon 9866742 9866851 . + . Parent=ENSMUST00000040069 +18 protein_coding exon 9874787 9874932 . + . Parent=ENSMUST00000040069 +18 protein_coding exon 9876986 9877993 . + . Parent=ENSMUST00000040069 +18 snoRNA gene 9614312 9614437 . + . ID=ENSMUSG00000088996;Name=SNORA25.10 +18 snoRNA transcript 9614312 9614437 . + . ID=ENSMUST00000158371;Parent=ENSMUSG00000088996;Name=SNORA25.10-201 +18 snoRNA exon 9614312 9614437 . + . Parent=ENSMUST00000158371 +18 misc_RNA gene 3860106 3860428 . + . ID=ENSMUSG00000084719;Name=7SK.69 +18 misc_RNA transcript 3860106 3860428 . + . ID=ENSMUST00000122770;Parent=ENSMUSG00000084719;Name=7SK.69-201 +18 misc_RNA exon 3860106 3860428 . + . Parent=ENSMUST00000122770 +18 lincRNA gene 10706858 10711830 . + . ID=ENSMUSG00000084832;Name=4930563E18Rik +18 lincRNA transcript 10706858 10711830 . + . ID=ENSMUST00000130193;Parent=ENSMUSG00000084832;Name=4930563E18Rik-201 +18 lincRNA exon 10706858 10708202 . + . Parent=ENSMUST00000130193 +18 lincRNA exon 10710510 10710564 . + . Parent=ENSMUST00000130193 +18 lincRNA exon 10711678 10711830 . + . Parent=ENSMUST00000130193 +18 protein_coding gene 11791785 11901324 . + . ID=ENSMUSG00000041238;Name=Rbbp8 +18 protein_coding mRNA 11815936 11901387 . + . ID=ENSMUST00000047322;Parent=ENSMUSG00000041238;Name=Rbbp8-201 +18 protein_coding five_prime_UTR 11815936 11816201 . + . Parent=ENSMUST00000047322 +18 protein_coding five_prime_UTR 11819244 11819341 . + . Parent=ENSMUST00000047322 +18 protein_coding CDS 11819342 11819450 . + 0 Parent=ENSMUST00000047322 +18 protein_coding CDS 11831091 11831133 . + 2 Parent=ENSMUST00000047322 +18 protein_coding CDS 11836104 11836199 . + 1 Parent=ENSMUST00000047322 +18 protein_coding CDS 11851521 11851633 . + 1 Parent=ENSMUST00000047322 +18 protein_coding CDS 11855252 11855318 . + 2 Parent=ENSMUST00000047322 +18 protein_coding CDS 11864201 11864376 . + 1 Parent=ENSMUST00000047322 +18 protein_coding CDS 11874243 11874347 . + 2 Parent=ENSMUST00000047322 +18 protein_coding CDS 11877342 11877439 . + 2 Parent=ENSMUST00000047322 +18 protein_coding CDS 11879054 11879166 . + 0 Parent=ENSMUST00000047322 +18 protein_coding CDS 11880149 11881034 . + 1 Parent=ENSMUST00000047322 +18 protein_coding CDS 11881113 11881239 . + 0 Parent=ENSMUST00000047322 +18 protein_coding CDS 11883916 11884004 . + 2 Parent=ENSMUST00000047322 +18 protein_coding CDS 11885682 11885777 . + 0 Parent=ENSMUST00000047322 +18 protein_coding three_prime_UTR 11885778 11885793 . + . Parent=ENSMUST00000047322 +18 protein_coding three_prime_UTR 11890699 11890839 . + . Parent=ENSMUST00000047322 +18 protein_coding three_prime_UTR 11892985 11893054 . + . Parent=ENSMUST00000047322 +18 protein_coding three_prime_UTR 11897082 11897178 . + . Parent=ENSMUST00000047322 +18 protein_coding three_prime_UTR 11899435 11899576 . + . Parent=ENSMUST00000047322 +18 protein_coding three_prime_UTR 11901125 11901387 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11815936 11816201 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11819244 11819450 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11831091 11831133 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11836104 11836199 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11851521 11851633 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11855252 11855318 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11864201 11864376 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11874243 11874347 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11877342 11877439 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11879054 11879166 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11880149 11881034 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11881113 11881239 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11883916 11884004 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11885682 11885793 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11890699 11890839 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11892985 11893054 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11897082 11897178 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11899435 11899576 . + . Parent=ENSMUST00000047322 +18 protein_coding exon 11901125 11901387 . + . Parent=ENSMUST00000047322 +18 protein_coding mRNA 11791785 11901324 . + . ID=ENSMUST00000165655;Parent=ENSMUSG00000041238;Name=Rbbp8-203 +18 protein_coding five_prime_UTR 11791785 11792033 . + . Parent=ENSMUST00000165655 +18 protein_coding five_prime_UTR 11819244 11819341 . + . Parent=ENSMUST00000165655 +18 protein_coding CDS 11819342 11819450 . + 0 Parent=ENSMUST00000165655 +18 protein_coding CDS 11831091 11831133 . + 2 Parent=ENSMUST00000165655 +18 protein_coding CDS 11836104 11836199 . + 1 Parent=ENSMUST00000165655 +18 protein_coding CDS 11851521 11851633 . + 1 Parent=ENSMUST00000165655 +18 protein_coding CDS 11855252 11855318 . + 2 Parent=ENSMUST00000165655 +18 protein_coding CDS 11864201 11864376 . + 1 Parent=ENSMUST00000165655 +18 protein_coding CDS 11874243 11874347 . + 2 Parent=ENSMUST00000165655 +18 protein_coding CDS 11877342 11877439 . + 2 Parent=ENSMUST00000165655 +18 protein_coding CDS 11879054 11879166 . + 0 Parent=ENSMUST00000165655 +18 protein_coding CDS 11880149 11881034 . + 1 Parent=ENSMUST00000165655 +18 protein_coding CDS 11881113 11881239 . + 0 Parent=ENSMUST00000165655 +18 protein_coding CDS 11883916 11884004 . + 2 Parent=ENSMUST00000165655 +18 protein_coding CDS 11885682 11885793 . + 0 Parent=ENSMUST00000165655 +18 protein_coding CDS 11890699 11890839 . + 2 Parent=ENSMUST00000165655 +18 protein_coding CDS 11892985 11893054 . + 2 Parent=ENSMUST00000165655 +18 protein_coding CDS 11897082 11897178 . + 1 Parent=ENSMUST00000165655 +18 protein_coding CDS 11899435 11899576 . + 0 Parent=ENSMUST00000165655 +18 protein_coding CDS 11901125 11901222 . + 2 Parent=ENSMUST00000165655 +18 protein_coding three_prime_UTR 11901223 11901324 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11791785 11792033 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11819244 11819450 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11831091 11831133 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11836104 11836199 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11851521 11851633 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11855252 11855318 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11864201 11864376 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11874243 11874347 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11877342 11877439 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11879054 11879166 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11880149 11881034 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11881113 11881239 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11883916 11884004 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11885682 11885793 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11890699 11890839 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11892985 11893054 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11897082 11897178 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11899435 11899576 . + . Parent=ENSMUST00000165655 +18 protein_coding exon 11901125 11901324 . + . Parent=ENSMUST00000165655 +18 protein_coding mRNA 11816351 11901716 . + . ID=ENSMUST00000115861;Parent=ENSMUSG00000041238;Name=Rbbp8-202 +18 protein_coding five_prime_UTR 11816351 11816482 . + . Parent=ENSMUST00000115861 +18 protein_coding five_prime_UTR 11819244 11819341 . + . Parent=ENSMUST00000115861 +18 protein_coding CDS 11819342 11819450 . + 0 Parent=ENSMUST00000115861 +18 protein_coding CDS 11831091 11831133 . + 2 Parent=ENSMUST00000115861 +18 protein_coding CDS 11836104 11836199 . + 1 Parent=ENSMUST00000115861 +18 protein_coding CDS 11851521 11851633 . + 1 Parent=ENSMUST00000115861 +18 protein_coding CDS 11855252 11855318 . + 2 Parent=ENSMUST00000115861 +18 protein_coding CDS 11864201 11864376 . + 1 Parent=ENSMUST00000115861 +18 protein_coding CDS 11874243 11874347 . + 2 Parent=ENSMUST00000115861 +18 protein_coding CDS 11877342 11877439 . + 2 Parent=ENSMUST00000115861 +18 protein_coding CDS 11879054 11879166 . + 0 Parent=ENSMUST00000115861 +18 protein_coding CDS 11880149 11881034 . + 1 Parent=ENSMUST00000115861 +18 protein_coding CDS 11881113 11881239 . + 0 Parent=ENSMUST00000115861 +18 protein_coding CDS 11883916 11884004 . + 2 Parent=ENSMUST00000115861 +18 protein_coding CDS 11885682 11885793 . + 0 Parent=ENSMUST00000115861 +18 protein_coding CDS 11890699 11890839 . + 2 Parent=ENSMUST00000115861 +18 protein_coding CDS 11892985 11893054 . + 2 Parent=ENSMUST00000115861 +18 protein_coding CDS 11897082 11897178 . + 1 Parent=ENSMUST00000115861 +18 protein_coding CDS 11899435 11899576 . + 0 Parent=ENSMUST00000115861 +18 protein_coding CDS 11901125 11901222 . + 2 Parent=ENSMUST00000115861 +18 protein_coding three_prime_UTR 11901223 11901716 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11816351 11816482 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11819244 11819450 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11831091 11831133 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11836104 11836199 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11851521 11851633 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11855252 11855318 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11864201 11864376 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11874243 11874347 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11877342 11877439 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11879054 11879166 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11880149 11881034 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11881113 11881239 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11883916 11884004 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11885682 11885793 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11890699 11890839 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11892985 11893054 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11897082 11897178 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11899435 11899576 . + . Parent=ENSMUST00000115861 +18 protein_coding exon 11901125 11901716 . + . Parent=ENSMUST00000115861 +18 lincRNA gene 11049085 11051487 . - . ID=ENSMUSG00000087274;Name=1010001N08Rik +18 lincRNA transcript 11049085 11051487 . - . ID=ENSMUST00000138373;Parent=ENSMUSG00000087274;Name=1010001N08Rik-202 +18 lincRNA exon 11049085 11050819 . - . Parent=ENSMUST00000138373 +18 lincRNA exon 11051256 11051487 . - . Parent=ENSMUST00000138373 +18 lincRNA transcript 11049929 11052565 . - . ID=ENSMUST00000133759;Parent=ENSMUSG00000087274;Name=1010001N08Rik-201 +18 lincRNA exon 11049929 11050254 . - . Parent=ENSMUST00000133759 +18 lincRNA exon 11050622 11050819 . - . Parent=ENSMUST00000133759 +18 lincRNA exon 11051256 11051366 . - . Parent=ENSMUST00000133759 +18 lincRNA exon 11052473 11052565 . - . Parent=ENSMUST00000133759 +18 miRNA gene 11998870 11998947 . - . ID=ENSMUSG00000084565;Name=Mir1901 +18 miRNA transcript 11998870 11998947 . - . ID=ENSMUST00000122616;Parent=ENSMUSG00000084565;Name=Mir1901-201 +18 miRNA exon 11998870 11998947 . - . Parent=ENSMUST00000122616 +18 protein_coding gene 7088231 7297899 . - . ID=ENSMUSG00000061802;Name=Armc4 +18 protein_coding mRNA 7088231 7297899 . - . ID=ENSMUST00000081275;Parent=ENSMUSG00000061802;Name=Armc4-201 +18 protein_coding five_prime_UTR 7294610 7294622 . - . Parent=ENSMUST00000081275 +18 protein_coding five_prime_UTR 7296949 7297055 . - . Parent=ENSMUST00000081275 +18 protein_coding five_prime_UTR 7297878 7297899 . - . Parent=ENSMUST00000081275 +18 protein_coding CDS 7088452 7088565 . - 0 Parent=ENSMUST00000081275 +18 protein_coding CDS 7127210 7127431 . - 0 Parent=ENSMUST00000081275 +18 protein_coding CDS 7129397 7129585 . - 0 Parent=ENSMUST00000081275 +18 protein_coding CDS 7181732 7181846 . - 1 Parent=ENSMUST00000081275 +18 protein_coding CDS 7211397 7211639 . - 1 Parent=ENSMUST00000081275 +18 protein_coding CDS 7214567 7214721 . - 0 Parent=ENSMUST00000081275 +18 protein_coding CDS 7216933 7217043 . - 0 Parent=ENSMUST00000081275 +18 protein_coding CDS 7217746 7217988 . - 0 Parent=ENSMUST00000081275 +18 protein_coding CDS 7222544 7222753 . - 0 Parent=ENSMUST00000081275 +18 protein_coding CDS 7223528 7223674 . - 0 Parent=ENSMUST00000081275 +18 protein_coding CDS 7264999 7265146 . - 1 Parent=ENSMUST00000081275 +18 protein_coding CDS 7266881 7266979 . - 1 Parent=ENSMUST00000081275 +18 protein_coding CDS 7268398 7268585 . - 0 Parent=ENSMUST00000081275 +18 protein_coding CDS 7273157 7273273 . - 0 Parent=ENSMUST00000081275 +18 protein_coding CDS 7285345 7285481 . - 2 Parent=ENSMUST00000081275 +18 protein_coding CDS 7285684 7285790 . - 1 Parent=ENSMUST00000081275 +18 protein_coding CDS 7286659 7286845 . - 2 Parent=ENSMUST00000081275 +18 protein_coding CDS 7288482 7288639 . - 1 Parent=ENSMUST00000081275 +18 protein_coding CDS 7294386 7294609 . - 0 Parent=ENSMUST00000081275 +18 protein_coding three_prime_UTR 7088231 7088451 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7088231 7088565 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7127210 7127431 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7129397 7129585 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7181732 7181846 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7211397 7211639 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7214567 7214721 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7216933 7217043 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7217746 7217988 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7222544 7222753 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7223528 7223674 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7264999 7265146 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7266881 7266979 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7268398 7268585 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7273157 7273273 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7285345 7285481 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7285684 7285790 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7286659 7286845 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7288482 7288639 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7294386 7294622 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7296949 7297055 . - . Parent=ENSMUST00000081275 +18 protein_coding exon 7297878 7297899 . - . Parent=ENSMUST00000081275 +18 protein_coding gene 12657194 12657637 . - . ID=ENSMUSG00000090309;Name=AC102131.1 +18 protein_coding mRNA 12657194 12657637 . - . ID=ENSMUST00000172267;Parent=ENSMUSG00000090309;Name=AC102131.1-201 +18 protein_coding CDS 12657194 12657637 . - 0 Parent=ENSMUST00000172267 +18 protein_coding exon 12657194 12657637 . - . Parent=ENSMUST00000172267 +18 lincRNA gene 11979185 11997846 . - . ID=ENSMUSG00000087420;Name=Gm6277 +18 lincRNA transcript 11979185 11997846 . - . ID=ENSMUST00000129627;Parent=ENSMUSG00000087420;Name=Gm6277-201 +18 lincRNA exon 11979185 11979574 . - . Parent=ENSMUST00000129627 +18 lincRNA exon 11979624 11980616 . - . Parent=ENSMUST00000129627 +18 lincRNA exon 11981407 11981548 . - . Parent=ENSMUST00000129627 +18 lincRNA exon 11983673 11983735 . - . Parent=ENSMUST00000129627 +18 lincRNA exon 11997690 11997846 . - . Parent=ENSMUST00000129627 +18 lincRNA gene 5162878 5165729 . - . ID=ENSMUSG00000085461;Name=Gm16954 +18 lincRNA transcript 5162878 5165729 . - . ID=ENSMUST00000150337;Parent=ENSMUSG00000085461;Name=Gm16954-201 +18 lincRNA exon 5162878 5164430 . - . Parent=ENSMUST00000150337 +18 lincRNA exon 5165286 5165400 . - . Parent=ENSMUST00000150337 +18 lincRNA exon 5165669 5165729 . - . Parent=ENSMUST00000150337 +18 protein_coding gene 3266046 3281076 . - . ID=ENSMUSG00000063889;Name=Crem +18 protein_coding mRNA 3266046 3327589 . - . ID=ENSMUST00000151311;Parent=ENSMUSG00000063889;Name=Crem-020 +18 protein_coding five_prime_UTR 3327536 3327589 . - . Parent=ENSMUST00000151311 +18 protein_coding CDS 3267586 3267730 . - 1 Parent=ENSMUST00000151311 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000151311 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000151311 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000151311 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000151311 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000151311 +18 protein_coding CDS 3327492 3327535 . - 0 Parent=ENSMUST00000151311 +18 protein_coding three_prime_UTR 3266046 3267585 . - . Parent=ENSMUST00000151311 +18 protein_coding exon 3266046 3267730 . - . Parent=ENSMUST00000151311 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000151311 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000151311 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000151311 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000151311 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000151311 +18 protein_coding exon 3327492 3327589 . - . Parent=ENSMUST00000151311 +18 protein_coding mRNA 3266354 3337486 . - . ID=ENSMUST00000154135;Parent=ENSMUSG00000063889;Name=Crem-004 +18 protein_coding five_prime_UTR 3327536 3327589 . - . Parent=ENSMUST00000154135 +18 protein_coding five_prime_UTR 3337378 3337486 . - . Parent=ENSMUST00000154135 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000154135 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000154135 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000154135 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000154135 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000154135 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000154135 +18 protein_coding CDS 3327492 3327535 . - 0 Parent=ENSMUST00000154135 +18 protein_coding three_prime_UTR 3266354 3267982 . - . Parent=ENSMUST00000154135 +18 protein_coding exon 3266354 3268127 . - . Parent=ENSMUST00000154135 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000154135 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000154135 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000154135 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000154135 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000154135 +18 protein_coding exon 3327492 3327589 . - . Parent=ENSMUST00000154135 +18 protein_coding exon 3337378 3337486 . - . Parent=ENSMUST00000154135 +18 protein_coding mRNA 3267512 3325472 . - . ID=ENSMUST00000130599;Parent=ENSMUSG00000063889;Name=Crem-032 +18 protein_coding CDS 3267586 3267730 . - 1 Parent=ENSMUST00000130599 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000130599 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000130599 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000130599 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000130599 +18 protein_coding CDS 3325359 3325472 . - 0 Parent=ENSMUST00000130599 +18 protein_coding three_prime_UTR 3267512 3267585 . - . Parent=ENSMUST00000130599 +18 protein_coding exon 3267512 3267730 . - . Parent=ENSMUST00000130599 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000130599 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000130599 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000130599 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000130599 +18 protein_coding exon 3325359 3325472 . - . Parent=ENSMUST00000130599 +18 protein_coding mRNA 3267556 3325476 . - . ID=ENSMUST00000127601;Parent=ENSMUSG00000063889;Name=Crem-019 +18 protein_coding CDS 3267586 3267730 . - 0 Parent=ENSMUST00000127601 +18 protein_coding CDS 3273420 3273576 . - 1 Parent=ENSMUST00000127601 +18 protein_coding CDS 3287902 3288090 . - 1 Parent=ENSMUST00000127601 +18 protein_coding CDS 3295038 3295180 . - 0 Parent=ENSMUST00000127601 +18 protein_coding CDS 3295320 3295414 . - 2 Parent=ENSMUST00000127601 +18 protein_coding CDS 3299160 3299306 . - 2 Parent=ENSMUST00000127601 +18 protein_coding CDS 3325359 3325476 . - 0 Parent=ENSMUST00000127601 +18 protein_coding three_prime_UTR 3267556 3267585 . - . Parent=ENSMUST00000127601 +18 protein_coding exon 3267556 3267730 . - . Parent=ENSMUST00000127601 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000127601 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000127601 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000127601 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000127601 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000127601 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000127601 +18 protein_coding mRNA 3266352 3337677 . - . ID=ENSMUST00000150235;Parent=ENSMUSG00000063889;Name=Crem-001 +18 protein_coding five_prime_UTR 3327536 3327589 . - . Parent=ENSMUST00000150235 +18 protein_coding five_prime_UTR 3337378 3337677 . - . Parent=ENSMUST00000150235 +18 protein_coding CDS 3267586 3267730 . - 1 Parent=ENSMUST00000150235 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000150235 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000150235 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000150235 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000150235 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000150235 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000150235 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000150235 +18 protein_coding CDS 3327492 3327535 . - 0 Parent=ENSMUST00000150235 +18 protein_coding three_prime_UTR 3266352 3267585 . - . Parent=ENSMUST00000150235 +18 protein_coding exon 3266352 3267730 . - . Parent=ENSMUST00000150235 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000150235 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000150235 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000150235 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000150235 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000150235 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000150235 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000150235 +18 protein_coding exon 3327492 3327589 . - . Parent=ENSMUST00000150235 +18 protein_coding exon 3337378 3337677 . - . Parent=ENSMUST00000150235 +18 protein_coding mRNA 3267259 3337746 . - . ID=ENSMUST00000154470;Parent=ENSMUSG00000063889;Name=Crem-006 +18 protein_coding five_prime_UTR 3327536 3327589 . - . Parent=ENSMUST00000154470 +18 protein_coding five_prime_UTR 3337378 3337746 . - . Parent=ENSMUST00000154470 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000154470 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000154470 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000154470 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000154470 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000154470 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000154470 +18 protein_coding CDS 3327492 3327535 . - 0 Parent=ENSMUST00000154470 +18 protein_coding three_prime_UTR 3267259 3267982 . - . Parent=ENSMUST00000154470 +18 protein_coding exon 3267259 3268127 . - . Parent=ENSMUST00000154470 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000154470 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000154470 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000154470 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000154470 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000154470 +18 protein_coding exon 3327492 3327589 . - . Parent=ENSMUST00000154470 +18 protein_coding exon 3337378 3337746 . - . Parent=ENSMUST00000154470 +18 protein_coding mRNA 3266354 3337587 . - . ID=ENSMUST00000082141;Parent=ENSMUSG00000063889;Name=Crem-203 +18 protein_coding five_prime_UTR 3327536 3327589 . - . Parent=ENSMUST00000082141 +18 protein_coding five_prime_UTR 3337378 3337587 . - . Parent=ENSMUST00000082141 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000082141 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000082141 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000082141 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000082141 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000082141 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000082141 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000082141 +18 protein_coding CDS 3327492 3327535 . - 0 Parent=ENSMUST00000082141 +18 protein_coding three_prime_UTR 3266354 3267982 . - . Parent=ENSMUST00000082141 +18 protein_coding exon 3266354 3268127 . - . Parent=ENSMUST00000082141 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000082141 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000082141 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000082141 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000082141 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000082141 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000082141 +18 protein_coding exon 3327492 3327589 . - . Parent=ENSMUST00000082141 +18 protein_coding exon 3337378 3337587 . - . Parent=ENSMUST00000082141 +18 protein_coding mRNA 3267421 3327505 . - . ID=ENSMUST00000131899;Parent=ENSMUSG00000063889;Name=Crem-002 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000131899 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000131899 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000131899 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000131899 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000131899 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000131899 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000131899 +18 protein_coding CDS 3327492 3327505 . - 0 Parent=ENSMUST00000131899 +18 protein_coding three_prime_UTR 3267421 3267982 . - . Parent=ENSMUST00000131899 +18 protein_coding exon 3267421 3268127 . - . Parent=ENSMUST00000131899 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000131899 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000131899 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000131899 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000131899 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000131899 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000131899 +18 protein_coding exon 3327492 3327505 . - . Parent=ENSMUST00000131899 +18 protein_coding transcript 3287630 3299554 . - . ID=ENSMUST00000130047;Parent=ENSMUSG00000063889;Name=Crem-017 +18 protein_coding exon 3287630 3288090 . - . Parent=ENSMUST00000130047 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000130047 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000130047 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000130047 +18 protein_coding exon 3299448 3299554 . - . Parent=ENSMUST00000130047 +18 protein_coding mRNA 3266354 3337587 . - . ID=ENSMUST00000025069;Parent=ENSMUSG00000063889;Name=Crem-201 +18 protein_coding five_prime_UTR 3327536 3327589 . - . Parent=ENSMUST00000025069 +18 protein_coding five_prime_UTR 3337378 3337587 . - . Parent=ENSMUST00000025069 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000025069 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000025069 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000025069 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000025069 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000025069 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000025069 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000025069 +18 protein_coding CDS 3327492 3327535 . - 0 Parent=ENSMUST00000025069 +18 protein_coding three_prime_UTR 3266354 3267982 . - . Parent=ENSMUST00000025069 +18 protein_coding exon 3266354 3268127 . - . Parent=ENSMUST00000025069 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000025069 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000025069 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000025069 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000025069 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000025069 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000025069 +18 protein_coding exon 3327492 3327589 . - . Parent=ENSMUST00000025069 +18 protein_coding exon 3337378 3337587 . - . Parent=ENSMUST00000025069 +18 protein_coding mRNA 3267532 3281130 . - . ID=ENSMUST00000124747;Parent=ENSMUSG00000063889;Name=Crem-029 +18 protein_coding five_prime_UTR 3276699 3276727 . - . Parent=ENSMUST00000124747 +18 protein_coding five_prime_UTR 3280947 3281130 . - . Parent=ENSMUST00000124747 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000124747 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000124747 +18 protein_coding CDS 3276692 3276698 . - 0 Parent=ENSMUST00000124747 +18 protein_coding three_prime_UTR 3267532 3267982 . - . Parent=ENSMUST00000124747 +18 protein_coding exon 3267532 3268127 . - . Parent=ENSMUST00000124747 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000124747 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000124747 +18 protein_coding exon 3280947 3281130 . - . Parent=ENSMUST00000124747 +18 protein_coding mRNA 3267586 3309721 . - . ID=ENSMUST00000136961;Parent=ENSMUSG00000063889;Name=Crem-035 +18 protein_coding CDS 3267586 3267730 . - 1 Parent=ENSMUST00000136961 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000136961 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000136961 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000136961 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000136961 +18 protein_coding CDS 3309644 3309721 . - 0 Parent=ENSMUST00000136961 +18 protein_coding exon 3267586 3267730 . - . Parent=ENSMUST00000136961 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000136961 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000136961 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000136961 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000136961 +18 protein_coding exon 3309644 3309721 . - . Parent=ENSMUST00000136961 +18 protein_coding mRNA 3267837 3325472 . - . ID=ENSMUST00000148305;Parent=ENSMUSG00000063889;Name=Crem-011 +18 protein_coding CDS 3273508 3273576 . - 0 Parent=ENSMUST00000148305 +18 protein_coding CDS 3276692 3276727 . - 0 Parent=ENSMUST00000148305 +18 protein_coding CDS 3325359 3325472 . - 0 Parent=ENSMUST00000148305 +18 protein_coding three_prime_UTR 3267837 3268127 . - . Parent=ENSMUST00000148305 +18 protein_coding three_prime_UTR 3273420 3273507 . - . Parent=ENSMUST00000148305 +18 protein_coding exon 3267837 3268127 . - . Parent=ENSMUST00000148305 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000148305 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000148305 +18 protein_coding exon 3325359 3325472 . - . Parent=ENSMUST00000148305 +18 protein_coding mRNA 3267983 3325472 . - . ID=ENSMUST00000115873;Parent=ENSMUSG00000063889;Name=Crem-204 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000115873 +18 protein_coding CDS 3273420 3273601 . - 0 Parent=ENSMUST00000115873 +18 protein_coding CDS 3273607 3273623 . - 2 Parent=ENSMUST00000115873 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000115873 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000115873 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000115873 +18 protein_coding CDS 3325359 3325472 . - 0 Parent=ENSMUST00000115873 +18 protein_coding exon 3267983 3268127 . - . Parent=ENSMUST00000115873 +18 protein_coding exon 3273420 3273601 . - . Parent=ENSMUST00000115873 +18 protein_coding exon 3273607 3273623 . - . Parent=ENSMUST00000115873 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000115873 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000115873 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000115873 +18 protein_coding exon 3325359 3325472 . - . Parent=ENSMUST00000115873 +18 protein_coding mRNA 3267262 3299554 . - . ID=ENSMUST00000129435;Parent=ENSMUSG00000063889;Name=Crem-021 +18 protein_coding five_prime_UTR 3299451 3299554 . - . Parent=ENSMUST00000129435 +18 protein_coding CDS 3267586 3267730 . - 1 Parent=ENSMUST00000129435 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000129435 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000129435 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000129435 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000129435 +18 protein_coding CDS 3299448 3299450 . - 0 Parent=ENSMUST00000129435 +18 protein_coding three_prime_UTR 3267262 3267585 . - . Parent=ENSMUST00000129435 +18 protein_coding exon 3267262 3267730 . - . Parent=ENSMUST00000129435 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000129435 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000129435 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000129435 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000129435 +18 protein_coding exon 3299448 3299554 . - . Parent=ENSMUST00000129435 +18 protein_coding transcript 3283896 3299539 . - . ID=ENSMUST00000149266;Parent=ENSMUSG00000063889;Name=Crem-018 +18 protein_coding exon 3283896 3284071 . - . Parent=ENSMUST00000149266 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000149266 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000149266 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000149266 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000149266 +18 protein_coding exon 3299448 3299539 . - . Parent=ENSMUST00000149266 +18 protein_coding mRNA 3267583 3337531 . - . ID=ENSMUST00000134027;Parent=ENSMUSG00000063889;Name=Crem-007 +18 protein_coding five_prime_UTR 3327536 3327589 . - . Parent=ENSMUST00000134027 +18 protein_coding five_prime_UTR 3337378 3337531 . - . Parent=ENSMUST00000134027 +18 protein_coding CDS 3309977 3309985 . - 0 Parent=ENSMUST00000134027 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000134027 +18 protein_coding CDS 3327492 3327535 . - 0 Parent=ENSMUST00000134027 +18 protein_coding three_prime_UTR 3267583 3268127 . - . Parent=ENSMUST00000134027 +18 protein_coding three_prime_UTR 3273420 3273576 . - . Parent=ENSMUST00000134027 +18 protein_coding three_prime_UTR 3295038 3295180 . - . Parent=ENSMUST00000134027 +18 protein_coding three_prime_UTR 3295320 3295414 . - . Parent=ENSMUST00000134027 +18 protein_coding three_prime_UTR 3309644 3309753 . - . Parent=ENSMUST00000134027 +18 protein_coding three_prime_UTR 3309853 3309976 . - . Parent=ENSMUST00000134027 +18 protein_coding exon 3267583 3268127 . - . Parent=ENSMUST00000134027 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000134027 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000134027 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000134027 +18 protein_coding exon 3309644 3309753 . - . Parent=ENSMUST00000134027 +18 protein_coding exon 3309853 3309985 . - . Parent=ENSMUST00000134027 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000134027 +18 protein_coding exon 3327492 3327589 . - . Parent=ENSMUST00000134027 +18 protein_coding exon 3337378 3337531 . - . Parent=ENSMUST00000134027 +18 protein_coding mRNA 3267843 3281736 . - . ID=ENSMUST00000154705;Parent=ENSMUSG00000063889;Name=Crem-024 +18 protein_coding five_prime_UTR 3281711 3281736 . - . Parent=ENSMUST00000154705 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000154705 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000154705 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000154705 +18 protein_coding CDS 3281686 3281710 . - 0 Parent=ENSMUST00000154705 +18 protein_coding three_prime_UTR 3267843 3267982 . - . Parent=ENSMUST00000154705 +18 protein_coding exon 3267843 3268127 . - . Parent=ENSMUST00000154705 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000154705 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000154705 +18 protein_coding exon 3281686 3281736 . - . Parent=ENSMUST00000154705 +18 protein_coding mRNA 3267586 3309721 . - . ID=ENSMUST00000152108;Parent=ENSMUSG00000063889;Name=Crem-034 +18 protein_coding CDS 3267586 3267730 . - 1 Parent=ENSMUST00000152108 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000152108 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000152108 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000152108 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000152108 +18 protein_coding CDS 3309644 3309721 . - 0 Parent=ENSMUST00000152108 +18 protein_coding exon 3267586 3267730 . - . Parent=ENSMUST00000152108 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000152108 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000152108 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000152108 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000152108 +18 protein_coding exon 3309644 3309721 . - . Parent=ENSMUST00000152108 +18 protein_coding mRNA 3267573 3325472 . - . ID=ENSMUST00000156234;Parent=ENSMUSG00000063889;Name=Crem-012 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000156234 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000156234 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000156234 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000156234 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000156234 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000156234 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000156234 +18 protein_coding CDS 3325359 3325472 . - 0 Parent=ENSMUST00000156234 +18 protein_coding three_prime_UTR 3267573 3267982 . - . Parent=ENSMUST00000156234 +18 protein_coding exon 3267573 3268127 . - . Parent=ENSMUST00000156234 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000156234 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000156234 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000156234 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000156234 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000156234 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000156234 +18 protein_coding exon 3325359 3325472 . - . Parent=ENSMUST00000156234 +18 protein_coding transcript 3266961 3337511 . - . ID=ENSMUST00000140912;Parent=ENSMUSG00000063889;Name=Crem-005 +18 protein_coding exon 3266961 3268127 . - . Parent=ENSMUST00000140912 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000140912 +18 protein_coding exon 3337378 3337511 . - . Parent=ENSMUST00000140912 +18 protein_coding mRNA 3267388 3281745 . - . ID=ENSMUST00000151084;Parent=ENSMUSG00000063889;Name=Crem-023 +18 protein_coding five_prime_UTR 3281711 3281745 . - . Parent=ENSMUST00000151084 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000151084 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000151084 +18 protein_coding CDS 3281686 3281710 . - 0 Parent=ENSMUST00000151084 +18 protein_coding three_prime_UTR 3267388 3267982 . - . Parent=ENSMUST00000151084 +18 protein_coding exon 3267388 3268127 . - . Parent=ENSMUST00000151084 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000151084 +18 protein_coding exon 3281686 3281745 . - . Parent=ENSMUST00000151084 +18 protein_coding mRNA 3267631 3281099 . - . ID=ENSMUST00000139537;Parent=ENSMUSG00000063889;Name=Crem-030 +18 protein_coding five_prime_UTR 3273563 3273576 . - . Parent=ENSMUST00000139537 +18 protein_coding five_prime_UTR 3280947 3281099 . - . Parent=ENSMUST00000139537 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000139537 +18 protein_coding CDS 3273420 3273562 . - 0 Parent=ENSMUST00000139537 +18 protein_coding three_prime_UTR 3267631 3267982 . - . Parent=ENSMUST00000139537 +18 protein_coding exon 3267631 3268127 . - . Parent=ENSMUST00000139537 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000139537 +18 protein_coding exon 3280947 3281099 . - . Parent=ENSMUST00000139537 +18 protein_coding mRNA 3267583 3327505 . - . ID=ENSMUST00000137568;Parent=ENSMUSG00000063889;Name=Crem-009 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000137568 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000137568 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000137568 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000137568 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000137568 +18 protein_coding CDS 3327492 3327505 . - 0 Parent=ENSMUST00000137568 +18 protein_coding three_prime_UTR 3267583 3267982 . - . Parent=ENSMUST00000137568 +18 protein_coding exon 3267583 3268127 . - . Parent=ENSMUST00000137568 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000137568 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000137568 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000137568 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000137568 +18 protein_coding exon 3327492 3327505 . - . Parent=ENSMUST00000137568 +18 protein_coding mRNA 3294480 3337572 . - . ID=ENSMUST00000142690;Parent=ENSMUSG00000063889;Name=Crem-014 +18 protein_coding five_prime_UTR 3325473 3325476 . - . Parent=ENSMUST00000142690 +18 protein_coding five_prime_UTR 3337378 3337572 . - . Parent=ENSMUST00000142690 +18 protein_coding CDS 3295015 3295180 . - 1 Parent=ENSMUST00000142690 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000142690 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000142690 +18 protein_coding CDS 3325359 3325472 . - 0 Parent=ENSMUST00000142690 +18 protein_coding three_prime_UTR 3294480 3295014 . - . Parent=ENSMUST00000142690 +18 protein_coding exon 3294480 3295180 . - . Parent=ENSMUST00000142690 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000142690 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000142690 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000142690 +18 protein_coding exon 3337378 3337572 . - . Parent=ENSMUST00000142690 +18 protein_coding mRNA 3266354 3337587 . - . ID=ENSMUST00000073545;Parent=ENSMUSG00000063889;Name=Crem-202 +18 protein_coding five_prime_UTR 3325473 3325476 . - . Parent=ENSMUST00000073545 +18 protein_coding five_prime_UTR 3327492 3327589 . - . Parent=ENSMUST00000073545 +18 protein_coding five_prime_UTR 3337378 3337587 . - . Parent=ENSMUST00000073545 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000073545 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000073545 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000073545 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000073545 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000073545 +18 protein_coding CDS 3325359 3325472 . - 0 Parent=ENSMUST00000073545 +18 protein_coding three_prime_UTR 3266354 3267982 . - . Parent=ENSMUST00000073545 +18 protein_coding exon 3266354 3268127 . - . Parent=ENSMUST00000073545 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000073545 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000073545 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000073545 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000073545 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000073545 +18 protein_coding exon 3327492 3327589 . - . Parent=ENSMUST00000073545 +18 protein_coding exon 3337378 3337587 . - . Parent=ENSMUST00000073545 +18 protein_coding mRNA 3267570 3281767 . - . ID=ENSMUST00000147138;Parent=ENSMUSG00000063889;Name=Crem-022 +18 protein_coding five_prime_UTR 3281711 3281767 . - . Parent=ENSMUST00000147138 +18 protein_coding CDS 3267586 3267730 . - 1 Parent=ENSMUST00000147138 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000147138 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000147138 +18 protein_coding CDS 3281686 3281710 . - 0 Parent=ENSMUST00000147138 +18 protein_coding three_prime_UTR 3267570 3267585 . - . Parent=ENSMUST00000147138 +18 protein_coding exon 3267570 3267730 . - . Parent=ENSMUST00000147138 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000147138 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000147138 +18 protein_coding exon 3281686 3281767 . - . Parent=ENSMUST00000147138 +18 protein_coding mRNA 3267583 3327505 . - . ID=ENSMUST00000146265;Parent=ENSMUSG00000063889;Name=Crem-010 +18 protein_coding CDS 3267586 3267730 . - 1 Parent=ENSMUST00000146265 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000146265 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000146265 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000146265 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000146265 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000146265 +18 protein_coding CDS 3327492 3327505 . - 0 Parent=ENSMUST00000146265 +18 protein_coding three_prime_UTR 3267583 3267585 . - . Parent=ENSMUST00000146265 +18 protein_coding exon 3267583 3267730 . - . Parent=ENSMUST00000146265 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000146265 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000146265 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000146265 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000146265 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000146265 +18 protein_coding exon 3327492 3327505 . - . Parent=ENSMUST00000146265 +18 protein_coding mRNA 3267983 3299450 . - . ID=ENSMUST00000126578;Parent=ENSMUSG00000063889;Name=Crem-036 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000126578 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000126578 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000126578 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000126578 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000126578 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000126578 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000126578 +18 protein_coding CDS 3299448 3299450 . - 0 Parent=ENSMUST00000126578 +18 protein_coding exon 3267983 3268127 . - . Parent=ENSMUST00000126578 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000126578 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000126578 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000126578 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000126578 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000126578 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000126578 +18 protein_coding exon 3299448 3299450 . - . Parent=ENSMUST00000126578 +18 protein_coding mRNA 3267583 3327505 . - . ID=ENSMUST00000152900;Parent=ENSMUSG00000063889;Name=Crem-003 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000152900 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000152900 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000152900 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000152900 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000152900 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000152900 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000152900 +18 protein_coding CDS 3327492 3327505 . - 0 Parent=ENSMUST00000152900 +18 protein_coding three_prime_UTR 3267583 3267982 . - . Parent=ENSMUST00000152900 +18 protein_coding exon 3267583 3268127 . - . Parent=ENSMUST00000152900 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000152900 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000152900 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000152900 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000152900 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000152900 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000152900 +18 protein_coding exon 3327492 3327505 . - . Parent=ENSMUST00000152900 +18 protein_coding transcript 3318698 3337061 . - . ID=ENSMUST00000132334;Parent=ENSMUSG00000063889;Name=Crem-026 +18 protein_coding exon 3318698 3318987 . - . Parent=ENSMUST00000132334 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000132334 +18 protein_coding exon 3327492 3327589 . - . Parent=ENSMUST00000132334 +18 protein_coding exon 3336959 3337061 . - . Parent=ENSMUST00000132334 +18 protein_coding mRNA 3294182 3337587 . - . ID=ENSMUST00000149803;Parent=ENSMUSG00000063889;Name=Crem-013 +18 protein_coding five_prime_UTR 3325473 3325476 . - . Parent=ENSMUST00000149803 +18 protein_coding five_prime_UTR 3337378 3337587 . - . Parent=ENSMUST00000149803 +18 protein_coding CDS 3295015 3295180 . - 1 Parent=ENSMUST00000149803 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000149803 +18 protein_coding CDS 3325359 3325472 . - 0 Parent=ENSMUST00000149803 +18 protein_coding three_prime_UTR 3294182 3295014 . - . Parent=ENSMUST00000149803 +18 protein_coding exon 3294182 3295180 . - . Parent=ENSMUST00000149803 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000149803 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000149803 +18 protein_coding exon 3337378 3337587 . - . Parent=ENSMUST00000149803 +18 protein_coding mRNA 3266354 3299557 . - . ID=ENSMUST00000122958;Parent=ENSMUSG00000063889;Name=Crem-015 +18 protein_coding five_prime_UTR 3299451 3299557 . - . Parent=ENSMUST00000122958 +18 protein_coding CDS 3267586 3267730 . - 1 Parent=ENSMUST00000122958 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000122958 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000122958 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000122958 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000122958 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000122958 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000122958 +18 protein_coding CDS 3299448 3299450 . - 0 Parent=ENSMUST00000122958 +18 protein_coding three_prime_UTR 3266354 3267585 . - . Parent=ENSMUST00000122958 +18 protein_coding exon 3266354 3267730 . - . Parent=ENSMUST00000122958 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000122958 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000122958 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000122958 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000122958 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000122958 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000122958 +18 protein_coding exon 3299448 3299557 . - . Parent=ENSMUST00000122958 +18 protein_coding mRNA 3266955 3281767 . - . ID=ENSMUST00000140332;Parent=ENSMUSG00000063889;Name=Crem-025 +18 protein_coding five_prime_UTR 3281711 3281767 . - . Parent=ENSMUST00000140332 +18 protein_coding CDS 3267586 3267730 . - 1 Parent=ENSMUST00000140332 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000140332 +18 protein_coding CDS 3281686 3281710 . - 0 Parent=ENSMUST00000140332 +18 protein_coding three_prime_UTR 3266955 3267585 . - . Parent=ENSMUST00000140332 +18 protein_coding exon 3266955 3267730 . - . Parent=ENSMUST00000140332 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000140332 +18 protein_coding exon 3281686 3281767 . - . Parent=ENSMUST00000140332 +18 protein_coding mRNA 3267586 3325472 . - . ID=ENSMUST00000123672;Parent=ENSMUSG00000063889;Name=Crem-033 +18 protein_coding CDS 3267586 3267730 . - 1 Parent=ENSMUST00000123672 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000123672 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000123672 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000123672 +18 protein_coding CDS 3325359 3325472 . - 0 Parent=ENSMUST00000123672 +18 protein_coding exon 3267586 3267730 . - . Parent=ENSMUST00000123672 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000123672 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000123672 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000123672 +18 protein_coding exon 3325359 3325472 . - . Parent=ENSMUST00000123672 +18 protein_coding transcript 3288053 3299552 . - . ID=ENSMUST00000156929;Parent=ENSMUSG00000063889;Name=Crem-016 +18 protein_coding exon 3288053 3288090 . - . Parent=ENSMUST00000156929 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000156929 +18 protein_coding exon 3299448 3299552 . - . Parent=ENSMUST00000156929 +18 protein_coding mRNA 3267583 3327505 . - . ID=ENSMUST00000130455;Parent=ENSMUSG00000063889;Name=Crem-008 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000130455 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000130455 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000130455 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000130455 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000130455 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000130455 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000130455 +18 protein_coding CDS 3327492 3327505 . - 0 Parent=ENSMUST00000130455 +18 protein_coding three_prime_UTR 3267583 3267982 . - . Parent=ENSMUST00000130455 +18 protein_coding exon 3267583 3268127 . - . Parent=ENSMUST00000130455 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000130455 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000130455 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000130455 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000130455 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000130455 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000130455 +18 protein_coding exon 3327492 3327505 . - . Parent=ENSMUST00000130455 +18 protein_coding mRNA 3267983 3309898 . - . ID=ENSMUST00000154715;Parent=ENSMUSG00000063889;Name=Crem-027 +18 protein_coding five_prime_UTR 3309722 3309898 . - . Parent=ENSMUST00000154715 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000154715 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000154715 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000154715 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000154715 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000154715 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000154715 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000154715 +18 protein_coding CDS 3309644 3309721 . - 0 Parent=ENSMUST00000154715 +18 protein_coding exon 3267983 3268127 . - . Parent=ENSMUST00000154715 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000154715 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000154715 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000154715 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000154715 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000154715 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000154715 +18 protein_coding exon 3309644 3309898 . - . Parent=ENSMUST00000154715 +18 protein_coding mRNA 3267544 3281076 . - . ID=ENSMUST00000049942;Parent=ENSMUSG00000063889;Name=Crem-031 +18 protein_coding five_prime_UTR 3276750 3276773 . - . Parent=ENSMUST00000049942 +18 protein_coding five_prime_UTR 3280947 3281076 . - . Parent=ENSMUST00000049942 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000049942 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000049942 +18 protein_coding CDS 3276692 3276749 . - 0 Parent=ENSMUST00000049942 +18 protein_coding three_prime_UTR 3267544 3267982 . - . Parent=ENSMUST00000049942 +18 protein_coding exon 3267544 3268127 . - . Parent=ENSMUST00000049942 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000049942 +18 protein_coding exon 3276692 3276773 . - . Parent=ENSMUST00000049942 +18 protein_coding exon 3280947 3281076 . - . Parent=ENSMUST00000049942 +18 protein_coding mRNA 3267586 3309856 . - . ID=ENSMUST00000144496;Parent=ENSMUSG00000063889;Name=Crem-028 +18 protein_coding five_prime_UTR 3309722 3309856 . - . Parent=ENSMUST00000144496 +18 protein_coding CDS 3267586 3267730 . - 1 Parent=ENSMUST00000144496 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000144496 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000144496 +18 protein_coding CDS 3287902 3288090 . - 2 Parent=ENSMUST00000144496 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000144496 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000144496 +18 protein_coding CDS 3309644 3309721 . - 0 Parent=ENSMUST00000144496 +18 protein_coding exon 3267586 3267730 . - . Parent=ENSMUST00000144496 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000144496 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000144496 +18 protein_coding exon 3287902 3288090 . - . Parent=ENSMUST00000144496 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000144496 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000144496 +18 protein_coding exon 3309644 3309856 . - . Parent=ENSMUST00000144496 +18 protein_coding mRNA 3266354 3337587 . - . ID=ENSMUST00000165086;Parent=ENSMUSG00000063889;Name=Crem-205 +18 protein_coding five_prime_UTR 3327536 3327589 . - . Parent=ENSMUST00000165086 +18 protein_coding five_prime_UTR 3337378 3337587 . - . Parent=ENSMUST00000165086 +18 protein_coding CDS 3267983 3268127 . - 1 Parent=ENSMUST00000165086 +18 protein_coding CDS 3273420 3273576 . - 2 Parent=ENSMUST00000165086 +18 protein_coding CDS 3276692 3276727 . - 2 Parent=ENSMUST00000165086 +18 protein_coding CDS 3295038 3295180 . - 1 Parent=ENSMUST00000165086 +18 protein_coding CDS 3295320 3295414 . - 0 Parent=ENSMUST00000165086 +18 protein_coding CDS 3299160 3299306 . - 0 Parent=ENSMUST00000165086 +18 protein_coding CDS 3325359 3325476 . - 1 Parent=ENSMUST00000165086 +18 protein_coding CDS 3327492 3327535 . - 0 Parent=ENSMUST00000165086 +18 protein_coding three_prime_UTR 3266354 3267982 . - . Parent=ENSMUST00000165086 +18 protein_coding exon 3266354 3268127 . - . Parent=ENSMUST00000165086 +18 protein_coding exon 3273420 3273576 . - . Parent=ENSMUST00000165086 +18 protein_coding exon 3276692 3276727 . - . Parent=ENSMUST00000165086 +18 protein_coding exon 3295038 3295180 . - . Parent=ENSMUST00000165086 +18 protein_coding exon 3295320 3295414 . - . Parent=ENSMUST00000165086 +18 protein_coding exon 3299160 3299306 . - . Parent=ENSMUST00000165086 +18 protein_coding exon 3325359 3325476 . - . Parent=ENSMUST00000165086 +18 protein_coding exon 3327492 3327589 . - . Parent=ENSMUST00000165086 +18 protein_coding exon 3337378 3337587 . - . Parent=ENSMUST00000165086 +18 snoRNA gene 10551287 10551404 . - . ID=ENSMUSG00000084693;Name=SNORA33.5 +18 snoRNA transcript 10551287 10551404 . - . ID=ENSMUST00000122744;Parent=ENSMUSG00000084693;Name=SNORA33.5-201 +18 snoRNA exon 10551287 10551404 . - . Parent=ENSMUST00000122744 +18 protein_coding gene 7347960 7626861 . - . ID=ENSMUSG00000057440;Name=Mpp7 +18 protein_coding mRNA 7347960 7626861 . - . ID=ENSMUST00000115869;Parent=ENSMUSG00000057440;Name=Mpp7-202 +18 protein_coding five_prime_UTR 7561761 7561870 . - . Parent=ENSMUST00000115869 +18 protein_coding five_prime_UTR 7626731 7626861 . - . Parent=ENSMUST00000115869 +18 protein_coding CDS 7350963 7351142 . - 0 Parent=ENSMUST00000115869 +18 protein_coding CDS 7353152 7353295 . - 0 Parent=ENSMUST00000115869 +18 protein_coding CDS 7355016 7355124 . - 1 Parent=ENSMUST00000115869 +18 protein_coding CDS 7356140 7356233 . - 2 Parent=ENSMUST00000115869 +18 protein_coding CDS 7379987 7380067 . - 2 Parent=ENSMUST00000115869 +18 protein_coding CDS 7403184 7403354 . - 2 Parent=ENSMUST00000115869 +18 protein_coding CDS 7439567 7439631 . - 1 Parent=ENSMUST00000115869 +18 protein_coding CDS 7440081 7440277 . - 0 Parent=ENSMUST00000115869 +18 protein_coding CDS 7440430 7440504 . - 0 Parent=ENSMUST00000115869 +18 protein_coding CDS 7441551 7441636 . - 2 Parent=ENSMUST00000115869 +18 protein_coding CDS 7442791 7442872 . - 0 Parent=ENSMUST00000115869 +18 protein_coding CDS 7443972 7444103 . - 0 Parent=ENSMUST00000115869 +18 protein_coding CDS 7458930 7459010 . - 0 Parent=ENSMUST00000115869 +18 protein_coding CDS 7461636 7461713 . - 0 Parent=ENSMUST00000115869 +18 protein_coding CDS 7512942 7513060 . - 2 Parent=ENSMUST00000115869 +18 protein_coding CDS 7561724 7561760 . - 0 Parent=ENSMUST00000115869 +18 protein_coding three_prime_UTR 7347960 7350962 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7347960 7351142 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7353152 7353295 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7355016 7355124 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7356140 7356233 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7379987 7380067 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7403184 7403354 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7439567 7439631 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7440081 7440277 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7440430 7440504 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7441551 7441636 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7442791 7442872 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7443972 7444103 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7458930 7459010 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7461636 7461713 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7512942 7513060 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7561724 7561870 . - . Parent=ENSMUST00000115869 +18 protein_coding exon 7626731 7626861 . - . Parent=ENSMUST00000115869 +18 protein_coding mRNA 7429282 7626861 . - . ID=ENSMUST00000025129;Parent=ENSMUSG00000057440;Name=Mpp7-201 +18 protein_coding five_prime_UTR 7561728 7561870 . - . Parent=ENSMUST00000025129 +18 protein_coding five_prime_UTR 7626731 7626861 . - . Parent=ENSMUST00000025129 +18 protein_coding CDS 7429282 7429322 . - 2 Parent=ENSMUST00000025129 +18 protein_coding CDS 7430259 7430270 . - 2 Parent=ENSMUST00000025129 +18 protein_coding CDS 7430393 7430413 . - 2 Parent=ENSMUST00000025129 +18 protein_coding CDS 7439567 7439631 . - 1 Parent=ENSMUST00000025129 +18 protein_coding CDS 7440081 7440277 . - 0 Parent=ENSMUST00000025129 +18 protein_coding CDS 7440430 7440504 . - 0 Parent=ENSMUST00000025129 +18 protein_coding CDS 7441551 7441636 . - 2 Parent=ENSMUST00000025129 +18 protein_coding CDS 7442791 7442872 . - 0 Parent=ENSMUST00000025129 +18 protein_coding CDS 7443972 7444103 . - 0 Parent=ENSMUST00000025129 +18 protein_coding CDS 7458930 7459010 . - 0 Parent=ENSMUST00000025129 +18 protein_coding CDS 7461636 7461713 . - 0 Parent=ENSMUST00000025129 +18 protein_coding CDS 7512942 7513060 . - 2 Parent=ENSMUST00000025129 +18 protein_coding CDS 7561724 7561727 . - 0 Parent=ENSMUST00000025129 +18 protein_coding exon 7429282 7429322 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7430259 7430270 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7430393 7430413 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7439567 7439631 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7440081 7440277 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7440430 7440504 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7441551 7441636 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7442791 7442872 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7443972 7444103 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7458930 7459010 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7461636 7461713 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7512942 7513060 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7561724 7561870 . - . Parent=ENSMUST00000025129 +18 protein_coding exon 7626731 7626861 . - . Parent=ENSMUST00000025129
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/ens_mm9_chr18.gtf Thu Apr 23 17:57:49 2015 -0400 @@ -0,0 +1,1066 @@ +18 lincRNA exon 11049085 11050819 . - . gene_id "ENSMUSG00000087274"; transcript_id "ENSMUST00000138373"; exon_number "1"; gene_name "1010001N08Rik"; +18 lincRNA exon 11051256 11051487 . - . gene_id "ENSMUSG00000087274"; transcript_id "ENSMUST00000138373"; exon_number "2"; gene_name "1010001N08Rik"; +18 lincRNA exon 11049929 11050254 . - . gene_id "ENSMUSG00000087274"; transcript_id "ENSMUST00000133759"; exon_number "1"; gene_name "1010001N08Rik"; +18 lincRNA exon 11050622 11050819 . - . gene_id "ENSMUSG00000087274"; transcript_id "ENSMUST00000133759"; exon_number "2"; gene_name "1010001N08Rik"; +18 lincRNA exon 11051256 11051366 . - . gene_id "ENSMUSG00000087274"; transcript_id "ENSMUST00000133759"; exon_number "3"; gene_name "1010001N08Rik"; +18 lincRNA exon 11052473 11052565 . - . gene_id "ENSMUSG00000087274"; transcript_id "ENSMUST00000133759"; exon_number "4"; gene_name "1010001N08Rik"; +18 lincRNA exon 5162878 5164430 . - . gene_id "ENSMUSG00000085461"; transcript_id "ENSMUST00000150337"; exon_number "1"; gene_name "Gm16954"; +18 lincRNA exon 5165286 5165400 . - . gene_id "ENSMUSG00000085461"; transcript_id "ENSMUST00000150337"; exon_number "2"; gene_name "Gm16954"; +18 lincRNA exon 5165669 5165729 . - . gene_id "ENSMUSG00000085461"; transcript_id "ENSMUST00000150337"; exon_number "3"; gene_name "Gm16954"; +18 protein_coding exon 12657194 12657637 . - . gene_id "ENSMUSG00000090309"; transcript_id "ENSMUST00000172267"; exon_number "1"; gene_name "AC102131.1"; +18 protein_coding CDS 12657194 12657637 . - 0 gene_id "ENSMUSG00000090309"; transcript_id "ENSMUST00000172267"; exon_number "1"; gene_name "AC102131.1"; +18 protein_coding start_codon 12657635 12657637 . - 0 gene_id "ENSMUSG00000090309"; transcript_id "ENSMUST00000172267"; exon_number "1"; gene_name "AC102131.1"; +18 protein_coding stop_codon 12657194 12657196 . - 0 gene_id "ENSMUSG00000090309"; transcript_id "ENSMUST00000172267"; exon_number "1"; gene_name "AC102131.1"; +18 lincRNA exon 11979185 11979574 . - . gene_id "ENSMUSG00000087420"; transcript_id "ENSMUST00000129627"; exon_number "1"; gene_name "Gm6277"; +18 lincRNA exon 11979624 11980616 . - . gene_id "ENSMUSG00000087420"; transcript_id "ENSMUST00000129627"; exon_number "2"; gene_name "Gm6277"; +18 lincRNA exon 11981407 11981548 . - . gene_id "ENSMUSG00000087420"; transcript_id "ENSMUST00000129627"; exon_number "3"; gene_name "Gm6277"; +18 lincRNA exon 11983673 11983735 . - . gene_id "ENSMUSG00000087420"; transcript_id "ENSMUST00000129627"; exon_number "4"; gene_name "Gm6277"; +18 lincRNA exon 11997690 11997846 . - . gene_id "ENSMUSG00000087420"; transcript_id "ENSMUST00000129627"; exon_number "5"; gene_name "Gm6277"; +18 misc_RNA exon 3860106 3860428 . + . gene_id "ENSMUSG00000084719"; transcript_id "ENSMUST00000122770"; exon_number "1"; gene_name "7SK.69"; +18 protein_coding exon 11815936 11816201 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "1"; gene_name "Rbbp8"; +18 protein_coding CDS 11819342 11819450 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "1"; gene_name "Rbbp8"; +18 protein_coding start_codon 11819342 11819344 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "1"; gene_name "Rbbp8"; +18 protein_coding exon 11819244 11819450 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "2"; gene_name "Rbbp8"; +18 protein_coding CDS 11831091 11831133 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "2"; gene_name "Rbbp8"; +18 protein_coding exon 11831091 11831133 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "3"; gene_name "Rbbp8"; +18 protein_coding CDS 11836104 11836199 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "3"; gene_name "Rbbp8"; +18 protein_coding exon 11836104 11836199 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "4"; gene_name "Rbbp8"; +18 protein_coding CDS 11851521 11851633 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "4"; gene_name "Rbbp8"; +18 protein_coding exon 11851521 11851633 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "5"; gene_name "Rbbp8"; +18 protein_coding CDS 11855252 11855318 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "5"; gene_name "Rbbp8"; +18 protein_coding exon 11855252 11855318 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "6"; gene_name "Rbbp8"; +18 protein_coding CDS 11864201 11864376 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "6"; gene_name "Rbbp8"; +18 protein_coding exon 11864201 11864376 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "7"; gene_name "Rbbp8"; +18 protein_coding CDS 11874243 11874347 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "7"; gene_name "Rbbp8"; +18 protein_coding exon 11874243 11874347 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "8"; gene_name "Rbbp8"; +18 protein_coding CDS 11877342 11877439 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "8"; gene_name "Rbbp8"; +18 protein_coding exon 11877342 11877439 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "9"; gene_name "Rbbp8"; +18 protein_coding CDS 11879054 11879166 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "9"; gene_name "Rbbp8"; +18 protein_coding exon 11879054 11879166 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "10"; gene_name "Rbbp8"; +18 protein_coding CDS 11880149 11881034 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "10"; gene_name "Rbbp8"; +18 protein_coding exon 11880149 11881034 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "11"; gene_name "Rbbp8"; +18 protein_coding CDS 11881113 11881239 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "11"; gene_name "Rbbp8"; +18 protein_coding exon 11881113 11881239 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "12"; gene_name "Rbbp8"; +18 protein_coding CDS 11883916 11884004 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "12"; gene_name "Rbbp8"; +18 protein_coding exon 11883916 11884004 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "13"; gene_name "Rbbp8"; +18 protein_coding CDS 11885682 11885777 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "13"; gene_name "Rbbp8"; +18 protein_coding exon 11885682 11885793 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "14"; gene_name "Rbbp8"; +18 protein_coding exon 11890699 11890839 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "15"; gene_name "Rbbp8"; +18 protein_coding exon 11892985 11893054 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "16"; gene_name "Rbbp8"; +18 protein_coding exon 11897082 11897178 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "17"; gene_name "Rbbp8"; +18 protein_coding exon 11899435 11899576 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "18"; gene_name "Rbbp8"; +18 protein_coding exon 11901125 11901387 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "19"; gene_name "Rbbp8"; +18 protein_coding stop_codon 11885775 11885777 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000047322"; exon_number "19"; gene_name "Rbbp8"; +18 protein_coding exon 11791785 11792033 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "1"; gene_name "Rbbp8"; +18 protein_coding CDS 11819342 11819450 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "1"; gene_name "Rbbp8"; +18 protein_coding start_codon 11819342 11819344 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "1"; gene_name "Rbbp8"; +18 protein_coding exon 11819244 11819450 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "2"; gene_name "Rbbp8"; +18 protein_coding CDS 11831091 11831133 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "2"; gene_name "Rbbp8"; +18 protein_coding exon 11831091 11831133 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "3"; gene_name "Rbbp8"; +18 protein_coding CDS 11836104 11836199 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "3"; gene_name "Rbbp8"; +18 protein_coding exon 11836104 11836199 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "4"; gene_name "Rbbp8"; +18 protein_coding CDS 11851521 11851633 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "4"; gene_name "Rbbp8"; +18 protein_coding exon 11851521 11851633 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "5"; gene_name "Rbbp8"; +18 protein_coding CDS 11855252 11855318 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "5"; gene_name "Rbbp8"; +18 protein_coding exon 11855252 11855318 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "6"; gene_name "Rbbp8"; +18 protein_coding CDS 11864201 11864376 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "6"; gene_name "Rbbp8"; +18 protein_coding exon 11864201 11864376 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "7"; gene_name "Rbbp8"; +18 protein_coding CDS 11874243 11874347 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "7"; gene_name "Rbbp8"; +18 protein_coding exon 11874243 11874347 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "8"; gene_name "Rbbp8"; +18 protein_coding CDS 11877342 11877439 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "8"; gene_name "Rbbp8"; +18 protein_coding exon 11877342 11877439 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "9"; gene_name "Rbbp8"; +18 protein_coding CDS 11879054 11879166 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "9"; gene_name "Rbbp8"; +18 protein_coding exon 11879054 11879166 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "10"; gene_name "Rbbp8"; +18 protein_coding CDS 11880149 11881034 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "10"; gene_name "Rbbp8"; +18 protein_coding exon 11880149 11881034 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "11"; gene_name "Rbbp8"; +18 protein_coding CDS 11881113 11881239 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "11"; gene_name "Rbbp8"; +18 protein_coding exon 11881113 11881239 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "12"; gene_name "Rbbp8"; +18 protein_coding CDS 11883916 11884004 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "12"; gene_name "Rbbp8"; +18 protein_coding exon 11883916 11884004 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "13"; gene_name "Rbbp8"; +18 protein_coding CDS 11885682 11885793 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "13"; gene_name "Rbbp8"; +18 protein_coding exon 11885682 11885793 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "14"; gene_name "Rbbp8"; +18 protein_coding CDS 11890699 11890839 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "14"; gene_name "Rbbp8"; +18 protein_coding exon 11890699 11890839 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "15"; gene_name "Rbbp8"; +18 protein_coding CDS 11892985 11893054 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "15"; gene_name "Rbbp8"; +18 protein_coding exon 11892985 11893054 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "16"; gene_name "Rbbp8"; +18 protein_coding CDS 11897082 11897178 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "16"; gene_name "Rbbp8"; +18 protein_coding exon 11897082 11897178 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "17"; gene_name "Rbbp8"; +18 protein_coding CDS 11899435 11899576 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "17"; gene_name "Rbbp8"; +18 protein_coding exon 11899435 11899576 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "18"; gene_name "Rbbp8"; +18 protein_coding CDS 11901125 11901222 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "18"; gene_name "Rbbp8"; +18 protein_coding exon 11901125 11901324 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "19"; gene_name "Rbbp8"; +18 protein_coding stop_codon 11901220 11901222 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000165655"; exon_number "19"; gene_name "Rbbp8"; +18 protein_coding exon 11816351 11816482 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "1"; gene_name "Rbbp8"; +18 protein_coding CDS 11819342 11819450 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "1"; gene_name "Rbbp8"; +18 protein_coding start_codon 11819342 11819344 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "1"; gene_name "Rbbp8"; +18 protein_coding exon 11819244 11819450 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "2"; gene_name "Rbbp8"; +18 protein_coding CDS 11831091 11831133 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "2"; gene_name "Rbbp8"; +18 protein_coding exon 11831091 11831133 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "3"; gene_name "Rbbp8"; +18 protein_coding CDS 11836104 11836199 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "3"; gene_name "Rbbp8"; +18 protein_coding exon 11836104 11836199 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "4"; gene_name "Rbbp8"; +18 protein_coding CDS 11851521 11851633 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "4"; gene_name "Rbbp8"; +18 protein_coding exon 11851521 11851633 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "5"; gene_name "Rbbp8"; +18 protein_coding CDS 11855252 11855318 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "5"; gene_name "Rbbp8"; +18 protein_coding exon 11855252 11855318 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "6"; gene_name "Rbbp8"; +18 protein_coding CDS 11864201 11864376 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "6"; gene_name "Rbbp8"; +18 protein_coding exon 11864201 11864376 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "7"; gene_name "Rbbp8"; +18 protein_coding CDS 11874243 11874347 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "7"; gene_name "Rbbp8"; +18 protein_coding exon 11874243 11874347 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "8"; gene_name "Rbbp8"; +18 protein_coding CDS 11877342 11877439 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "8"; gene_name "Rbbp8"; +18 protein_coding exon 11877342 11877439 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "9"; gene_name "Rbbp8"; +18 protein_coding CDS 11879054 11879166 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "9"; gene_name "Rbbp8"; +18 protein_coding exon 11879054 11879166 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "10"; gene_name "Rbbp8"; +18 protein_coding CDS 11880149 11881034 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "10"; gene_name "Rbbp8"; +18 protein_coding exon 11880149 11881034 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "11"; gene_name "Rbbp8"; +18 protein_coding CDS 11881113 11881239 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "11"; gene_name "Rbbp8"; +18 protein_coding exon 11881113 11881239 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "12"; gene_name "Rbbp8"; +18 protein_coding CDS 11883916 11884004 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "12"; gene_name "Rbbp8"; +18 protein_coding exon 11883916 11884004 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "13"; gene_name "Rbbp8"; +18 protein_coding CDS 11885682 11885793 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "13"; gene_name "Rbbp8"; +18 protein_coding exon 11885682 11885793 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "14"; gene_name "Rbbp8"; +18 protein_coding CDS 11890699 11890839 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "14"; gene_name "Rbbp8"; +18 protein_coding exon 11890699 11890839 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "15"; gene_name "Rbbp8"; +18 protein_coding CDS 11892985 11893054 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "15"; gene_name "Rbbp8"; +18 protein_coding exon 11892985 11893054 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "16"; gene_name "Rbbp8"; +18 protein_coding CDS 11897082 11897178 . + 1 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "16"; gene_name "Rbbp8"; +18 protein_coding exon 11897082 11897178 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "17"; gene_name "Rbbp8"; +18 protein_coding CDS 11899435 11899576 . + 0 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "17"; gene_name "Rbbp8"; +18 protein_coding exon 11899435 11899576 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "18"; gene_name "Rbbp8"; +18 protein_coding CDS 11901125 11901222 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "18"; gene_name "Rbbp8"; +18 protein_coding exon 11901125 11901716 . + . gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "19"; gene_name "Rbbp8"; +18 protein_coding stop_codon 11901220 11901222 . + 2 gene_id "ENSMUSG00000041238"; transcript_id "ENSMUST00000115861"; exon_number "19"; gene_name "Rbbp8"; +18 protein_coding exon 7088231 7088565 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "1"; gene_name "Armc4"; +18 protein_coding CDS 7088452 7088565 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "1"; gene_name "Armc4"; +18 protein_coding start_codon 7294607 7294609 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "1"; gene_name "Armc4"; +18 protein_coding exon 7127210 7127431 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "2"; gene_name "Armc4"; +18 protein_coding CDS 7127210 7127431 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "2"; gene_name "Armc4"; +18 protein_coding exon 7129397 7129585 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "3"; gene_name "Armc4"; +18 protein_coding CDS 7129397 7129585 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "3"; gene_name "Armc4"; +18 protein_coding exon 7181732 7181846 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "4"; gene_name "Armc4"; +18 protein_coding CDS 7181732 7181846 . - 1 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "4"; gene_name "Armc4"; +18 protein_coding exon 7211397 7211639 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "5"; gene_name "Armc4"; +18 protein_coding CDS 7211397 7211639 . - 1 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "5"; gene_name "Armc4"; +18 protein_coding exon 7214567 7214721 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "6"; gene_name "Armc4"; +18 protein_coding CDS 7214567 7214721 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "6"; gene_name "Armc4"; +18 protein_coding exon 7216933 7217043 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "7"; gene_name "Armc4"; +18 protein_coding CDS 7216933 7217043 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "7"; gene_name "Armc4"; +18 protein_coding exon 7217746 7217988 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "8"; gene_name "Armc4"; +18 protein_coding CDS 7217746 7217988 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "8"; gene_name "Armc4"; +18 protein_coding exon 7222544 7222753 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "9"; gene_name "Armc4"; +18 protein_coding CDS 7222544 7222753 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "9"; gene_name "Armc4"; +18 protein_coding exon 7223528 7223674 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "10"; gene_name "Armc4"; +18 protein_coding CDS 7223528 7223674 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "10"; gene_name "Armc4"; +18 protein_coding exon 7264999 7265146 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "11"; gene_name "Armc4"; +18 protein_coding CDS 7264999 7265146 . - 1 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "11"; gene_name "Armc4"; +18 protein_coding exon 7266881 7266979 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "12"; gene_name "Armc4"; +18 protein_coding CDS 7266881 7266979 . - 1 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "12"; gene_name "Armc4"; +18 protein_coding exon 7268398 7268585 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "13"; gene_name "Armc4"; +18 protein_coding CDS 7268398 7268585 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "13"; gene_name "Armc4"; +18 protein_coding exon 7273157 7273273 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "14"; gene_name "Armc4"; +18 protein_coding CDS 7273157 7273273 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "14"; gene_name "Armc4"; +18 protein_coding exon 7285345 7285481 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "15"; gene_name "Armc4"; +18 protein_coding CDS 7285345 7285481 . - 2 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "15"; gene_name "Armc4"; +18 protein_coding exon 7285684 7285790 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "16"; gene_name "Armc4"; +18 protein_coding CDS 7285684 7285790 . - 1 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "16"; gene_name "Armc4"; +18 protein_coding exon 7286659 7286845 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "17"; gene_name "Armc4"; +18 protein_coding CDS 7286659 7286845 . - 2 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "17"; gene_name "Armc4"; +18 protein_coding exon 7288482 7288639 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "18"; gene_name "Armc4"; +18 protein_coding CDS 7288482 7288639 . - 1 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "18"; gene_name "Armc4"; +18 protein_coding exon 7294386 7294622 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "19"; gene_name "Armc4"; +18 protein_coding CDS 7294386 7294609 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "19"; gene_name "Armc4"; +18 protein_coding exon 7296949 7297055 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "20"; gene_name "Armc4"; +18 protein_coding exon 7297878 7297899 . - . gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "21"; gene_name "Armc4"; +18 protein_coding stop_codon 7088452 7088454 . - 0 gene_id "ENSMUSG00000061802"; transcript_id "ENSMUST00000081275"; exon_number "21"; gene_name "Armc4"; +18 miRNA exon 10782897 10782983 . - . gene_id "ENSMUSG00000065399"; transcript_id "ENSMUST00000083465"; exon_number "1"; gene_name "Mir133a-1"; +18 lincRNA exon 3336414 3337176 . + . gene_id "ENSMUSG00000091488"; transcript_id "ENSMUST00000171726"; exon_number "1"; gene_name "AC124336.2"; +18 lincRNA exon 3365925 3366861 . + . gene_id "ENSMUSG00000091488"; transcript_id "ENSMUST00000171726"; exon_number "2"; gene_name "AC124336.2"; +18 protein_coding exon 9707646 9707757 . + . gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "1"; gene_name "Colec12"; +18 protein_coding CDS 9707751 9707757 . + 0 gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "1"; gene_name "Colec12"; +18 protein_coding start_codon 9707751 9707753 . + 0 gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "1"; gene_name "Colec12"; +18 protein_coding exon 9720919 9720969 . + . gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "2"; gene_name "Colec12"; +18 protein_coding CDS 9720919 9720969 . + 2 gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "2"; gene_name "Colec12"; +18 protein_coding exon 9840237 9840359 . + . gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "3"; gene_name "Colec12"; +18 protein_coding CDS 9840237 9840359 . + 2 gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "3"; gene_name "Colec12"; +18 protein_coding exon 9846785 9846883 . + . gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "4"; gene_name "Colec12"; +18 protein_coding CDS 9846785 9846883 . + 2 gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "4"; gene_name "Colec12"; +18 protein_coding exon 9848102 9849148 . + . gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "5"; gene_name "Colec12"; +18 protein_coding CDS 9848102 9849148 . + 2 gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "5"; gene_name "Colec12"; +18 protein_coding exon 9858544 9859032 . + . gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "6"; gene_name "Colec12"; +18 protein_coding CDS 9858544 9859032 . + 2 gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "6"; gene_name "Colec12"; +18 protein_coding exon 9859836 9859972 . + . gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "7"; gene_name "Colec12"; +18 protein_coding CDS 9859836 9859972 . + 2 gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "7"; gene_name "Colec12"; +18 protein_coding exon 9866742 9866851 . + . gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "8"; gene_name "Colec12"; +18 protein_coding CDS 9866742 9866851 . + 0 gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "8"; gene_name "Colec12"; +18 protein_coding exon 9874787 9874932 . + . gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "9"; gene_name "Colec12"; +18 protein_coding CDS 9874787 9874932 . + 1 gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "9"; gene_name "Colec12"; +18 protein_coding exon 9876986 9877993 . + . gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "10"; gene_name "Colec12"; +18 protein_coding CDS 9876986 9877005 . + 2 gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "10"; gene_name "Colec12"; +18 protein_coding stop_codon 9877003 9877005 . + 2 gene_id "ENSMUSG00000036103"; transcript_id "ENSMUST00000040069"; exon_number "10"; gene_name "Colec12"; +18 miRNA exon 3398783 3398904 . - . gene_id "ENSMUSG00000080475"; transcript_id "ENSMUST00000116825"; exon_number "1"; gene_name "AC124336.1"; +18 lincRNA exon 10706858 10708202 . + . gene_id "ENSMUSG00000084832"; transcript_id "ENSMUST00000130193"; exon_number "1"; gene_name "4930563E18Rik"; +18 lincRNA exon 10710510 10710564 . + . gene_id "ENSMUSG00000084832"; transcript_id "ENSMUST00000130193"; exon_number "2"; gene_name "4930563E18Rik"; +18 lincRNA exon 10711678 10711830 . + . gene_id "ENSMUSG00000084832"; transcript_id "ENSMUST00000130193"; exon_number "3"; gene_name "4930563E18Rik"; +18 protein_coding exon 9314042 9316670 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "1"; gene_name "Ccny"; +18 protein_coding CDS 9316554 9316670 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "1"; gene_name "Ccny"; +18 protein_coding start_codon 9449667 9449669 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "1"; gene_name "Ccny"; +18 protein_coding exon 9319407 9319569 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "2"; gene_name "Ccny"; +18 protein_coding CDS 9319407 9319569 . - 1 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "2"; gene_name "Ccny"; +18 protein_coding exon 9332782 9332948 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "3"; gene_name "Ccny"; +18 protein_coding CDS 9332782 9332948 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "3"; gene_name "Ccny"; +18 protein_coding exon 9345192 9345311 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "4"; gene_name "Ccny"; +18 protein_coding CDS 9345192 9345311 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "4"; gene_name "Ccny"; +18 protein_coding exon 9345412 9345469 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "5"; gene_name "Ccny"; +18 protein_coding CDS 9345412 9345469 . - 1 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "5"; gene_name "Ccny"; +18 protein_coding exon 9349386 9349421 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "6"; gene_name "Ccny"; +18 protein_coding CDS 9349386 9349421 . - 1 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "6"; gene_name "Ccny"; +18 protein_coding exon 9353405 9353505 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "7"; gene_name "Ccny"; +18 protein_coding CDS 9353405 9353505 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "7"; gene_name "Ccny"; +18 protein_coding exon 9377792 9377826 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "8"; gene_name "Ccny"; +18 protein_coding CDS 9377792 9377826 . - 2 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "8"; gene_name "Ccny"; +18 protein_coding exon 9386733 9386807 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "9"; gene_name "Ccny"; +18 protein_coding CDS 9386733 9386807 . - 2 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "9"; gene_name "Ccny"; +18 protein_coding exon 9449516 9450148 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "10"; gene_name "Ccny"; +18 protein_coding CDS 9449516 9449669 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "10"; gene_name "Ccny"; +18 protein_coding stop_codon 9316554 9316556 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000053917"; exon_number "10"; gene_name "Ccny"; +18 protein_coding exon 9314042 9316670 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "1"; gene_name "Ccny"; +18 protein_coding CDS 9316554 9316670 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "1"; gene_name "Ccny"; +18 protein_coding start_codon 9449667 9449669 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "1"; gene_name "Ccny"; +18 protein_coding exon 9319407 9319569 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "2"; gene_name "Ccny"; +18 protein_coding CDS 9319407 9319569 . - 1 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "2"; gene_name "Ccny"; +18 protein_coding exon 9332782 9332948 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "3"; gene_name "Ccny"; +18 protein_coding CDS 9332782 9332948 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "3"; gene_name "Ccny"; +18 protein_coding exon 9345192 9345311 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "4"; gene_name "Ccny"; +18 protein_coding CDS 9345192 9345311 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "4"; gene_name "Ccny"; +18 protein_coding exon 9345412 9345469 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "5"; gene_name "Ccny"; +18 protein_coding CDS 9345412 9345469 . - 1 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "5"; gene_name "Ccny"; +18 protein_coding exon 9349386 9349421 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "6"; gene_name "Ccny"; +18 protein_coding CDS 9349386 9349421 . - 1 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "6"; gene_name "Ccny"; +18 protein_coding exon 9353405 9353505 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "7"; gene_name "Ccny"; +18 protein_coding CDS 9353405 9353505 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "7"; gene_name "Ccny"; +18 protein_coding exon 9377792 9377826 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "8"; gene_name "Ccny"; +18 protein_coding CDS 9377792 9377826 . - 2 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "8"; gene_name "Ccny"; +18 protein_coding exon 9449516 9450148 . - . gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "9"; gene_name "Ccny"; +18 protein_coding CDS 9449516 9449669 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "9"; gene_name "Ccny"; +18 protein_coding stop_codon 9316554 9316556 . - 0 gene_id "ENSMUSG00000024286"; transcript_id "ENSMUST00000115867"; exon_number "9"; gene_name "Ccny"; +18 protein_coding exon 9726195 9726668 . - . gene_id "ENSMUSG00000091285"; transcript_id "ENSMUST00000171339"; exon_number "1"; gene_name "AC163101.1"; +18 protein_coding CDS 9726195 9726668 . - 0 gene_id "ENSMUSG00000091285"; transcript_id "ENSMUST00000171339"; exon_number "1"; gene_name "AC163101.1"; +18 protein_coding start_codon 9726666 9726668 . - 0 gene_id "ENSMUSG00000091285"; transcript_id "ENSMUST00000171339"; exon_number "1"; gene_name "AC163101.1"; +18 protein_coding stop_codon 9726195 9726197 . - 0 gene_id "ENSMUSG00000091285"; transcript_id "ENSMUST00000171339"; exon_number "1"; gene_name "AC163101.1"; +18 snoRNA exon 9614312 9614437 . + . gene_id "ENSMUSG00000088996"; transcript_id "ENSMUST00000158371"; exon_number "1"; gene_name "SNORA25.10"; +18 protein_coding exon 7347960 7351142 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "1"; gene_name "Mpp7"; +18 protein_coding CDS 7350963 7351142 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "1"; gene_name "Mpp7"; +18 protein_coding start_codon 7561758 7561760 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "1"; gene_name "Mpp7"; +18 protein_coding exon 7353152 7353295 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "2"; gene_name "Mpp7"; +18 protein_coding CDS 7353152 7353295 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "2"; gene_name "Mpp7"; +18 protein_coding exon 7355016 7355124 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "3"; gene_name "Mpp7"; +18 protein_coding CDS 7355016 7355124 . - 1 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "3"; gene_name "Mpp7"; +18 protein_coding exon 7356140 7356233 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "4"; gene_name "Mpp7"; +18 protein_coding CDS 7356140 7356233 . - 2 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "4"; gene_name "Mpp7"; +18 protein_coding exon 7379987 7380067 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "5"; gene_name "Mpp7"; +18 protein_coding CDS 7379987 7380067 . - 2 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "5"; gene_name "Mpp7"; +18 protein_coding exon 7403184 7403354 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "6"; gene_name "Mpp7"; +18 protein_coding CDS 7403184 7403354 . - 2 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "6"; gene_name "Mpp7"; +18 protein_coding exon 7439567 7439631 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "7"; gene_name "Mpp7"; +18 protein_coding CDS 7439567 7439631 . - 1 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "7"; gene_name "Mpp7"; +18 protein_coding exon 7440081 7440277 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "8"; gene_name "Mpp7"; +18 protein_coding CDS 7440081 7440277 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "8"; gene_name "Mpp7"; +18 protein_coding exon 7440430 7440504 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "9"; gene_name "Mpp7"; +18 protein_coding CDS 7440430 7440504 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "9"; gene_name "Mpp7"; +18 protein_coding exon 7441551 7441636 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "10"; gene_name "Mpp7"; +18 protein_coding CDS 7441551 7441636 . - 2 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "10"; gene_name "Mpp7"; +18 protein_coding exon 7442791 7442872 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "11"; gene_name "Mpp7"; +18 protein_coding CDS 7442791 7442872 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "11"; gene_name "Mpp7"; +18 protein_coding exon 7443972 7444103 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "12"; gene_name "Mpp7"; +18 protein_coding CDS 7443972 7444103 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "12"; gene_name "Mpp7"; +18 protein_coding exon 7458930 7459010 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "13"; gene_name "Mpp7"; +18 protein_coding CDS 7458930 7459010 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "13"; gene_name "Mpp7"; +18 protein_coding exon 7461636 7461713 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "14"; gene_name "Mpp7"; +18 protein_coding CDS 7461636 7461713 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "14"; gene_name "Mpp7"; +18 protein_coding exon 7512942 7513060 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "15"; gene_name "Mpp7"; +18 protein_coding CDS 7512942 7513060 . - 2 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "15"; gene_name "Mpp7"; +18 protein_coding exon 7561724 7561870 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "16"; gene_name "Mpp7"; +18 protein_coding CDS 7561724 7561760 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "16"; gene_name "Mpp7"; +18 protein_coding exon 7626731 7626861 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "17"; gene_name "Mpp7"; +18 protein_coding stop_codon 7350963 7350965 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000115869"; exon_number "17"; gene_name "Mpp7"; +18 protein_coding exon 7429282 7429322 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "1"; gene_name "Mpp7"; +18 protein_coding CDS 7429282 7429322 . - 2 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "1"; gene_name "Mpp7"; +18 protein_coding start_codon 7561725 7561727 . - 2 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "1"; gene_name "Mpp7"; +18 protein_coding exon 7430259 7430270 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "2"; gene_name "Mpp7"; +18 protein_coding CDS 7430259 7430270 . - 2 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "2"; gene_name "Mpp7"; +18 protein_coding exon 7430393 7430413 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "3"; gene_name "Mpp7"; +18 protein_coding CDS 7430393 7430413 . - 2 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "3"; gene_name "Mpp7"; +18 protein_coding exon 7439567 7439631 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "4"; gene_name "Mpp7"; +18 protein_coding CDS 7439567 7439631 . - 1 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "4"; gene_name "Mpp7"; +18 protein_coding exon 7440081 7440277 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "5"; gene_name "Mpp7"; +18 protein_coding CDS 7440081 7440277 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "5"; gene_name "Mpp7"; +18 protein_coding exon 7440430 7440504 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "6"; gene_name "Mpp7"; +18 protein_coding CDS 7440430 7440504 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "6"; gene_name "Mpp7"; +18 protein_coding exon 7441551 7441636 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "7"; gene_name "Mpp7"; +18 protein_coding CDS 7441551 7441636 . - 2 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "7"; gene_name "Mpp7"; +18 protein_coding exon 7442791 7442872 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "8"; gene_name "Mpp7"; +18 protein_coding CDS 7442791 7442872 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "8"; gene_name "Mpp7"; +18 protein_coding exon 7443972 7444103 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "9"; gene_name "Mpp7"; +18 protein_coding CDS 7443972 7444103 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "9"; gene_name "Mpp7"; +18 protein_coding exon 7458930 7459010 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "10"; gene_name "Mpp7"; +18 protein_coding CDS 7458930 7459010 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "10"; gene_name "Mpp7"; +18 protein_coding exon 7461636 7461713 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "11"; gene_name "Mpp7"; +18 protein_coding CDS 7461636 7461713 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "11"; gene_name "Mpp7"; +18 protein_coding exon 7512942 7513060 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "12"; gene_name "Mpp7"; +18 protein_coding CDS 7512942 7513060 . - 2 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "12"; gene_name "Mpp7"; +18 protein_coding exon 7561724 7561870 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "13"; gene_name "Mpp7"; +18 protein_coding CDS 7561724 7561727 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "13"; gene_name "Mpp7"; +18 protein_coding exon 7626731 7626861 . - . gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "14"; gene_name "Mpp7"; +18 protein_coding stop_codon 7429282 7429284 . - 0 gene_id "ENSMUSG00000057440"; transcript_id "ENSMUST00000025129"; exon_number "14"; gene_name "Mpp7"; +18 protein_coding exon 10760807 10760946 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "1"; gene_name "Mib1"; +18 protein_coding CDS 10760807 10760946 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "1"; gene_name "Mib1"; +18 protein_coding start_codon 10760807 10760809 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "1"; gene_name "Mib1"; +18 protein_coding exon 10763187 10763320 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "2"; gene_name "Mib1"; +18 protein_coding CDS 10763187 10763320 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "2"; gene_name "Mib1"; +18 protein_coding exon 10768122 10768229 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "3"; gene_name "Mib1"; +18 protein_coding CDS 10768122 10768229 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "3"; gene_name "Mib1"; +18 protein_coding exon 10775527 10775724 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "4"; gene_name "Mib1"; +18 protein_coding CDS 10775527 10775724 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "4"; gene_name "Mib1"; +18 protein_coding exon 10778147 10778298 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "5"; gene_name "Mib1"; +18 protein_coding CDS 10778147 10778298 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "5"; gene_name "Mib1"; +18 protein_coding exon 10792893 10793025 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "6"; gene_name "Mib1"; +18 protein_coding CDS 10792893 10793025 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "6"; gene_name "Mib1"; +18 protein_coding exon 10794476 10794562 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "7"; gene_name "Mib1"; +18 protein_coding CDS 10794476 10794562 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "7"; gene_name "Mib1"; +18 protein_coding exon 10795688 10795849 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "8"; gene_name "Mib1"; +18 protein_coding CDS 10795688 10795849 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "8"; gene_name "Mib1"; +18 protein_coding exon 10798350 10798531 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "9"; gene_name "Mib1"; +18 protein_coding CDS 10798350 10798531 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "9"; gene_name "Mib1"; +18 protein_coding exon 10800054 10800246 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "10"; gene_name "Mib1"; +18 protein_coding CDS 10800054 10800246 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "10"; gene_name "Mib1"; +18 protein_coding exon 10802259 10802337 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "11"; gene_name "Mib1"; +18 protein_coding CDS 10802259 10802337 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "11"; gene_name "Mib1"; +18 protein_coding exon 10804685 10804798 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "12"; gene_name "Mib1"; +18 protein_coding CDS 10804685 10804798 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "12"; gene_name "Mib1"; +18 protein_coding exon 10808032 10808132 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "13"; gene_name "Mib1"; +18 protein_coding CDS 10808032 10808132 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "13"; gene_name "Mib1"; +18 protein_coding exon 10811983 10812154 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "14"; gene_name "Mib1"; +18 protein_coding CDS 10811983 10812123 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "14"; gene_name "Mib1"; +18 protein_coding exon 10817817 10818702 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "15"; gene_name "Mib1"; +18 protein_coding stop_codon 10812121 10812123 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000124288"; exon_number "15"; gene_name "Mib1"; +18 protein_coding exon 10798363 10798531 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "1"; gene_name "Mib1"; +18 protein_coding CDS 10798363 10798531 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "1"; gene_name "Mib1"; +18 protein_coding start_codon 10798363 10798365 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "1"; gene_name "Mib1"; +18 protein_coding exon 10800054 10800246 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "2"; gene_name "Mib1"; +18 protein_coding CDS 10800054 10800246 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "2"; gene_name "Mib1"; +18 protein_coding exon 10802259 10802337 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "3"; gene_name "Mib1"; +18 protein_coding CDS 10802259 10802337 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "3"; gene_name "Mib1"; +18 protein_coding exon 10804685 10804798 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "4"; gene_name "Mib1"; +18 protein_coding CDS 10804685 10804798 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "4"; gene_name "Mib1"; +18 protein_coding exon 10808032 10808132 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "5"; gene_name "Mib1"; +18 protein_coding CDS 10808032 10808132 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "5"; gene_name "Mib1"; +18 protein_coding exon 10811983 10812154 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "6"; gene_name "Mib1"; +18 protein_coding CDS 10811983 10812123 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "6"; gene_name "Mib1"; +18 protein_coding exon 10815734 10817626 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "7"; gene_name "Mib1"; +18 protein_coding stop_codon 10812121 10812123 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000150000"; exon_number "7"; gene_name "Mib1"; +18 protein_coding exon 10725742 10726531 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000131073"; exon_number "1"; gene_name "Mib1"; +18 protein_coding exon 10740981 10741152 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000131073"; exon_number "2"; gene_name "Mib1"; +18 protein_coding exon 10743267 10743396 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000131073"; exon_number "3"; gene_name "Mib1"; +18 protein_coding exon 10747354 10747458 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000131073"; exon_number "4"; gene_name "Mib1"; +18 protein_coding exon 10749321 10749387 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000131073"; exon_number "5"; gene_name "Mib1"; +18 protein_coding exon 10751821 10752025 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000131073"; exon_number "6"; gene_name "Mib1"; +18 protein_coding exon 10755502 10755697 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000131073"; exon_number "7"; gene_name "Mib1"; +18 protein_coding exon 10725546 10726531 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "1"; gene_name "Mib1"; +18 protein_coding CDS 10726303 10726531 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "1"; gene_name "Mib1"; +18 protein_coding start_codon 10726303 10726305 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "1"; gene_name "Mib1"; +18 protein_coding exon 10740981 10741152 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "2"; gene_name "Mib1"; +18 protein_coding CDS 10740981 10741152 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "2"; gene_name "Mib1"; +18 protein_coding exon 10743267 10743396 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "3"; gene_name "Mib1"; +18 protein_coding CDS 10743267 10743396 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "3"; gene_name "Mib1"; +18 protein_coding exon 10747354 10747458 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "4"; gene_name "Mib1"; +18 protein_coding CDS 10747354 10747458 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "4"; gene_name "Mib1"; +18 protein_coding exon 10749321 10749387 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "5"; gene_name "Mib1"; +18 protein_coding CDS 10749321 10749387 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "5"; gene_name "Mib1"; +18 protein_coding exon 10751821 10752025 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "6"; gene_name "Mib1"; +18 protein_coding CDS 10751821 10752025 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "6"; gene_name "Mib1"; +18 protein_coding exon 10755502 10755685 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "7"; gene_name "Mib1"; +18 protein_coding CDS 10755502 10755685 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "7"; gene_name "Mib1"; +18 protein_coding exon 10760802 10760946 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "8"; gene_name "Mib1"; +18 protein_coding CDS 10760802 10760946 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "8"; gene_name "Mib1"; +18 protein_coding exon 10763187 10763320 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "9"; gene_name "Mib1"; +18 protein_coding CDS 10763187 10763320 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "9"; gene_name "Mib1"; +18 protein_coding exon 10768122 10768229 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "10"; gene_name "Mib1"; +18 protein_coding CDS 10768122 10768229 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "10"; gene_name "Mib1"; +18 protein_coding exon 10775527 10775724 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "11"; gene_name "Mib1"; +18 protein_coding CDS 10775527 10775724 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "11"; gene_name "Mib1"; +18 protein_coding exon 10778147 10778298 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "12"; gene_name "Mib1"; +18 protein_coding CDS 10778147 10778298 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "12"; gene_name "Mib1"; +18 protein_coding exon 10792893 10793025 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "13"; gene_name "Mib1"; +18 protein_coding CDS 10792893 10793025 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "13"; gene_name "Mib1"; +18 protein_coding exon 10794476 10794562 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "14"; gene_name "Mib1"; +18 protein_coding CDS 10794476 10794562 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "14"; gene_name "Mib1"; +18 protein_coding exon 10795688 10795849 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "15"; gene_name "Mib1"; +18 protein_coding CDS 10795688 10795849 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "15"; gene_name "Mib1"; +18 protein_coding exon 10798350 10798531 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "16"; gene_name "Mib1"; +18 protein_coding CDS 10798350 10798531 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "16"; gene_name "Mib1"; +18 protein_coding exon 10800054 10800246 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "17"; gene_name "Mib1"; +18 protein_coding CDS 10800054 10800246 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "17"; gene_name "Mib1"; +18 protein_coding exon 10802259 10802337 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "18"; gene_name "Mib1"; +18 protein_coding CDS 10802259 10802337 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "18"; gene_name "Mib1"; +18 protein_coding exon 10804685 10804798 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "19"; gene_name "Mib1"; +18 protein_coding CDS 10804685 10804798 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "19"; gene_name "Mib1"; +18 protein_coding exon 10808032 10808132 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "20"; gene_name "Mib1"; +18 protein_coding CDS 10808032 10808132 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "20"; gene_name "Mib1"; +18 protein_coding exon 10811983 10818576 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "21"; gene_name "Mib1"; +18 protein_coding CDS 10811983 10812123 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "21"; gene_name "Mib1"; +18 protein_coding stop_codon 10812121 10812123 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000052838"; exon_number "21"; gene_name "Mib1"; +18 protein_coding exon 10725653 10725723 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "1"; gene_name "Mib1"; +18 protein_coding CDS 10726303 10726531 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "1"; gene_name "Mib1"; +18 protein_coding start_codon 10726303 10726305 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "1"; gene_name "Mib1"; +18 protein_coding exon 10726228 10726531 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "2"; gene_name "Mib1"; +18 protein_coding CDS 10740981 10741152 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "2"; gene_name "Mib1"; +18 protein_coding exon 10740981 10741152 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "3"; gene_name "Mib1"; +18 protein_coding CDS 10743267 10743396 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "3"; gene_name "Mib1"; +18 protein_coding exon 10743267 10743396 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "4"; gene_name "Mib1"; +18 protein_coding CDS 10747354 10747458 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "4"; gene_name "Mib1"; +18 protein_coding exon 10747354 10747458 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "5"; gene_name "Mib1"; +18 protein_coding CDS 10749321 10749387 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "5"; gene_name "Mib1"; +18 protein_coding exon 10749321 10749387 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "6"; gene_name "Mib1"; +18 protein_coding CDS 10751821 10752025 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "6"; gene_name "Mib1"; +18 protein_coding exon 10751821 10752025 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "7"; gene_name "Mib1"; +18 protein_coding CDS 10755502 10755685 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "7"; gene_name "Mib1"; +18 protein_coding exon 10755502 10755685 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "8"; gene_name "Mib1"; +18 protein_coding CDS 10760802 10760946 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "8"; gene_name "Mib1"; +18 protein_coding exon 10760802 10760946 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "9"; gene_name "Mib1"; +18 protein_coding CDS 10763187 10763320 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "9"; gene_name "Mib1"; +18 protein_coding exon 10763187 10763320 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "10"; gene_name "Mib1"; +18 protein_coding CDS 10768122 10768229 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "10"; gene_name "Mib1"; +18 protein_coding exon 10768122 10768229 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "11"; gene_name "Mib1"; +18 protein_coding CDS 10775527 10775724 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "11"; gene_name "Mib1"; +18 protein_coding exon 10775527 10775724 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "12"; gene_name "Mib1"; +18 protein_coding CDS 10778147 10778298 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "12"; gene_name "Mib1"; +18 protein_coding exon 10778147 10778298 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "13"; gene_name "Mib1"; +18 protein_coding CDS 10792893 10793025 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "13"; gene_name "Mib1"; +18 protein_coding exon 10792893 10793025 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "14"; gene_name "Mib1"; +18 protein_coding CDS 10794476 10794562 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "14"; gene_name "Mib1"; +18 protein_coding exon 10794476 10794562 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "15"; gene_name "Mib1"; +18 protein_coding CDS 10795688 10795849 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "15"; gene_name "Mib1"; +18 protein_coding exon 10795688 10795849 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "16"; gene_name "Mib1"; +18 protein_coding CDS 10798350 10798531 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "16"; gene_name "Mib1"; +18 protein_coding exon 10798350 10798531 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "17"; gene_name "Mib1"; +18 protein_coding CDS 10800054 10800246 . + 1 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "17"; gene_name "Mib1"; +18 protein_coding exon 10800054 10800246 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "18"; gene_name "Mib1"; +18 protein_coding CDS 10802259 10802337 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "18"; gene_name "Mib1"; +18 protein_coding exon 10802259 10802337 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "19"; gene_name "Mib1"; +18 protein_coding CDS 10804685 10804798 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "19"; gene_name "Mib1"; +18 protein_coding exon 10804685 10804798 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "20"; gene_name "Mib1"; +18 protein_coding CDS 10808032 10808132 . + 2 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "20"; gene_name "Mib1"; +18 protein_coding exon 10808032 10808132 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "21"; gene_name "Mib1"; +18 protein_coding CDS 10811983 10812123 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "21"; gene_name "Mib1"; +18 protein_coding exon 10811983 10812172 . + . gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "22"; gene_name "Mib1"; +18 protein_coding stop_codon 10812121 10812123 . + 0 gene_id "ENSMUSG00000024294"; transcript_id "ENSMUST00000165555"; exon_number "22"; gene_name "Mib1"; +18 protein_coding exon 3266046 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327533 3327535 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3327492 3327589 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327535 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "7"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151311"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3266354 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327533 3327535 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3327492 3327589 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327535 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3337378 3337486 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "8"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154135"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3267512 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3325470 3325472 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3325359 3325472 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325472 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "6"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130599"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3267556 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3325474 3325476 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "7"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000127601"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3266352 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327533 3327535 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "8"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3327492 3327589 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "9"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327535 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "9"; gene_name "Crem"; +18 protein_coding exon 3337378 3337677 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "10"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000150235"; exon_number "10"; gene_name "Crem"; +18 protein_coding exon 3267259 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327533 3327535 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3327492 3327589 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327535 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3337378 3337746 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "8"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154470"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3266354 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327533 3327535 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3327492 3327589 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "8"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327535 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3337378 3337587 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "9"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000082141"; exon_number "9"; gene_name "Crem"; +18 protein_coding exon 3267421 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327503 3327505 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3327492 3327505 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "8"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327505 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "8"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000131899"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3287630 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130047"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130047"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130047"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130047"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3299448 3299554 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130047"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3266354 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327533 3327535 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3327492 3327589 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "8"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327535 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3337378 3337587 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "9"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000025069"; exon_number "9"; gene_name "Crem"; +18 protein_coding exon 3267532 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000124747"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000124747"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3276696 3276698 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000124747"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000124747"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000124747"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000124747"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276698 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000124747"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3280947 3281130 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000124747"; exon_number "4"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000124747"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3267586 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3309719 3309721 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3309644 3309721 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3309644 3309721 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "6"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000136961"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3267837 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000148305"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3273508 3273576 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000148305"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3325470 3325472 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000148305"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000148305"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000148305"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000148305"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325472 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000148305"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3325359 3325472 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000148305"; exon_number "4"; gene_name "Crem"; +18 protein_coding stop_codon 3273508 3273510 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000148305"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3267983 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3325470 3325472 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273601 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273601 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3273607 3273623 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3273607 3273623 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3325359 3325472 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325472 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "7"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000115873"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3267262 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3299448 3299450 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3299448 3299554 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3299448 3299450 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "6"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000129435"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3283896 3284071 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149266"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149266"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149266"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149266"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149266"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3299448 3299539 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149266"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3267583 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3309977 3309985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327533 3327535 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327535 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3309644 3309753 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3309853 3309985 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3327492 3327589 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3337378 3337531 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "9"; gene_name "Crem"; +18 protein_coding stop_codon 3309977 3309979 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000134027"; exon_number "9"; gene_name "Crem"; +18 protein_coding exon 3267843 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154705"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154705"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3281708 3281710 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154705"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154705"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154705"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154705"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154705"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3281686 3281736 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154705"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3281686 3281710 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154705"; exon_number "4"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154705"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3267586 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3309719 3309721 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3309644 3309721 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3309644 3309721 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "6"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152108"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3267573 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3325470 3325472 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3325359 3325472 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "8"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325472 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "8"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156234"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3266961 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000140912"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000140912"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3337378 3337511 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000140912"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3267388 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151084"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151084"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3281708 3281710 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151084"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151084"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151084"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3281686 3281745 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151084"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3281686 3281710 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151084"; exon_number "3"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000151084"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3267631 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000139537"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000139537"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3273560 3273562 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000139537"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000139537"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273562 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000139537"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3280947 3281099 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000139537"; exon_number "3"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000139537"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3267583 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327503 3327505 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3327492 3327505 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327505 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "6"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000137568"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3294480 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000142690"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3295015 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000142690"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3325470 3325472 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000142690"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000142690"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000142690"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000142690"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000142690"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000142690"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325472 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000142690"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3337378 3337572 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000142690"; exon_number "5"; gene_name "Crem"; +18 protein_coding stop_codon 3295015 3295017 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000142690"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3266354 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3325470 3325472 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325472 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3327492 3327589 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3337378 3337587 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "8"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000073545"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3267570 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000147138"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000147138"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3281708 3281710 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000147138"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000147138"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000147138"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000147138"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000147138"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3281686 3281767 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000147138"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3281686 3281710 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000147138"; exon_number "4"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000147138"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3267583 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327503 3327505 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3327492 3327505 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327505 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "7"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000146265"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3267983 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3299448 3299450 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3299448 3299450 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "8"; gene_name "Crem"; +18 protein_coding CDS 3299448 3299450 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "8"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000126578"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3267583 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327503 3327505 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3327492 3327505 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "8"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327505 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "8"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000152900"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3318698 3318987 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000132334"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000132334"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3327492 3327589 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000132334"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3336959 3337061 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000132334"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3294182 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149803"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3295015 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149803"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3325470 3325472 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149803"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149803"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149803"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149803"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325472 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149803"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3337378 3337587 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149803"; exon_number "4"; gene_name "Crem"; +18 protein_coding stop_codon 3295015 3295017 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000149803"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3266354 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3299448 3299450 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3299448 3299557 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "8"; gene_name "Crem"; +18 protein_coding CDS 3299448 3299450 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "8"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000122958"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3266955 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000140332"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000140332"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3281708 3281710 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000140332"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000140332"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000140332"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3281686 3281767 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000140332"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3281686 3281710 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000140332"; exon_number "3"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000140332"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3267586 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000123672"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000123672"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3325470 3325472 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000123672"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000123672"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000123672"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000123672"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000123672"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000123672"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000123672"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3325359 3325472 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000123672"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325472 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000123672"; exon_number "5"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000123672"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3288053 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156929"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156929"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3299448 3299552 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000156929"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3267583 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327503 3327505 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3327492 3327505 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "8"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327505 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "8"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000130455"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3267983 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3309719 3309721 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3309644 3309898 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "8"; gene_name "Crem"; +18 protein_coding CDS 3309644 3309721 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "8"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000154715"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3267544 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000049942"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000049942"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3276747 3276749 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000049942"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000049942"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000049942"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276773 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000049942"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276749 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000049942"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3280947 3281076 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000049942"; exon_number "4"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000049942"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3267586 3267730 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267586 3267730 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3309719 3309721 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3287902 3288090 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3287902 3288090 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3309644 3309856 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3309644 3309721 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "7"; gene_name "Crem"; +18 protein_coding stop_codon 3267586 3267588 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000144496"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3266354 3268127 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "1"; gene_name "Crem"; +18 protein_coding CDS 3267983 3268127 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "1"; gene_name "Crem"; +18 protein_coding start_codon 3327533 3327535 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "1"; gene_name "Crem"; +18 protein_coding exon 3273420 3273576 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "2"; gene_name "Crem"; +18 protein_coding CDS 3273420 3273576 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "2"; gene_name "Crem"; +18 protein_coding exon 3276692 3276727 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "3"; gene_name "Crem"; +18 protein_coding CDS 3276692 3276727 . - 2 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "3"; gene_name "Crem"; +18 protein_coding exon 3295038 3295180 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "4"; gene_name "Crem"; +18 protein_coding CDS 3295038 3295180 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "4"; gene_name "Crem"; +18 protein_coding exon 3295320 3295414 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "5"; gene_name "Crem"; +18 protein_coding CDS 3295320 3295414 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "5"; gene_name "Crem"; +18 protein_coding exon 3299160 3299306 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "6"; gene_name "Crem"; +18 protein_coding CDS 3299160 3299306 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "6"; gene_name "Crem"; +18 protein_coding exon 3325359 3325476 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "7"; gene_name "Crem"; +18 protein_coding CDS 3325359 3325476 . - 1 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "7"; gene_name "Crem"; +18 protein_coding exon 3327492 3327589 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "8"; gene_name "Crem"; +18 protein_coding CDS 3327492 3327535 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "8"; gene_name "Crem"; +18 protein_coding exon 3337378 3337587 . - . gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "9"; gene_name "Crem"; +18 protein_coding stop_codon 3267983 3267985 . - 0 gene_id "ENSMUSG00000063889"; transcript_id "ENSMUST00000165086"; exon_number "9"; gene_name "Crem"; +18 snoRNA exon 10551287 10551404 . - . gene_id "ENSMUSG00000084693"; transcript_id "ENSMUST00000122744"; exon_number "1"; gene_name "SNORA33.5"; +18 miRNA exon 11998870 11998947 . - . gene_id "ENSMUSG00000084565"; transcript_id "ENSMUST00000122616"; exon_number "1"; gene_name "Mir1901"; +18 protein_coding exon 10064399 10066049 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "1"; gene_name "Rock1"; +18 protein_coding CDS 10066046 10066049 . - 1 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "1"; gene_name "Rock1"; +18 protein_coding start_codon 10181313 10181315 . - 1 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "1"; gene_name "Rock1"; +18 protein_coding exon 10067469 10067676 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "2"; gene_name "Rock1"; +18 protein_coding CDS 10067469 10067676 . - 2 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "2"; gene_name "Rock1"; +18 protein_coding exon 10070217 10070478 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "3"; gene_name "Rock1"; +18 protein_coding CDS 10070217 10070478 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "3"; gene_name "Rock1"; +18 protein_coding exon 10070620 10070698 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "4"; gene_name "Rock1"; +18 protein_coding CDS 10070620 10070698 . - 1 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "4"; gene_name "Rock1"; +18 protein_coding exon 10072830 10072918 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "5"; gene_name "Rock1"; +18 protein_coding CDS 10072830 10072918 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "5"; gene_name "Rock1"; +18 protein_coding exon 10073113 10073183 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "6"; gene_name "Rock1"; +18 protein_coding CDS 10073113 10073183 . - 2 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "6"; gene_name "Rock1"; +18 protein_coding exon 10079113 10079272 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "7"; gene_name "Rock1"; +18 protein_coding CDS 10079113 10079272 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "7"; gene_name "Rock1"; +18 protein_coding exon 10080349 10080537 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "8"; gene_name "Rock1"; +18 protein_coding CDS 10080349 10080537 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "8"; gene_name "Rock1"; +18 protein_coding exon 10083120 10083208 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "9"; gene_name "Rock1"; +18 protein_coding CDS 10083120 10083208 . - 2 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "9"; gene_name "Rock1"; +18 protein_coding exon 10084316 10084409 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "10"; gene_name "Rock1"; +18 protein_coding CDS 10084316 10084409 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "10"; gene_name "Rock1"; +18 protein_coding exon 10090811 10090976 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "11"; gene_name "Rock1"; +18 protein_coding CDS 10090811 10090976 . - 1 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "11"; gene_name "Rock1"; +18 protein_coding exon 10092127 10092221 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "12"; gene_name "Rock1"; +18 protein_coding CDS 10092127 10092221 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "12"; gene_name "Rock1"; +18 protein_coding exon 10093906 10093975 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "13"; gene_name "Rock1"; +18 protein_coding CDS 10093906 10093975 . - 1 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "13"; gene_name "Rock1"; +18 protein_coding exon 10095411 10095595 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "14"; gene_name "Rock1"; +18 protein_coding CDS 10095411 10095595 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "14"; gene_name "Rock1"; +18 protein_coding exon 10097481 10097641 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "15"; gene_name "Rock1"; +18 protein_coding CDS 10097481 10097641 . - 2 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "15"; gene_name "Rock1"; +18 protein_coding exon 10099255 10099405 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "16"; gene_name "Rock1"; +18 protein_coding CDS 10099255 10099405 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "16"; gene_name "Rock1"; +18 protein_coding exon 10100920 10101026 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "17"; gene_name "Rock1"; +18 protein_coding CDS 10100920 10101026 . - 2 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "17"; gene_name "Rock1"; +18 protein_coding exon 10104072 10104318 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "18"; gene_name "Rock1"; +18 protein_coding CDS 10104072 10104318 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "18"; gene_name "Rock1"; +18 protein_coding exon 10104416 10104507 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "19"; gene_name "Rock1"; +18 protein_coding CDS 10104416 10104507 . - 2 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "19"; gene_name "Rock1"; +18 protein_coding exon 10106320 10106455 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "20"; gene_name "Rock1"; +18 protein_coding CDS 10106320 10106455 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "20"; gene_name "Rock1"; +18 protein_coding exon 10112342 10112390 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "21"; gene_name "Rock1"; +18 protein_coding CDS 10112342 10112390 . - 1 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "21"; gene_name "Rock1"; +18 protein_coding exon 10116772 10116860 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "22"; gene_name "Rock1"; +18 protein_coding CDS 10116772 10116860 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "22"; gene_name "Rock1"; +18 protein_coding exon 10119883 10119943 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "23"; gene_name "Rock1"; +18 protein_coding CDS 10119883 10119943 . - 1 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "23"; gene_name "Rock1"; +18 protein_coding exon 10122607 10122766 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "24"; gene_name "Rock1"; +18 protein_coding CDS 10122607 10122766 . - 2 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "24"; gene_name "Rock1"; +18 protein_coding exon 10129303 10129394 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "25"; gene_name "Rock1"; +18 protein_coding CDS 10129303 10129394 . - 1 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "25"; gene_name "Rock1"; +18 protein_coding exon 10131528 10131666 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "26"; gene_name "Rock1"; +18 protein_coding CDS 10131528 10131666 . - 2 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "26"; gene_name "Rock1"; +18 protein_coding exon 10132126 10132270 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "27"; gene_name "Rock1"; +18 protein_coding CDS 10132126 10132270 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "27"; gene_name "Rock1"; +18 protein_coding exon 10134414 10134498 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "28"; gene_name "Rock1"; +18 protein_coding CDS 10134414 10134498 . - 1 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "28"; gene_name "Rock1"; +18 protein_coding exon 10136094 10136269 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "29"; gene_name "Rock1"; +18 protein_coding CDS 10136094 10136269 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "29"; gene_name "Rock1"; +18 protein_coding exon 10140174 10140311 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "30"; gene_name "Rock1"; +18 protein_coding CDS 10140174 10140311 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "30"; gene_name "Rock1"; +18 protein_coding exon 10140786 10140886 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "31"; gene_name "Rock1"; +18 protein_coding CDS 10140786 10140886 . - 2 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "31"; gene_name "Rock1"; +18 protein_coding exon 10150233 10150314 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "32"; gene_name "Rock1"; +18 protein_coding CDS 10150233 10150314 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "32"; gene_name "Rock1"; +18 protein_coding exon 10181223 10181790 . - . gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "33"; gene_name "Rock1"; +18 protein_coding CDS 10181223 10181315 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "33"; gene_name "Rock1"; +18 protein_coding stop_codon 10066046 10066048 . - 0 gene_id "ENSMUSG00000024290"; transcript_id "ENSMUST00000067947"; exon_number "33"; gene_name "Rock1";
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/gencode_ens_hav.gtf Thu Apr 23 17:57:49 2015 -0400 @@ -0,0 +1,50 @@ +1 HAVANA gene 69091 70008 . + . gene_id "ENSG00000186092.4"; transcript_id "ENSG00000186092.4"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F5"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F5"; level 2; havana_gene "OTTHUMG00000001094.1"; +1 HAVANA transcript 69091 70008 . + . gene_id "ENSG00000186092.4"; transcript_id "ENST00000335137.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F5"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F5-001"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS30547.1"; havana_gene "OTTHUMG00000001094.1"; havana_transcript "OTTHUMT00000003223.1"; +1 HAVANA exon 69091 70008 . + . gene_id "ENSG00000186092.4"; transcript_id "ENST00000335137.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F5"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F5-001"; exon_number 1; exon_id "ENSE00002319515.1"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS30547.1"; havana_gene "OTTHUMG00000001094.1"; havana_transcript "OTTHUMT00000003223.1"; +1 HAVANA CDS 69091 70005 . + 0 gene_id "ENSG00000186092.4"; transcript_id "ENST00000335137.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F5"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F5-001"; exon_number 1; exon_id "ENSE00002319515.1"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS30547.1"; havana_gene "OTTHUMG00000001094.1"; havana_transcript "OTTHUMT00000003223.1"; +1 HAVANA start_codon 69091 69093 . + 0 gene_id "ENSG00000186092.4"; transcript_id "ENST00000335137.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F5"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F5-001"; exon_number 1; exon_id "ENSE00002319515.1"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS30547.1"; havana_gene "OTTHUMG00000001094.1"; havana_transcript "OTTHUMT00000003223.1"; +1 HAVANA stop_codon 70006 70008 . + 0 gene_id "ENSG00000186092.4"; transcript_id "ENST00000335137.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F5"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F5-001"; exon_number 1; exon_id "ENSE00002319515.1"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS30547.1"; havana_gene "OTTHUMG00000001094.1"; havana_transcript "OTTHUMT00000003223.1"; +1 HAVANA UTR 70006 70008 . + . gene_id "ENSG00000186092.4"; transcript_id "ENST00000335137.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F5"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F5-001"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS30547.1"; havana_gene "OTTHUMG00000001094.1"; havana_transcript "OTTHUMT00000003223.1"; +1 ENSEMBL gene 134901 139379 . - . gene_id "ENSG00000237683.5"; transcript_id "ENSG00000237683.5"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "AL627309.1"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "AL627309.1"; level 3; +1 ENSEMBL transcript 134901 139379 . - . gene_id "ENSG00000237683.5"; transcript_id "ENST00000423372.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "AL627309.1"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "AL627309.1-201"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL exon 137621 139379 . - . gene_id "ENSG00000237683.5"; transcript_id "ENST00000423372.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "AL627309.1"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "AL627309.1-201"; exon_number 1; exon_id "ENSE00002221580.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL CDS 138533 139309 . - 0 gene_id "ENSG00000237683.5"; transcript_id "ENST00000423372.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "AL627309.1"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "AL627309.1-201"; exon_number 1; exon_id "ENSE00002221580.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL stop_codon 138530 138532 . - 0 gene_id "ENSG00000237683.5"; transcript_id "ENST00000423372.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "AL627309.1"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "AL627309.1-201"; exon_number 1; exon_id "ENSE00002221580.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL exon 134901 135802 . - . gene_id "ENSG00000237683.5"; transcript_id "ENST00000423372.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "AL627309.1"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "AL627309.1-201"; exon_number 2; exon_id "ENSE00002314092.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL UTR 137621 138532 . - . gene_id "ENSG00000237683.5"; transcript_id "ENST00000423372.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "AL627309.1"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "AL627309.1-201"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL UTR 139310 139379 . - . gene_id "ENSG00000237683.5"; transcript_id "ENST00000423372.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "AL627309.1"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "AL627309.1-201"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL UTR 134901 135802 . - . gene_id "ENSG00000237683.5"; transcript_id "ENST00000423372.3"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "AL627309.1"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "AL627309.1-201"; level 3; tag "basic"; tag "appris_principal"; +1 HAVANA gene 367640 368634 . + . gene_id "ENSG00000235249.1"; transcript_id "ENSG00000235249.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F29"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F29"; level 2; havana_gene "OTTHUMG00000002860.1"; +1 HAVANA transcript 367640 368634 . + . gene_id "ENSG00000235249.1"; transcript_id "ENST00000426406.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F29"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F29-001"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41220.1"; havana_gene "OTTHUMG00000002860.1"; havana_transcript "OTTHUMT00000007999.1"; +1 HAVANA exon 367640 368634 . + . gene_id "ENSG00000235249.1"; transcript_id "ENST00000426406.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F29"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F29-001"; exon_number 1; exon_id "ENSE00002316283.1"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41220.1"; havana_gene "OTTHUMG00000002860.1"; havana_transcript "OTTHUMT00000007999.1"; +1 HAVANA CDS 367659 368594 . + 0 gene_id "ENSG00000235249.1"; transcript_id "ENST00000426406.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F29"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F29-001"; exon_number 1; exon_id "ENSE00002316283.1"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41220.1"; havana_gene "OTTHUMG00000002860.1"; havana_transcript "OTTHUMT00000007999.1"; +1 HAVANA start_codon 367659 367661 . + 0 gene_id "ENSG00000235249.1"; transcript_id "ENST00000426406.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F29"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F29-001"; exon_number 1; exon_id "ENSE00002316283.1"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41220.1"; havana_gene "OTTHUMG00000002860.1"; havana_transcript "OTTHUMT00000007999.1"; +1 HAVANA stop_codon 368595 368597 . + 0 gene_id "ENSG00000235249.1"; transcript_id "ENST00000426406.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F29"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F29-001"; exon_number 1; exon_id "ENSE00002316283.1"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41220.1"; havana_gene "OTTHUMG00000002860.1"; havana_transcript "OTTHUMT00000007999.1"; +1 HAVANA UTR 367640 367658 . + . gene_id "ENSG00000235249.1"; transcript_id "ENST00000426406.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F29"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F29-001"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41220.1"; havana_gene "OTTHUMG00000002860.1"; havana_transcript "OTTHUMT00000007999.1"; +1 HAVANA UTR 368595 368634 . + . gene_id "ENSG00000235249.1"; transcript_id "ENST00000426406.1"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F29"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F29-001"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41220.1"; havana_gene "OTTHUMG00000002860.1"; havana_transcript "OTTHUMT00000007999.1"; +1 HAVANA gene 621059 622053 . - . gene_id "ENSG00000185097.2"; transcript_id "ENSG00000185097.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F16"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F16"; level 2; havana_gene "OTTHUMG00000002581.1"; +1 HAVANA transcript 621059 622053 . - . gene_id "ENSG00000185097.2"; transcript_id "ENST00000332831.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F16"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F16-001"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41221.1"; havana_gene "OTTHUMG00000002581.1"; havana_transcript "OTTHUMT00000007334.1"; +1 HAVANA exon 621059 622053 . - . gene_id "ENSG00000185097.2"; transcript_id "ENST00000332831.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F16"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F16-001"; exon_number 1; exon_id "ENSE00002324228.1"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41221.1"; havana_gene "OTTHUMG00000002581.1"; havana_transcript "OTTHUMT00000007334.1"; +1 HAVANA CDS 621099 622034 . - 0 gene_id "ENSG00000185097.2"; transcript_id "ENST00000332831.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F16"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F16-001"; exon_number 1; exon_id "ENSE00002324228.1"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41221.1"; havana_gene "OTTHUMG00000002581.1"; havana_transcript "OTTHUMT00000007334.1"; +1 HAVANA start_codon 622032 622034 . - 0 gene_id "ENSG00000185097.2"; transcript_id "ENST00000332831.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F16"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F16-001"; exon_number 1; exon_id "ENSE00002324228.1"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41221.1"; havana_gene "OTTHUMG00000002581.1"; havana_transcript "OTTHUMT00000007334.1"; +1 HAVANA stop_codon 621096 621098 . - 0 gene_id "ENSG00000185097.2"; transcript_id "ENST00000332831.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F16"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F16-001"; exon_number 1; exon_id "ENSE00002324228.1"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41221.1"; havana_gene "OTTHUMG00000002581.1"; havana_transcript "OTTHUMT00000007334.1"; +1 HAVANA UTR 621059 621098 . - . gene_id "ENSG00000185097.2"; transcript_id "ENST00000332831.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F16"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F16-001"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41221.1"; havana_gene "OTTHUMG00000002581.1"; havana_transcript "OTTHUMT00000007334.1"; +1 HAVANA UTR 622035 622053 . - . gene_id "ENSG00000185097.2"; transcript_id "ENST00000332831.2"; gene_type "protein_coding"; gene_status "KNOWN"; gene_name "OR4F16"; transcript_type "protein_coding"; transcript_status "KNOWN"; transcript_name "OR4F16-001"; level 2; tag "basic"; tag "appris_principal"; tag "CCDS"; ccdsid "CCDS41221.1"; havana_gene "OTTHUMG00000002581.1"; havana_transcript "OTTHUMT00000007334.1"; +1 ENSEMBL gene 738532 739137 . - . gene_id "ENSG00000269831.1"; transcript_id "ENSG00000269831.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL669831.1"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL669831.1"; level 3; +1 ENSEMBL transcript 738532 739137 . - . gene_id "ENSG00000269831.1"; transcript_id "ENST00000599533.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL669831.1"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL669831.1-201"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL exon 739121 739137 . - . gene_id "ENSG00000269831.1"; transcript_id "ENST00000599533.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL669831.1"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL669831.1-201"; exon_number 1; exon_id "ENSE00003063549.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL CDS 739121 739137 . - 0 gene_id "ENSG00000269831.1"; transcript_id "ENST00000599533.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL669831.1"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL669831.1-201"; exon_number 1; exon_id "ENSE00003063549.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL exon 738788 738812 . - . gene_id "ENSG00000269831.1"; transcript_id "ENST00000599533.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL669831.1"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL669831.1-201"; exon_number 2; exon_id "ENSE00003084653.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL CDS 738788 738812 . - 1 gene_id "ENSG00000269831.1"; transcript_id "ENST00000599533.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL669831.1"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL669831.1-201"; exon_number 2; exon_id "ENSE00003084653.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL exon 738532 738618 . - . gene_id "ENSG00000269831.1"; transcript_id "ENST00000599533.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL669831.1"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL669831.1-201"; exon_number 3; exon_id "ENSE00003138540.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL CDS 738532 738618 . - 0 gene_id "ENSG00000269831.1"; transcript_id "ENST00000599533.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL669831.1"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL669831.1-201"; exon_number 3; exon_id "ENSE00003138540.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL gene 818043 819983 . + . gene_id "ENSG00000269308.1"; transcript_id "ENSG00000269308.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL645608.2"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL645608.2"; level 3; +1 ENSEMBL transcript 818043 819983 . + . gene_id "ENSG00000269308.1"; transcript_id "ENST00000594233.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL645608.2"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL645608.2-201"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL exon 818043 818058 . + . gene_id "ENSG00000269308.1"; transcript_id "ENST00000594233.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL645608.2"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL645608.2-201"; exon_number 1; exon_id "ENSE00003079649.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL CDS 818043 818058 . + 0 gene_id "ENSG00000269308.1"; transcript_id "ENST00000594233.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL645608.2"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL645608.2-201"; exon_number 1; exon_id "ENSE00003079649.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL exon 819496 819513 . + . gene_id "ENSG00000269308.1"; transcript_id "ENST00000594233.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL645608.2"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL645608.2-201"; exon_number 2; exon_id "ENSE00003048391.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL CDS 819496 819513 . + 2 gene_id "ENSG00000269308.1"; transcript_id "ENST00000594233.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL645608.2"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL645608.2-201"; exon_number 2; exon_id "ENSE00003048391.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL exon 819961 819983 . + . gene_id "ENSG00000269308.1"; transcript_id "ENST00000594233.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL645608.2"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL645608.2-201"; exon_number 3; exon_id "ENSE00003055565.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL CDS 819961 819980 . + 2 gene_id "ENSG00000269308.1"; transcript_id "ENST00000594233.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL645608.2"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL645608.2-201"; exon_number 3; exon_id "ENSE00003055565.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL stop_codon 819981 819983 . + 0 gene_id "ENSG00000269308.1"; transcript_id "ENST00000594233.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL645608.2"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL645608.2-201"; exon_number 3; exon_id "ENSE00003055565.1"; level 3; tag "basic"; tag "appris_principal"; +1 ENSEMBL UTR 819981 819983 . + . gene_id "ENSG00000269308.1"; transcript_id "ENST00000594233.1"; gene_type "protein_coding"; gene_status "NOVEL"; gene_name "AL645608.2"; transcript_type "protein_coding"; transcript_status "NOVEL"; transcript_name "AL645608.2-201"; level 3; tag "basic"; tag "appris_principal";
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/s_cerevisiae_SCU49845.gff Thu Apr 23 17:57:49 2015 -0400 @@ -0,0 +1,8 @@ +IX gbk2gff gene 687 3158 . + . ID=AXL2;Name=AXL2 +IX gbk2gff mRNA 687 3158 . + . ID=Transcript:AXL2;Parent=AXL2 +IX gbk2gff CDS 687 3158 . + . Parent=Transcript:AXL2 +IX gbk2gff exon 687 3158 . + . Parent=Transcript:AXL2 +IX gbk2gff gene 3300 4037 . - . ID=REV7;Name=REV7 +IX gbk2gff mRNA 3300 4037 . - . ID=Transcript:REV7;Parent=REV7 +IX gbk2gff CDS 3300 4037 . - . Parent=Transcript:REV7 +IX gbk2gff exon 3300 4037 . - . Parent=Transcript:REV7
--- a/test-data/s_cerevisiae_SCU49845.gff3 Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,8 +0,0 @@ -IX gbk_to_gff gene 687 3158 . + . ID=AXL2;Name=AXL2 -IX gbk_to_gff . 687 3158 . + . ID=Transcript:AXL2;Parent=AXL2 -IX gbk_to_gff CDS 687 3158 . + . Parent=Transcript:AXL2 -IX gbk_to_gff exon 687 3158 . + . Parent=Transcript:AXL2 -IX gbk_to_gff gene 3300 4037 . - . ID=REV7;Name=REV7 -IX gbk_to_gff . 3300 4037 . - . ID=Transcript:REV7;Parent=REV7 -IX gbk_to_gff CDS 3300 4037 . - . Parent=Transcript:REV7 -IX gbk_to_gff exon 3300 4037 . - . Parent=Transcript:REV7
--- a/test-data/single_parent_feature_record.gff3 Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,10 +0,0 @@ -chr1 . miRNA_primary_transcript 1380242 1380467 . - . ID=MI0031047;Alias=MI0031047;Name=gma-MIR9754 -chr1 . miRNA 1380249 1380270 . - . ID=MIMAT0036385;Alias=MIMAT0036385;Name=gma-miR9754;Derives_from=MI0031047 -chr1 . miRNA_primary_transcript 2410094 2410318 . + . ID=MI0016507;Alias=MI0016507;Name=gma-MIR4367 -chr1 . miRNA 2410242 2410263 . + . ID=MIMAT0018266;Alias=MIMAT0018266;Name=gma-miR4367;Derives_from=MI0016507 -chr1 . miRNA_primary_transcript 4792375 4792487 . - . ID=MI0021714;Alias=MI0021714;Name=gma-MIR395h -chr1 . miRNA 4792388 4792408 . - . ID=MIMAT0024920;Alias=MIMAT0024920;Name=gma-miR395h;Derives_from=MI0021714 -chr1 . miRNA_primary_transcript 4797903 4798018 . - . ID=MI0021715;Alias=MI0021715;Name=gma-MIR395i -chr1 . miRNA 4797916 4797936 . - . ID=MIMAT0024921;Alias=MIMAT0024921;Name=gma-miR395i;Derives_from=MI0021715 -chr1 . miRNA_primary_transcript 4810817 4810942 . - . ID=MI0021716;Alias=MI0021716;Name=gma-MIR395j -chr1 . miRNA 4810830 4810850 . - . ID=MIMAT0024922;Alias=MIMAT0024922;Name=gma-miR395j;Derives_from=MI0021716
--- a/tool_conf.xml.sample Thu Apr 23 17:51:14 2015 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,9 +0,0 @@ -<section name="GFFtools" id="gfftools.web"> - <tool file="GFFtools-GX/gff_to_bed.xml"/> - <tool file="GFFtools-GX/bed_to_gff.xml"/> - <tool file="GFFtools-GX/gbk_to_gff.xml"/> - <tool file="GFFtools-GX/gff_to_gbk.xml"/> - <tool file="GFFtools-GX/gff_to_gtf.xml"/> - <tool file="GFFtools-GX/gtf_to_gff.xml"/> - <tool file="GFFtools-GX/gff_fmap.xml"/> -</section>