Mercurial > repos > vmarcon > repet_tedenovo
diff TEdenovo.xml @ 0:baea09e6722b draft default tip
1st Uploaded
| author | vmarcon |
|---|---|
| date | Mon, 06 Feb 2017 13:31:53 -0500 |
| parents | |
| children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/TEdenovo.xml Mon Feb 06 13:31:53 2017 -0500 @@ -0,0 +1,322 @@ +<tool id="tedenovo" name="REPET Lite - TEdenovo" version="2.2.0"> + + <!-- [REQUIRED] Tool description displayed after the tool name --> + <description> Compute a library of transposable element</description> + + <!-- [OPTIONAL] 3rd party tools, binaries, modules... required for the tool to work --> + <requirements> + <requirement type="binary">python</requirement> + <requirement type="package" version="2.5">repet</requirement> + </requirements> + + <!-- [STRONGLY RECOMMANDED] Exit code rules --> + <stdio> + <!-- Anything other than zero is an error --> + <exit_code range="1:" level="fatal"/> + <exit_code range=":-1" level="fatal"/> + + </stdio> + + <!-- [OPTIONAL] Command to be executed to get the tool's version string --> + <version_command> + TEdenovo.py --version + </version_command> + + <!-- [REQUIRED] The command to execute --> + <command interpreter="bash"> + TEdenovo.sh $fasta $outputfasta $classif $outputlog $outputconfig $outputstats + #if str( $classif ) == "yes": + $outputclassif + #else + '' + #end if + </command> + + <!-- [REQUIRED] Input files and tool parameters --> + <inputs> + <param name="fasta" type="data" format="fasta" optional="false" label="Fasta alignment input" /> + <param name="classif" type="select" label="Get classification informations" help="To add the informations at annotation file on next step." > + <option value="no" selected="true">No</option> + <option value="yes">Yes</option> + </param> + <param name="label" type="text" label="Output name" /> + </inputs> + + <!-- [REQUIRED] Output files --> + <outputs> + <data name="outputlog" type="data" format="txt" label="TEdenovo-#if str($label)=='' then $fasta.name else $label #.log" /> + <data name="outputfasta" type="data" format="fasta" label="TEdenovo-#if str($label)=='' then $fasta.name else $label #.TElib.fa" /> + <data name="outputstats" type="data" format="txt" label="TEdenovo-#if str($label)=='' then $fasta.name else $label #.classif_stats.txt" /> + <data name="outputclassif" type="data" format="tabular" label="TEdenovo-#if str($label)=='' then $fasta.name else $label #.classif" > + <filter>(classif == 'yes')</filter> + </data> + <data name="outputconfig" type="data" format="txt" label="TEdenovo-#if str($label)=='' then $fasta.name else $label #.cfg" /> + </outputs> + + + <!-- [OPTIONAL] Tests to be run manually by the Galaxy admin --> + <tests> + <!-- [HELP] Test files have to be in the ~/test-data directory --> + <test> + <param name="fasta" value="DmelChr4Chr3.fa" /> + <output name="outputfasta"> + <assert_contents> + <has_line_matching expression="^>\w+" /> + <has_line_matching expression="[ACTG]{60}" /> + </assert_contents> + </output> + <output name="outputlog"> + <assert_contents> + <has_line_matching expression="^step 7 finished successfully" /> + <has_line_matching expression="^END time: \d{4}-\d{2}-\d{2} \d{2}:\d{2}:\d{2}" /> + <has_line_matching expression="^Writing fasta file" /> + </assert_contents> + </output> + <output name="outputconfig"> + <assert_contents> + <has_line_matching expression="^project_name: \d{8}" /> + <has_line_matching expression="^repet_version: 2.5" /> + <has_line_matching expression="^tmpDir:" /> + <has_line_matching expression="^clean: yes" /> + </assert_contents> + </output> + <output name="outputstats"> + <assert_contents> + <has_line_matching expression="-------Summary---------" /> + <has_line_matching expression="TOTAL: \d+ (\d+.\d+%)" /> + <has_line_matching expression="------NOTES---------" /> + </assert_contents> + </output> + </test> + <test> + <param name="fasta" value="DmelChr4Chr3.fa" /> + <param name="classif" value="yes" /> + <output name="outputfasta"> + <assert_contents> + <has_line_matching expression="^>\w+" /> + <has_line_matching expression="[ACTG]{60}" /> + </assert_contents> + </output> + <output name="outputlog"> + <assert_contents> + <has_line_matching expression="^step 7 finished successfully" /> + <has_line_matching expression="^END time: \d{4}-\d{2}-\d{2} \d{2}:\d{2}:\d{2}" /> + <has_line_matching expression="^Writing fasta file" /> + </assert_contents> + </output> + <output name="outputconfig"> + <assert_contents> + <has_line_matching expression="^project_name: \d{8}" /> + <has_line_matching expression="^repet_version: 2.5" /> + <has_line_matching expression="^tmpDir:" /> + <has_line_matching expression="^clean: yes" /> + </assert_contents> + </output> + <output name="outputstats"> + <assert_contents> + <has_line_matching expression="-------Summary---------" /> + <has_line_matching expression="TOTAL: \d+ (\d+.\d+%)" /> + <has_line_matching expression="------NOTES---------" /> + </assert_contents> + </output> + <output name="outputclassif"> + <assert_contents> + <has_n_columns n="8" /> + </assert_contents> + </output> + </test> + </tests> + + <!-- [OPTIONAL] Help displayed in Galaxy --> + <help> +<![CDATA[ +.. class:: infomark + + +**Authors** +Gwendoline Andres +Valentin Marcon +Veronique Jamilloux +Olivier Inizan + +--------------------------------------------------- + +.. class:: infomark + +**Please cite** If you use this tool, please cite + +--------------------------------------------------- + +============== +TEdenovo Lite +============== + +----------- +Description +----------- + REPET is for detection and annotation of transposable elements (TE). The ligth version available on Galaxy is specialised on transposable element masking. + TEdenovo is the first step to constitute a consensus library of TE. + For a detailed description of each parameter used, please consult the Galaxy page in "Shared Data > Published Pages" + +----------------- +Workflow position +----------------- + +**Downstream tools** + +=========== ========================== ======= +Name output file(s) format +=========== ========================== ======= +TEannot GFF with TE masked gff +=========== ========================== ======= + + +---------- +Input file +---------- + +Fasta file + Genome file at fasta format + + +------------ +Output files +------------ + +Output_name.fa + TE library + +Output_name.log + log file to see each steps progress + +Output_name.cfg + File to show which params have been used + +Output_name.classif_stats.txt + File with statistics you can visualize + +Output_name.classif + If asked, the classification file to give to next step (TEannot) + + +--------------- +Working example +--------------- + +Input files +=========== + +Fasta file +----------- + +:: + + >dmel_chr4 + GAATTCGCGTCCGCTTACCCATGTGCCTGTGGATGCCGAACAGGAGGCGCCGTTGACGGC + GAATGACTTACTCAAGGGAGTAGCCAATCTGTCGGATACGCCCGGATTGGAGCTGCCCAT + GGAGGGTTCTACAAGAAAGCGGTGGAGGATTGCTCGCATACTGCGAGACCGTTTCTGAAG + GAGATGGCTCATGGAGTACCTGCCTACGCTTGTGCGCCGCGAGAAGTGGTGAAGAAGAAC + GGAGCCCATACACCAGGGTGATATGGTCTTCGTCTGCGATCCCGCCTTGCCCCGGCGAGA + GTGGTGCAAGGGCATCATGGAGGAAGTCTCCAGCAGAGCAGATGGAGCAACGGCCTATAG + AGGACACTGATGCTACCCGTCTCTAAGCTTGCAGTTTTGGATTTAAGTGAATCGGTTATT + CACGGGGTCGGGGATGTCGCGGATCGAACGGTGCAATCGATAGGCGTAATCAGTATTTCC + AGATAGTGATAAGATTTGGTGGATAAATGTGTGCGGGCACACTAATGGCCGCCATCGTAA + GCCGCGAAAAGCTTAGCGTGCATTGTCGATCGAGAGTTTGGAGGGCAAACTGCGGTAAGA + TAAGATTAAATAATTTGTACTGAATAATCTTAAAGAATCCTGATGGAAAGCGCCATGCAG + TCACATATAATATGTGCAGAGCTCTCCTC + + +Output files +============ + +output fasta : TE library +------------------------- + +:: + + >DTX-incomp_20150313101806-B-G1-Map3 + ATACAGCTGCGGTTAAAATAATAGCACTACTGCAGGTGGAAAGTTGATTTCCTAAAAAAA + ATTATTAAATGTTTATATTTTTTTAAGTCAGATTGCATGAATAATAAGTACCATATGTTG + GCTCTCTGAGCAAGAAATTTTTAG + >RLX-incomp_20150313101806-B-R12-Map3_reversed + ATGATAAGTAGGCAAACTATAAAAATGTTCTATTTATGGGCTGCAATAAACATGTCACCG + GACAGCATAAGTGGCAACTACAG + + +output config : .cfg +-------------------- + +:: + + [repet_env] + repet_version: 2.4 + repet_host: ****** + repet_user: ****** + + +output stats : .classif_stats.txt +--------------------------------- + +:: + + LTR incomp: 1 (10.00%) + LTR total (RLX): 1 (10.00%) + + ClassI + one order: 1 (10.00%) + ClassI total (RXX): 1 (10.00%) + + -------------------------Summary-------------------------------- + + RXX: 1 (10.00%) + DXX: 9 (90.00%) + TOTAL: 10 (100.00%) + + -----------------------------NOTES------------------------------ + + +output classif : Classification file +------------------------------------ + +:: + + DTX-incomp_dataset_370.dat-B-G1-Map3 542 + ok II TIR incomplete CI=37; coding=(TE_BLRtx: TC1_DM:ClassII:TIR:Tc1-Mariner: 32.59%; TE_BLRx: Mariner-1_DAn_1p:ClassII:TIR:Tc1-Mariner: 18.43%); struct=(TElength: <700bps); other=(Other_profiles: PF13936.1_HTH_38_NA_OTHER_27.0: 77.27%(77.27%); SSRCoverage=0.03) + DTX-comp_dataset_370.dat-B-G8-Map20 1244 + ok II TIR complete CI=50; coding=(TE_BLRtx: PROTOP:ClassII:TIR:P: 12.03%, PROTOP_A:ClassII:TIR:P: 49.14%); struct=(TElength: >1000bps; TermRepeats: termTIR: 50); other=(SSRCoverage=0.25) + +]]> + </help> + + <citations> + <citation type="bibtex"><![CDATA[@article{10.1371/journal.pone.0016526, + author = {Flutre, Timothée AND Duprat, Elodie AND Feuillet, Catherine AND Quesneville, Hadi}, + journal = {PLoS ONE}, + publisher = {Public Library of Science}, + title = {Considering Transposable Element Diversification in <italic>De Novo</italic> Annotation Approaches}, + year = {2011}, + month = {01}, + volume = {6}, + url = {http://dx.doi.org/10.1371%2Fjournal.pone.0016526}, + pages = {e16526}, + abstract = { + <p>Transposable elements (TEs) are mobile, repetitive DNA sequences that are almost ubiquitous in prokaryotic and eukaryotic genomes. They have a large impact on genome structure, function and evolution. With the recent development of high-throughput sequencing methods, many genome sequences have become available, making possible comparative studies of TE dynamics at an unprecedented scale. Several methods have been proposed for the <italic>de novo</italic> identification of TEs in sequenced genomes. Most begin with the detection of genomic repeats, but the subsequent steps for defining TE families differ. High-quality TE annotations are available for the <italic>Drosophila melanogaster</italic> and <italic>Arabidopsis thaliana</italic> genome sequences, providing a solid basis for the benchmarking of such methods. We compared the performance of specific algorithms for the clustering of interspersed repeats and found that only a particular combination of algorithms detected TE families with good recovery of the reference sequences. We then applied a new procedure for reconciling the different clustering results and classifying TE sequences. The whole approach was implemented in a pipeline using the REPET package. Finally, we show that our combined approach highlights the dynamics of well defined TE families by making it possible to identify structural variations among their copies. This approach makes it possible to annotate TE families and to study their diversification in a single analysis, improving our understanding of TE dynamics at the whole-genome scale and for diverse species.</p> + }, + number = {1}, + doi = {10.1371/journal.pone.0016526} + }]]></citation> + <citation type="bibtex"><![CDATA[@article{10.1371/journal.pone.0094101, + author = {Maumus, Florian AND Quesneville, Hadi}, + journal = {PLoS ONE}, + publisher = {Public Library of Science}, + title = {Deep Investigation of <italic>Arabidopsis thaliana</italic> Junk DNA Reveals a Continuum between Repetitive Elements and Genomic Dark Matter}, + year = {2014}, + month = {04}, + volume = {9}, + url = {http://dx.doi.org/10.1371%2Fjournal.pone.0094101}, + pages = {e94101}, + abstract = {<p>Eukaryotic genomes contain highly variable amounts of DNA with no apparent function. This so-called junk DNA is composed of two components: repeated and repeat-derived sequences (together referred to as the repeatome), and non-annotated sequences also known as genomic dark matter. Because of their high duplication rates as compared to other genomic features, transposable elements are predominant contributors to the repeatome and the products of their decay is thought to be a major source of genomic dark matter. Determining the origin and composition of junk DNA is thus important to help understanding genome evolution as well as host biology. In this study, we have used a combination of tools enabling to show that the repeatome from the small and reducing <italic>A. thaliana</italic> genome is significantly larger than previously thought. Furthermore, we present the concepts and results from a series of innovative approaches suggesting that a significant amount of the <italic>A. thaliana</italic> dark matter is of repetitive origin. As a tentative standard for the community, we propose a deep compendium annotation of the <italic>A. thaliana</italic> repeatome that may help addressing farther genome evolution as well as transcriptional and epigenetic regulation in this model plant.</p>}, + number = {4}, + doi = {10.1371/journal.pone.0094101} + }]]></citation> + </citations> + + +</tool>