# HG changeset patch # User xuebing # Date 1331921683 14400 # Node ID aa8bed8ca1e38688da6a80cdf38641fb3fc5fb4d # Parent 7e14dac65e49ade5984b23767c68ea10c2dee1a6 Deleted selected files diff -r 7e14dac65e49 -r aa8bed8ca1e3 mytools/match Binary file mytools/match has changed diff -r 7e14dac65e49 -r aa8bed8ca1e3 mytools/match.xml --- a/mytools/match.xml Fri Mar 16 14:03:59 2012 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,54 +0,0 @@ - - find short motif occurrences - ./match $motif $seq $output $nmismatch $rc $bed > $log - - - - - - - - - - - - - - -**What it does** - -This tool searches occurrences of a short nucleotide seuqences (allowing mismatches) in a set of longer sequences. - -Example motif file:: - - >motif1 - CAGGTAAGT - >motif2 - GTTTGGGGGCC - -Example sequence file:: - - >hg18_chr6_122208322_122209078_+ - CGTCGTAGCTACTAGCTACGTACGTACGTAGCTAGCATGCATGCTACGTA - CGTAGCTAGCTAAAAAAAAAAAAAAACTGCGGCTAGCTAGCTAGCTACGT - CGATCGTAGCTAC... - >hg18_chr6_1208322_122209023_+ - CGATGCTAGCTAGCTAGCTACGTAGCTAGCTAGTCGATGCTAGCTAGCTA - ATGCTAGCTAGC.... - -Output (bed):: - - chr11 72790893 72790902 ACTTAACTG 1 - antisense 5ss,G4T:CAGTTAAGT-rc hg18_chr11_72790846_72791902_+ 47 - chr11 72791880 72791889 CAGGTAAGA 1 + sense 5ss,T9A:CAGGTAAGA hg18_chr11_72790846_72791902_+ 1034 - - -Output (tab):: - - Tmod4 802 5ss:CAGGTAAGT-rc ACTTACCTG - Atp7b 77 5ss:CAGGTAAGT CAGGTAAGT - Fnta 665 5ss:CAGGTAAGT CAGGTAAGT - - - - -