annotate tools/metag_tools/shrimp_wrapper.xml @ 1:cdcb0ce84a1b

Uploaded

<tool id="shrimp_wrapper" name="SHRiMP for Letter-space" version="1.0.0">
  <description>reads mapping against reference sequence </description>
  <command interpreter="python">
    #if     ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $input_query
    #elif   ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size
    #elif   ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $input_query                                                              $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold 
    #elif   ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold
    #end if#
  </command>
    <inputs>
        <page>
        <conditional name="type_of_reads">
            <param name="single_or_paired" type="select" label="Single- or Paired-ends">
                <option value="single">Single-end</option>
                <option value="paired">Paired-end</option>
            </param>
            <when value="single">
                <param name="input_query" type="data" format="fastqsolexa" label="Align sequencing reads" help="No dataset? Read tip below"/>
            </when>
            <when value="paired">
                <param name="insertion_size" type="integer" size="5" value="600" label="Insertion length between two ends" help="bp" />
                <param name="input1" type="data" format="fastqsolexa" label="Align sequencing reads, one end" />
                <param name="input2" type="data" format="fastqsolexa" label="and the other end" />
            </when> 
        </conditional>
        <param name="input_target" type="data" format="fasta" label="against reference" />
        <conditional name="param">
            <param name="skip_or_full" type="select" label="SHRiMP settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full List">
                <option value="skip">Commonly used</option>
                <option value="full">Full Parameter List</option>
            </param>
            <when value="skip" />
            <when value="full">
                <param name="spaced_seed"                   type="text"     size="30"   value="111111011111"    label="Spaced Seed" />
                <param name="seed_matches_per_window"       type="integer"  size="5"    value="2"               label="Seed Matches per Window" />
                <param name="seed_hit_taboo_length"         type="integer"  size="5"    value="4"               label="Seed Hit Taboo Length" />
                <param name="seed_generation_taboo_length"  type="integer"  size="5"    value="0"               label="Seed Generation Taboo Length" />
                <param name="seed_window_length"            type="float"    size="10"   value="115.0"           label="Seed Window Length"          help="in percentage"/>
                <param name="max_hits_per_read"             type="integer"  size="10"   value="100"             label="Maximum Hits per Read" />
                <param name="max_read_length"               type="integer"  size="10"   value="1000"            label="Maximum Read Length" />
                <param name="kmer"                          type="integer"  size="10"   value="-1"              label="Kmer Std. Deviation Limit"   help="-1 as None"/>
                <param name="sw_match_value"                type="integer"  size="10"   value="100"             label="S-W Match Value" />
                <param name="sw_mismatch_value"             type="integer"  size="10"   value="-150"            label="S-W Mismatch Value" />
                <param name="sw_gap_open_ref"               type="integer"  size="10"   value="-400"            label="S-W Gap Open Penalty (Reference)" />
                <param name="sw_gap_open_query"             type="integer"  size="10"   value="-400"            label="S-W Gap Open Penalty (Query)" />
                <param name="sw_gap_ext_ref"                type="integer"  size="10"   value="-70"             label="S-W Gap Extend Penalty (Reference)" />
                <param name="sw_gap_ext_query"              type="integer"  size="10"   value="-70"             label="S-W Gap Extend Penalty (Query)" />
                <param name="sw_hit_threshold"              type="float"    size="10"   value="68.0"            label="S-W Hit Threshold"           help="in percentage"/>
            </when>
        </conditional>
        </page>
    </inputs>
    <outputs>
        <data name="output1" format="tabular"/>
        <data name="output2" format="tabular"/>
    </outputs>
    <requirements>
      <requirement type="binary">rmapper-ls</requirement>
    </requirements>
    <tests>
        <test>
            <param name="single_or_paired" value="single" />
            <param name="skip_or_full" value="skip" />
            <param name="input_target" value="shrimp_phix_anc.fa" ftype="fasta" />
            <param name="input_query" value="shrimp_wrapper_test1.fastq" ftype="fastqsolexa"/>
            <output name="output1" file="shrimp_wrapper_test1.out1" />
        </test>
        <!--  
        <test>
            <param name="single_or_paired" value="paired" />
            <param name="skip_or_full" value="skip" />
            <param name="input_target" value="shrimp_eca_chrMT.fa" ftype="fasta" />
            <param name="input1" value="shrimp_wrapper_test2_end1.fastq" ftype="fastqsolexa" />
            <param name="input2" value="shrimp_wrapper_test2_end2.fastq" ftype="fastqsolexa" />
            <param name="insertion_size" value="600" />
            <output name="output1" file="shrimp_wrapper_test2.out1" />
        </test>
        <test>
            <param name="single_or_paired" value="single" />
            <param name="skip_or_full" value="full" />
            <param name="input_target" value="shrimp_phix_anc.fa" ftype="fasta" />
            <param name="input_query" value="shrimp_wrapper_test1.fastq" ftype="fastqsolexa"/>
            <param name="spaced_seed" value="111111011111" />
            <param name="seed_matches_per_window" value="2" />
            <param name="seed_hit_taboo_length" value="4" />
            <param name="seed_generation_taboo_length" value="0" />
            <param name="seed_window_length" value="115.0" />
            <param name="max_hits_per_read" value="100" />
            <param name="max_read_length" value="1000" />
            <param name="kmer" value="-1" />
            <param name="sw_match_value" value="100" />
            <param name="sw_mismatch_value" value="-150" />
            <param name="sw_gap_open_ref" value="-400" />
            <param name="sw_gap_open_query" value="-400" />
            <param name="sw_gap_ext_ref" value="-70" />
            <param name="sw_gap_ext_query" value="-70" />
            <param name="sw_hit_threshold" value="68.0" />
            <output name="output1" file="shrimp_wrapper_test1.out1" />
        </test> 
        <test>
            <param name="single_or_paired" value="paired" />
            <param name="skip_or_full" value="full" />
            <param name="input_target" value="shrimp_eca_chrMT.fa" ftype="fasta" />
            <param name="spaced_seed" value="111111011111" />
            <param name="seed_matches_per_window" value="2" />
            <param name="seed_hit_taboo_length" value="4" />
            <param name="seed_generation_taboo_length" value="0" />
            <param name="seed_window_length" value="115.0" />
            <param name="max_hits_per_read" value="100" />
            <param name="max_read_length" value="1000" />
            <param name="kmer" value="-1" />
            <param name="sw_match_value" value="100" />
            <param name="sw_mismatch_value" value="-150" />
            <param name="sw_gap_open_ref" value="-400" />
            <param name="sw_gap_open_query" value="-400" />
            <param name="sw_gap_ext_ref" value="-70" />
            <param name="sw_gap_ext_query" value="-70" />
            <param name="sw_hit_threshold" value="68.0" />
            <param name="input1" value="shrimp_wrapper_test2_end1.fastq" ftype="fastqsolexa"/>
            <param name="input2" value="shrimp_wrapper_test2_end2.fastq" ftype="fastqsolexa"/>
            <param name="insertion_size" value="600" />
            <output name="output1" file="shrimp_wrapper_test2.out1" />
        </test>
        -->
    </tests>
<help>

.. class:: warningmark

IMPORTANT: This tool currently only supports data where the quality scores are integers or ASCII quality scores with base 64. Click pencil icon next to your dataset to set datatype to *fastqsolexa*.


-----
    
**What it does**
 
SHRiMP (SHort Read Mapping Package) is a software package for aligning genomic reads against a target genome. 

This wrapper post-processes the default SHRiMP/rmapper-ls output and generates a table with all information from reads and reference for the mapping. The tool takes single- or paired-end reads. For single-end reads, only uniquely mapped alignment is considered. In paired-end reads, only pairs that meet the following criteria will be used to generate the table: 1). the ends fall within the insertion size; 2). the ends are mapped at the opposite directions. If there are still multiple mappings after applying the criteria, this paired-end read will be discarded. 
  

-----

**Input formats**

A multiple-fastq file, for example::

    @seq1
    TACCCGATTTTTTGCTTTCCACTTTATCCTACCCTT
    +seq1
    hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh


-----

**Outputs**

The tool gives two outputs.

**Table output**

Table output contains 8 columns::

     1     2        3       4     5     6     7     8 
  ----------------------------------------------------
  chrM   14711     seq1     0     T     A    40     1 
  chrM   14712     seq1     1     T     T    40     1 

where::
    
  1. (chrM)   - Reference sequence id
  2. (14711)  - Position of the mapping in the reference
  3. (seq1)   - Read id
  4. (0)      - Position of the mapping in the read
  5. (T)      - Nucleotide in the reference
  6. (A)      - Nucleotide in the read
  7. (40)     - Quality score for the nucleotide in the position of the read
  8. (1)      - The number of times this position is covered by reads

     
**SHRiMP output**

This is the default output from SHRiMP/rmapper-ls::
 
     1     2     3       4      5      6     7     8      9      10
  -------------------------------------------------------------------
   seq1  chrM    +     3644    3679    1    36     36    3600    36  

where::

  1. (seq1)   - Read id 
  2. (chrM)   - Reference sequence id
  3. (+)      - Strand of the read
  4. (3466)   - Start position of the alignment in the reference
  5. (3679)   - End position of the alignment in the reference
  6. (1)      - Start position of the alignment in the read
  7. (36)     - End position of the alignment in the read
  8. (36)     - Length of the read
  9. (3600)   - Score 
 10. (36)     - Edit string

 
-----

**SHRiMP parameter list**

The commonly used parameters with default value setting::

    -s    Spaced Seed                             (default: 111111011111)
          The spaced seed is a single contiguous string of 0's and 1's. 
          0's represent wildcards, or positions which will always be 
          considered as matching, whereas 1's dictate positions that 
          must match. A string of all 1's will result in a simple kmer scan.
    -n    Seed Matches per Window                 (default: 2)
          The number of seed matches per window dictates how many seeds 
          must match within some window length of the genome before that 
          region is considered for Smith-Waterman alignment. A lower 
          value will increase sensitivity while drastically increasing 
          running time. Higher values will have the opposite effect.
    -t    Seed Hit Taboo Length                   (default: 4)
          The seed taboo length specifies how many target genome bases 
          or colors must exist prior to a previous seed match in order 
          to count another seed match as a hit.
    -9    Seed Generation Taboo Length            (default: 0)
          
    -w    Seed Window Length                      (default: 115.00%)
          This parameter specifies the genomic span in bases (or colours) 
          in which *seed_matches_per_window* must exist before the read 
          is given consideration by the Simth-Waterman alignment machinery.
    -o    Maximum Hits per Read                   (default: 100)
          This parameter specifies how many hits to remember for each read. 
          If more hits are encountered, ones with lower scores are dropped 
          to make room.
    -r    Maximum Read Length                     (default: 1000)
          This parameter specifies the maximum length of reads that will 
          be encountered in the dataset. If larger reads than the default 
          are used, an appropriate value must be passed to *rmapper*.
    -d    Kmer Std. Deviation Limit               (default: -1 [None])
          This option permits pruning read kmers, which occur with 
          frequencies greater than *kmer_std_dev_limit* standard 
          deviations above the average. This can shorten running 
          time at the cost of some sensitivity. 
          *Note*: A negative value disables this option.            
    -m    S-W Match Value                         (default: 100)
          The value applied to matches during the Smith-Waterman score calculation.
    -i    S-W Mismatch Value                      (default: -150)
          The value applied to mismatches during the Smith-Waterman 
          score calculation.
    -g    S-W Gap Open Penalty (Reference)        (default: -400)
          The value applied to gap opens along the reference sequence 
          during the Smith-Waterman score calculation.
          *Note*: Note that for backward compatibility, if -g is set 
          and -q is not set, the gap open penalty for the query will 
          be set to the same value as specified for the reference.
    -q    S-W Gap Open Penalty (Query)            (default: -400)
          The value applied to gap opens along the query sequence during 
          the Smith-Waterman score calculation.        
    -e    S-W Gap Extend Penalty (Reference)      (default: -70)
          The value applied to gap extends during the Smith-Waterman score calculation.
          *Note*: Note that for backward compatibility, if -e is set 
          and -f is not set, the gap exten penalty for the query will 
          be set to the same value as specified for the reference. 
    -f    S-W Gap Extend Penalty (Query)          (default: -70)
          The value applied to gap extends during the Smith-Waterman score calculation.
    -h    S-W Hit Threshold                       (default: 68.00%)
          In letter-space, this parameter determines the threshold 
          score for both vectored and full Smith-Waterman alignments. 
          Any values less than this quantity will be thrown away.
          *Note* This option differs slightly in meaning between letter-space and color-space.


-----

**Reference**
 
 **SHRiMP**: Stephen M. Rumble, Michael Brudno, Phil Lacroute, Vladimir Yanovsky, Marc Fiume, Adrian Dalca. shrimp at cs dot toronto dot edu. 

</help>
</tool>