comparison tools/genome_diversity/extract_primers.xml @ 0:9071e359b9a3

Uploaded

0:9071e359b9a3

<tool id="gd_extract_primers" name="Extract primers" version="1.0.0">
  <description>for selected SNPs</description>

  <command interpreter="python2.5">
    extract_primers.py "--input=$input" "--output=$output" "--primers_loc=${GALAXY_DATA_INDEX_DIR}/gd.primers.loc"
    #if $override_metadata.choice == "0":
      "--scaffold_col=${input.metadata.scaffold}" "--pos_col=${input.metadata.pos}" "--species=${input.metadata.species}"
    #else
      "--scaffold_col=$scaf_col" "--pos_col=$pos_col" "--species=$species"
    #end if
  </command>

  <inputs>
    <param format="tabular" name="input" type="data" label="Selected SNPS dataset"/>
    <conditional name="override_metadata">
      <param name="choice" type="select" format="integer" label="choose columns">
        <option value="0" selected="true">No, get columns from metadata</option>
        <option value="1" >Yes, choose columns</option>
      </param>
      <when value="0">
        <!-- no options -->
      </when>
      <when value="1">
        <param name="scaf_col" type="data_column" data_ref="input" numerical="false" label="Column with scaffold"/>
        <param name="pos_col" type="data_column" data_ref="input" numerical="true" label="Column with position"/>
        <param name="species" type="select" label="Choose species">
          <options from_file="gd.species.txt">
            <column name="name" index="1"/>
            <column name="value" index="0"/>
          </options>
        </param>
      </when>
    </conditional>
  </inputs>

  <outputs>
    <data format="txt" name="output"/>
  </outputs>

  <tests>
    <test>
      <param name="input" value="gd.sample.wsf" ftype="wsf"/>
      <param name="choice" value="0"/>
      <output name="output" file="gd.extract_primers.txt"/>
    </test>
  </tests>


  <help>
**What it does**

  This tool extracts primers for SNPs in the dataset using the Primer3 program.
  The first line of output for a given SNP reports the name of the assembled
  contig, the SNP's position in the contig, the two variant nucleotides, and
  Primer3's "pair penalty".  The next line, if not blank, names restriction
  enzymes (from the user-adjustable list) that differentially cut at that
  site, but do not cut at any other position between and including the
  primer positions.  The next lines show the SNP's flanking regions, with
  the SNP position indicated by "n", including the primer positions and an
  additional 3 nucleotides.

-----

**Example**

- input file::

    chr5_30800874_30802049    734   G  A  chr5   30801606   A  24  0  99   4  11  97   Y  496  0.502  0.033  0.215  6
    chr8_55117827_55119487    994   A  G  chr8   55118815   G  25  0  102  4  11  96   Y  22   0.502  0.025  2.365  1
    chr9_100484836_100485311  355   C  T  chr9   100485200  T  27  0  108  6  17  100  Y  190  0.512  0.880  2.733  4
    chr12_3635530_3637738     2101  T  C  chr12  3637630    T  25  0  102  4  13  93   Y  169  0.554  0.024  0.366  4

- output file::

    chr5_30800874_30802049 734 G A 0.352964
     BglII,MboI,Sau3AI,Tru9I,XhoII
      1 CTGAAGGTGAGCAGGATTCAGGAGACAGAAAACAAAGCCCAGGCCTGCCCAAGGTGGAAA
           >>>>>>>>>>>>>>>>>>>>
     
     61 AGTCTAACAACTCGCCCTCTGCTTAnATCTGAGACTCACAGGGATAATAACACACTTGGT
     
     
     21 CAAGGAATAAACTAGATATTATTCACTCCTCTAGAAGGCTGCCAGGAAAATTGCCTGACT
                                                             &lt;&lt;&lt;&lt;&lt;&lt;&lt;
     
    181 TGAACCTTGGCTCTGA
        &lt;&lt;&lt;&lt;&lt;&lt;&lt;&lt;&lt;&lt;&lt;&lt;&lt;
    etc.
  </help>
</tool>