Mercurial > repos > xuebing > sharplabtool
diff tools/fasta_tools/fasta_to_tabular.xml @ 0:9071e359b9a3
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:37:19 -0500 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/fasta_tools/fasta_to_tabular.xml Fri Mar 09 19:37:19 2012 -0500 @@ -0,0 +1,128 @@ +<tool id="fasta2tab" name="FASTA-to-Tabular" version="1.1.0"> + <description>converter</description> + <command interpreter="python">fasta_to_tabular.py $input $output $keep_first $descr_columns</command> + <inputs> + <param name="input" type="data" format="fasta" label="Convert these sequences"/> + <param name="descr_columns" type="integer" size="2" value="1" label="How many columns to divide title string into?" help="Typically 2 to take the ID (first word) and decription (rest) as two columns, or 1 to give a single column"> + <validator type="in_range" min="1" /> + </param> + <param name="keep_first" type="integer" size="5" value="0" label="How many title characters to keep?" help="Applies only to the first column taken from the title string ('0' = keep the whole thing), useful when your sequence identifiers are all the same length."> + <validator type="in_range" min="0" /> + </param> + </inputs> + <outputs> + <data name="output" format="tabular"/> + </outputs> + <tests> + <test> + <param name="input" value="454.fasta" /> + <param name="descr_columns" value="1"/> + <param name="keep_first" value="0"/> + <output name="output" file="fasta_to_tabular_out1.tabular" /> + </test> + + <test> + <param name="input" value="4.fasta" /> + <param name="descr_columns" value="1"/> + <param name="keep_first" value="0"/> + <output name="output" file="fasta_to_tabular_out2.tabular" /> + </test> + + <test> + <param name="input" value="454.fasta" /> + <param name="descr_columns" value="1"/> + <param name="keep_first" value="14"/> + <output name="output" file="fasta_to_tabular_out3.tabular" /> + </test> + + <test> + <param name="input" value="454.fasta" /> + <param name="descr_columns" value="2"/> + <param name="keep_first" value="0"/> + <output name="output" file="fasta_to_tabular_out4.tabular" /> + </test> + + <test> + <param name="input" value="454.fasta" /> + <param name="descr_columns" value="5"/> + <param name="keep_first" value="0"/> + <output name="output" file="fasta_to_tabular_out5.tabular" /> + </test> + + <test> + <param name="input" value="454.fasta" /> + <param name="descr_columns" value="5"/> + <param name="keep_first" value="10"/> + <output name="output" file="fasta_to_tabular_out6.tabular" /> + </test> + + </tests> + <help> + +**What it does** + +This tool converts FASTA formatted sequences to TAB-delimited format. + +Many tools consider the first word of the FASTA ">" title line to be an identifier, and any remaining text to be a free form description. +It is therefore useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**. +In some cases the description can be usefully broken up into more columns -- see the examples . + +The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. +With the introduction of the **How many columns to divide title string into?** option this setting is of limited use, but does still allow you to truncate the identifier. + +----- + +**Example** + +Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: + + >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ + TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG + TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG + >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ + AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA + +Running this tool with the default settings will produce this (2 column output): + +========================================================================== ======================================= +EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG +EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA +========================================================================== ======================================= + +Having the full title line (the FASTA ">" line text) as a column is not always ideal. + +The **How many characters to keep?** option is useful if your identifiers are all the same length. +In this example the identifier is 14 characters, so setting **How many characters to keep?** to **14** (and leaving **How many columns to divide title string into?** as the default, **1**) will produce this (2 column output): + +============== ======================================= +EYKX4VC02EQLO5 TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG +EYKX4VC02D4GS2 AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA +============== ======================================= + +If however your FASTA file has identifiers of variable length, it is better to split the text into at least two columns. +Running this tool with **How many columns to divide title string into?** to **2** will produce this (3 column output): + +============== =========================================================== ======================================= +EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG +EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA +============== =========================================================== ======================================= + +Running this tool with **How many columns to divide title string into?** to **5** will produce this (5 column output): + +============== ========== ============ ======== ========================== ======================================= +EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG +EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA +============== ========== ============ ======== ========================== ======================================= + +Running this tool with **How many columns to divide title string into?** to **5** and **How many characters to keep?** to **10** will produce this (5 column output). +Notice that only the first column is truncated to 10 characters -- and be careful not to trim your sequence names too much (generally they should be unique): + +========== ========== ============ ======== ========================== ======================================= +EYKX4VC02E length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGC...ACG +EYKX4VC02D length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA +========== ========== ============ ======== ========================== ======================================= + +Note the sequences have been truncated for display purposes in the above tables. + + </help> +</tool>