Mercurial > repos > xuebing > sharplabtool
diff tools/maf/maf_reverse_complement.xml @ 0:9071e359b9a3
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:37:19 -0500 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/maf/maf_reverse_complement.xml Fri Mar 09 19:37:19 2012 -0500 @@ -0,0 +1,53 @@ +<tool id="MAF_Reverse_Complement_1" name="Reverse Complement" version="1.0.1"> + <description>a MAF file</description> + <command interpreter="python">maf_reverse_complement.py $input1 $out_file1 $species</command> + <inputs> + <page> + <param format="maf" name="input1" label="Alignment File" type="data"/> + <param name="species" type="select" display="checkboxes" multiple="true" label="Choose species" help="Select species to be included in the final alignment"> + <options> + <filter type="data_meta" ref="input1" key="species" /> + </options> + </param> + </page> + </inputs> + <outputs> + <data format="maf" name="out_file1" metadata_source="input1"/> + </outputs> + <tests> + <test> + <param name="input1" value="3.maf" dbkey="hg17" format="maf"/> + <param name="species" value="hg17,panTro1,mm5,rn3,canFam1"/> + <output name="out_file1" file="maf_reverse_complement_out.dat"/> + </test> + </tests> + <help> +**What it does** + +This tool takes a MAF file and creates a new MAF file, where each block has been reversed complemented. + +**Example** + +This MAF Block:: + + a score=8157.000000 + s hg17.chr7 127471526 58 + 158628139 AATTTGTGGTTTATTCATTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG + s panTro1.chr6 129885407 58 + 161576975 AATTTGTGGTTTATTCGTTTTTCATTATTTTGTTTAAGGAGGTCTATAGTGGAAGAGG + s mm5.chr6 28904928 54 + 149721531 AA----CGTTTCATTGATTGCTCATCATTTAAAAAAAGAAATTCCTCAGTGGAAGAGG + +becomes:: + + a score=8157.000000 + s hg17.chr7 31156555 58 - 158628139 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAATGAATAAACCACAAATT + s panTro1.chr6 31691510 58 - 161576975 CCTCTTCCACTATAGACCTCCTTAAACAAAATAATGAAAAACGAATAAACCACAAATT + s mm5.chr6 120816549 54 - 149721531 CCTCTTCCACTGAGGAATTTCTTTTTTTAAATGATGAGCAATCAATGAAACG----TT + +------ + +**Citation** + +If you use this tool, please cite `Blankenberg D, Taylor J, Nekrutenko A; The Galaxy Team. Making whole genome multiple alignments usable for biologists. Bioinformatics. 2011 Sep 1;27(17):2426-2428. <http://www.ncbi.nlm.nih.gov/pubmed/21775304>`_ + + + </help> +</tool>