Mercurial > repos > xuebing > sharplabtool
diff tools/metag_tools/blat_coverage_report.xml @ 0:9071e359b9a3
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:37:19 -0500 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tools/metag_tools/blat_coverage_report.xml Fri Mar 09 19:37:19 2012 -0500 @@ -0,0 +1,75 @@ +<tool id="generate_coverage_report" name="Polymorphism of the Reads"> + <description>the percentage of reads supporting each nucleotide at each location</description> + <command interpreter="python">blat_coverage_report.py $input1 $output1</command> + <inputs> + <param name="input1" type="data" format="tabular" label="Alignment result"/> + </inputs> + <outputs> + <data name="output1" format="tabular"/> + </outputs> + <tests> + <test> + <param name="input1" value="blat_coverage_report_test1.txt" ftype="tabular" /> + <output name="output1" file="blat_coverage_report_test1.out" /> + </test> + </tests> + <help> + +.. class:: warningmark + +**IMPORTANT**. Only works for BLAT **standard** or **pslx** output formats (hint: to output pslx format, add **-out=pslx** in the command). + +----- + +**What it does** + + The tool will generate a table of 6 columns as following: + +- 1st column: chromosome id. + +- 2nd column: chromosome location. + +- 3rd column: the nucleotide from reference genome at the chromosome location (2nd column). + +- 4th column: total coverage of the reads (number of reads that were mapped to the chromosome location). + +- 5th column: percentage of reads that support nucleotide **A** at this location. + +- 6th column: percentage of reads that support nucleotide **T** at this location. + +- 7th column: percentage of reads that support nucleotide **C** at this location. + +- 8th column: percentage of reads that support nucleotide **G** at this location. + + +----- + +**Example** + +- The BLAT pslx results look like the following (tab separated with sequence at the end):: + + 30 0 0 0 0 0 0 0 + seq0 30 0 30 chr 4639675 4549207 4549237 1 30, 0, 4549207, cggacagcgccgccaccaacaaagccacca, cggacagcgccgccaccaacaaagccacca, + 30 0 0 0 0 0 0 0 + seq1 30 0 30 chr 4639675 614777 614807 1 30, 0, 614777, aaaacaccggatgctccggcgctggcagat, aaaacaccggatgctccggcgctggcagat, + 28 1 0 0 0 0 0 0 + seq2 30 0 29 chr 4639675 3289283 3289312 1 29, 0, 3289283, tttgcttttagtacaccggattcagaacc, tttgctttcagtacaccggattcagaacc, + 30 0 0 0 0 0 0 0 + seq4 30 0 30 chr 4639675 2665584 2665614 1 30, 0, 2665584, cacgctacgtgcgcccccgcccagaaggcg, cacgctacgtgcgcccccgcccagaaggcg, + + The 14th column is the chromosome id, and the 16th and 17th columns shows the reads were mapped to chromosome start and end locations. + +- The report showed overall coverage of reads on each chromosome location (partial result):: + + +-------+----------+------+------+--------+------+--------+------+ + | title | location | ref. | cov. | A | T | C | G | + +-------+----------+------+------+--------+------+--------+------+ + | chr | 614777 | A | 1 | A(100) | T(0) | C(0) | G(0) | + | chr | 614778 | A | 1 | A(100) | T(0) | C(0) | G(0) | + | chr | 614779 | A | 1 | A(100) | T(0) | C(0) | G(0) | + +-------+----------+------+------+--------+------+--------+------+ + +----- + +**Reference** + + **BLAT**: Kent, W James, BLAT--the BLAST-like alignment tool. (2002) Genome Research:12(4) 656-664. + + </help> +</tool>