Mercurial > repos > xuebing > sharplabtool
diff splicesite.xml @ 14:76e1b1b21cce default tip
Deleted selected files
author | xuebing |
---|---|
date | Tue, 13 Mar 2012 19:05:10 -0400 |
parents | 292186c14b08 |
children |
line wrap: on
line diff
--- a/splicesite.xml Sat Mar 10 08:17:36 2012 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,64 +0,0 @@ -<tool id="splicesite" name="splice site score"> - <description>using max entropy model</description> - <command interpreter="perl">$script $input > $out_file1 </command> - <inputs> - <param name="input" format="txt" type="data" label="Sequence file" help="fasta or raw sequence (one sequence per line)"/> - <param name="script" type="select" label="Select model"> - <option value="splicesitescore/score5.pl" selected="true">5' splice site</option> - <option value="splicesitescore/score3.pl">3' splice site</option> - </param> - </inputs> - <outputs> - <data format="tabular" name="out_file1" /> - </outputs> - <help> - -**What it does** - -This tool computes splice site scores using a max entropy model. See more details here: - -http://genes.mit.edu/burgelab/maxent/Xmaxentscan_scoreseq.html - ------ - -**Example input for 5' splice site sequence** - -3 exonic and 6 intronic nucleotides flanking the junction:: - - CTGGTGAGT - AAGGTACAG - -or fasta format:: - - >seq1 - CTGGTGAGT - >seq2 - AAGGTACAG - -Output:: - - CTGGTGAGT 10.10 - AAGGTACAG 8.04 - -or fasta format:: - - >seq1 CTGGTGAGT 10.10 - >seq2 AAGGTACAG 8.04 - - ------ - -**Example input for 3' splice site sequence** - -3 exonic and 20 intronic nucleotides flanking the junction:: - - CCTGCATCCTCTGTTCCCAGGTG - TTTCTTCCCTCCGGGAACAGTGG - -Output:: - - CCTGCATCCTCTGTTCCCAGGTG 10.47 - TTTCTTCCCTCCGGGAACAGTGG 6.22 - - </help> -</tool>