view tools/fastq/fastq_to_tabular.xml @ 0:9071e359b9a3

Uploaded

<tool id="fastq_to_tabular" name="FASTQ to Tabular" version="1.1.0">
  <description>converter</description>
  <command interpreter="python">fastq_to_tabular.py '$input_file' '$output_file' $descr_columns '${input_file.extension[len( 'fastq' ):]}'</command>
  <inputs>
    <param name="input_file" type="data" format="fastqsanger,fastqcssanger,fastqillumina,fastqsolexa" label="FASTQ file to convert" />
    <param name="descr_columns" type="integer" size="2" value="1" label="How many columns to divide title string into?" help="Typically 2 to take the ID (first word) and decription (rest) as two columns, or 1 to give a single column">
      <validator type="in_range" min="1" />
    </param>
  </inputs>
  <outputs>
    <data name="output_file" format="tabular" />
  </outputs>
  <tests>
    <!-- basic test -->
    <test>
      <param name="input_file" value="sanger_full_range_original_sanger.fastqsanger" ftype="fastqsanger" />
      <param name="descr_columns" value="1"/>
      <output name="output_file" file="fastq_to_tabular_out_1.tabular" />
    </test>
    <!-- color space test -->
    <test>
      <param name="input_file" value="sanger_full_range_as_cssanger.fastqcssanger" ftype="fastqcssanger" />
      <param name="descr_columns" value="1"/>
      <output name="output_file" file="fastq_to_tabular_out_2.tabular" />
    </test>
    <!-- split title into columns -->
    <test>
      <param name="input_file" value="sanger_full_range_original_sanger.fastqsanger" ftype="fastqsanger" />
      <param name="descr_columns" value="2"/>
      <output name="output_file" file="fastq_to_tabular_out_3.tabular" />
    </test>
  </tests>
  <help>

**What it does**

This tool converts FASTQ sequencing reads to a Tabular file.

It is conventional to take the first word of the FASTQ "@" title line as the identifier, and any remaining text to be a free form description.
It is therefore often useful to split this text into two columns in Galaxy (identifier and any description) by setting **How many columns to divide title string into?** to **2**.
In some cases the description can be usefully broken up into more columns -- see the examples .

Tab characters, if present in the source FASTQ title, will be converted to spaces.

-----	

**Example**

Consider the following two 454 reads in Sanger FASTQ format (using line wrapping for display, but do note not all tools will accept line wrapped FASTQ files)::

 @FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95]
 tcagTTAAGATGGGATAATATCCTCAGATTGCGTGATGAACTTTGTTCTGGTGGAGGAGAAGGAAGTGCATTCGACGTAT
 GCCCGTTTGTCGATATTTGtatttaaagtaatccgtcacaaatcagtgacataaatattatttagatttcgggagcaact
 ttatttattccacaagcaggtttaaattttaaatttaaattattgcagaagactttaaattaacctcgttgtcggagtca
 tttgttcggttattggtcgaaagtaaccncgggaagtgccgaaaactaacaaacaaaagaagatagtgaaattttaatta
 aaanaaatagccaaacgtaactaactaaaacggacccgtcgaggaactgccaacggacgacacagggagtagnnn
 +FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95]
 FFFDDDDDDDA666?688FFHGGIIIIIIIIIIIIIIIIIIHHHIIIIIIIIIGHGFFFFF====DFFFFFFFFFFFFFF
 D???:3104/76=:5...4.3,,,366////4&lt;ABBAAA=CCFDDDDDDDD:666CDFFFF=&lt;ABA=;:333111&lt;===9
 9;B889FFFFFFDDBDBDDD=8844231..,,,-,,,,,,,,1133..---17111,,,,,22555131121.--.,333
 11,.,,3--,,.,,--,3511123..--!,,,,--,----9,,,,8=,,-,,,-,,,,---26:9:5-..1,,,,11//,
 ,,,!,,1917--,,,,-3.,--,,17,,,,---+11113.030000,,,044400036;96662.//;7&gt;&lt;;!!!
 @FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74]
 tcagCCAGCAATTCCGACTTAATTGTTCTTCTTCCATCATTCATCTCGACTAACAGTTCTACGATTAATGAGTTTGGCtt
 taatttgttgttcattattgtcacaattacactactgagactgccaaggcacncagggataggnn
 +FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74]
 FFFFFFFFFDDDDFFFFGFDDDDBAAAAA=&lt;4444@@B=555:BBBBB@@?8:8&lt;?&lt;89898&lt;84442;==3,,,514,,
 ,11,,,.,,21777555513,..--1115758.//34488&gt;&lt;&lt;;;;;9944/!/4,,,57855!!

By default this is converted into a 3 column tabular file, with the full FASTQ title used as column 1:

=================================================================================================== ============== ==============
FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] tcagTTAA...nnn FFFDDDDD...!!!
FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74] tcagCCAG...gnn FFFFFFFF...5!!
=================================================================================================== ============== ==============

If you specified the title should be turned into 2 columns, you'd get 4 columns in total:

============== ==================================================================================== ============== ==============
FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] tcagTTAA...nnn FFFDDDDD...!!!
FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74] tcagCCAG...gnn FFFFFFFF...5!!
============== ==================================================================================== ============== ==============

Similarly, for this example treating the title string as 7 columns makes sense:

============== ============ ========== =========== ============= ============== =================== ============== ==============
FSRRS4401BE7HA [length=395] [gc=36.46] [flows=800] [phred_min=0] [phred_max=40] [trimmed_length=95] tcagTTAA...nnn FFFDDDDD...!!!
FSRRS4401BRRTC [length=145] [gc=38.62] [flows=800] [phred_min=0] [phred_max=38] [trimmed_length=74] tcagCCAG...gnn FFFFFFFF...5!!
============== ============ ========== =========== ============= ============== =================== ============== ==============

Note the sequences and quality strings have been truncated for display purposes in the above tables.

------

**Citation**

If you use this tool, please cite `Blankenberg D, Gordon A, Von Kuster G, Coraor N, Taylor J, Nekrutenko A; Galaxy Team. Manipulation of FASTQ data with Galaxy. Bioinformatics. 2010 Jul 15;26(14):1783-5. &lt;http://www.ncbi.nlm.nih.gov/pubmed/20562416&gt;`_


  </help>
</tool>