Mercurial > repos > xuebing > sharplabtool
view tools/metag_tools/fastqsolexa_to_fasta_qual.xml @ 0:9071e359b9a3
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:37:19 -0500 |
parents | |
children |
line wrap: on
line source
<tool id="fastqsolexa_to_fasta_qual" name="FASTQSOLEXA-to-FASTA-QUAL" version="1.0.0"> <description>extracts sequences and quality scores from FASTQSOLEXA data</description> <command interpreter="python">fastqsolexa_to_fasta_qual.py $input1 $output1 $output2 $input1.extension</command> <inputs> <param name="input1" type="data" format="fastqsolexa" label="Fastqsolexa file"/> </inputs> <outputs> <data name="output1" format="fasta"/> <data name="output2" format="qualsolexa"/> </outputs> <tests> <!-- NOTE: this tool generates 2 output files, but our functional tests currently only handle the last one generated --> <test> <param name="input1" value="1.fastqsolexa" ftype="fastqsolexa" /> <output name="output1" file="fastqsolexa_to_fasta_qual_out4.fasta" /> </test> <test> <param name="input1" value="2.fastqsolexa" ftype="fastqsolexa" /> <output name="output1" file="fastqsolexa_to_fasta_qual_out2.fasta" /> </test> </tests> <help> .. class:: warningmark IMPORTANT: This tool currently only supports data where the quality scores are integers or ASCII quality scores with base 64. ----- **What it does** This tool extracts sequences and quality scores from FASTQ data ( Solexa variant ), producing a FASTA dataset and a QUAL dataset. ----- **Example1** - Converting the following Solexa fastq data:: @seq1 GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT +seq1 hhhhhhhhhhhhhhhhhhhhhhhhhhPW@hhhhhh @seq2 GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG +seq2 hhhhhhhhhhhhhhYhhahhhhWhAhFhSIJGChO - will extract the following sequences:: >seq1 GACAGCTTGGTTTTTAGTGAGTTGTTCCTTTCTTT >seq2 GCAATGACGGCAGCAATAAACTCAACAGGTGCTGG - and quality scores:: >seq1 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 40 16 23 0 40 40 40 40 40 40 >seq2 40 40 40 40 40 40 40 40 40 40 40 40 40 40 25 40 40 33 40 40 40 40 23 40 1 40 6 40 19 9 10 7 3 40 15 **Example2** - Converting the following Solexa fastq data:: @HANNIBAL_1_FC302VTAAXX:2:1:228:167 GAATTGATCAGGACATAGGACAACTGTAGGCACCAT +HANNIBAL_1_FC302VTAAXX:2:1:228:167 40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4 @HANNIBAL_1_FC302VTAAXX:2:1:156:340 GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG +HANNIBAL_1_FC302VTAAXX:2:1:156:340 40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9 - will extract the following sequences:: >HANNIBAL_1_FC302VTAAXX:2:1:228:167 GAATTGATCAGGACATAGGACAACTGTAGGCACCAT >HANNIBAL_1_FC302VTAAXX:2:1:156:340 GAGTTCTCGTCGCCTGTAGGCACCATCAATCGTATG - and quality scores:: >HANNIBAL_1_FC302VTAAXX:2:1:228:167 40 40 40 40 35 40 40 40 25 40 40 26 40 9 33 11 40 35 17 40 40 33 40 7 9 15 3 22 15 30 11 17 9 4 9 4 >HANNIBAL_1_FC302VTAAXX:2:1:156:340 40 15 40 17 6 36 40 40 40 25 40 9 35 33 40 14 14 18 15 17 19 28 31 4 24 18 27 14 15 18 2 8 12 8 11 9 </help> </tool>