Mercurial > repos > xuebing > sharplabtool
view tools/metag_tools/shrimp_wrapper.xml @ 0:9071e359b9a3
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:37:19 -0500 |
parents | |
children |
line wrap: on
line source
<tool id="shrimp_wrapper" name="SHRiMP for Letter-space" version="1.0.0"> <description>reads mapping against reference sequence </description> <command interpreter="python"> #if ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $input_query #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="skip") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size #elif ($type_of_reads.single_or_paired=="single" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $input_query $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold #elif ($type_of_reads.single_or_paired=="paired" and $param.skip_or_full=="full") #shrimp_wrapper.py $input_target $output1 $output2 $type_of_reads.input1,$type_of_reads.input2,$type_of_reads.insertion_size $param.spaced_seed $param.seed_matches_per_window $param.seed_hit_taboo_length $param.seed_generation_taboo_length $param.seed_window_length $param.max_hits_per_read $param.max_read_length $param.kmer $param.sw_match_value $param.sw_mismatch_value $param.sw_gap_open_ref $param.sw_gap_open_query $param.sw_gap_ext_ref $param.sw_gap_ext_query $param.sw_hit_threshold #end if# </command> <inputs> <page> <conditional name="type_of_reads"> <param name="single_or_paired" type="select" label="Single- or Paired-ends"> <option value="single">Single-end</option> <option value="paired">Paired-end</option> </param> <when value="single"> <param name="input_query" type="data" format="fastqsolexa" label="Align sequencing reads" help="No dataset? Read tip below"/> </when> <when value="paired"> <param name="insertion_size" type="integer" size="5" value="600" label="Insertion length between two ends" help="bp" /> <param name="input1" type="data" format="fastqsolexa" label="Align sequencing reads, one end" /> <param name="input2" type="data" format="fastqsolexa" label="and the other end" /> </when> </conditional> <param name="input_target" type="data" format="fasta" label="against reference" /> <conditional name="param"> <param name="skip_or_full" type="select" label="SHRiMP settings to use" help="For most mapping needs use Commonly used settings. If you want full control use Full List"> <option value="skip">Commonly used</option> <option value="full">Full Parameter List</option> </param> <when value="skip" /> <when value="full"> <param name="spaced_seed" type="text" size="30" value="111111011111" label="Spaced Seed" /> <param name="seed_matches_per_window" type="integer" size="5" value="2" label="Seed Matches per Window" /> <param name="seed_hit_taboo_length" type="integer" size="5" value="4" label="Seed Hit Taboo Length" /> <param name="seed_generation_taboo_length" type="integer" size="5" value="0" label="Seed Generation Taboo Length" /> <param name="seed_window_length" type="float" size="10" value="115.0" label="Seed Window Length" help="in percentage"/> <param name="max_hits_per_read" type="integer" size="10" value="100" label="Maximum Hits per Read" /> <param name="max_read_length" type="integer" size="10" value="1000" label="Maximum Read Length" /> <param name="kmer" type="integer" size="10" value="-1" label="Kmer Std. Deviation Limit" help="-1 as None"/> <param name="sw_match_value" type="integer" size="10" value="100" label="S-W Match Value" /> <param name="sw_mismatch_value" type="integer" size="10" value="-150" label="S-W Mismatch Value" /> <param name="sw_gap_open_ref" type="integer" size="10" value="-400" label="S-W Gap Open Penalty (Reference)" /> <param name="sw_gap_open_query" type="integer" size="10" value="-400" label="S-W Gap Open Penalty (Query)" /> <param name="sw_gap_ext_ref" type="integer" size="10" value="-70" label="S-W Gap Extend Penalty (Reference)" /> <param name="sw_gap_ext_query" type="integer" size="10" value="-70" label="S-W Gap Extend Penalty (Query)" /> <param name="sw_hit_threshold" type="float" size="10" value="68.0" label="S-W Hit Threshold" help="in percentage"/> </when> </conditional> </page> </inputs> <outputs> <data name="output1" format="tabular"/> <data name="output2" format="tabular"/> </outputs> <requirements> <requirement type="binary">rmapper-ls</requirement> </requirements> <tests> <test> <param name="single_or_paired" value="single" /> <param name="skip_or_full" value="skip" /> <param name="input_target" value="shrimp_phix_anc.fa" ftype="fasta" /> <param name="input_query" value="shrimp_wrapper_test1.fastq" ftype="fastqsolexa"/> <output name="output1" file="shrimp_wrapper_test1.out1" /> </test> <!-- <test> <param name="single_or_paired" value="paired" /> <param name="skip_or_full" value="skip" /> <param name="input_target" value="shrimp_eca_chrMT.fa" ftype="fasta" /> <param name="input1" value="shrimp_wrapper_test2_end1.fastq" ftype="fastqsolexa" /> <param name="input2" value="shrimp_wrapper_test2_end2.fastq" ftype="fastqsolexa" /> <param name="insertion_size" value="600" /> <output name="output1" file="shrimp_wrapper_test2.out1" /> </test> <test> <param name="single_or_paired" value="single" /> <param name="skip_or_full" value="full" /> <param name="input_target" value="shrimp_phix_anc.fa" ftype="fasta" /> <param name="input_query" value="shrimp_wrapper_test1.fastq" ftype="fastqsolexa"/> <param name="spaced_seed" value="111111011111" /> <param name="seed_matches_per_window" value="2" /> <param name="seed_hit_taboo_length" value="4" /> <param name="seed_generation_taboo_length" value="0" /> <param name="seed_window_length" value="115.0" /> <param name="max_hits_per_read" value="100" /> <param name="max_read_length" value="1000" /> <param name="kmer" value="-1" /> <param name="sw_match_value" value="100" /> <param name="sw_mismatch_value" value="-150" /> <param name="sw_gap_open_ref" value="-400" /> <param name="sw_gap_open_query" value="-400" /> <param name="sw_gap_ext_ref" value="-70" /> <param name="sw_gap_ext_query" value="-70" /> <param name="sw_hit_threshold" value="68.0" /> <output name="output1" file="shrimp_wrapper_test1.out1" /> </test> <test> <param name="single_or_paired" value="paired" /> <param name="skip_or_full" value="full" /> <param name="input_target" value="shrimp_eca_chrMT.fa" ftype="fasta" /> <param name="spaced_seed" value="111111011111" /> <param name="seed_matches_per_window" value="2" /> <param name="seed_hit_taboo_length" value="4" /> <param name="seed_generation_taboo_length" value="0" /> <param name="seed_window_length" value="115.0" /> <param name="max_hits_per_read" value="100" /> <param name="max_read_length" value="1000" /> <param name="kmer" value="-1" /> <param name="sw_match_value" value="100" /> <param name="sw_mismatch_value" value="-150" /> <param name="sw_gap_open_ref" value="-400" /> <param name="sw_gap_open_query" value="-400" /> <param name="sw_gap_ext_ref" value="-70" /> <param name="sw_gap_ext_query" value="-70" /> <param name="sw_hit_threshold" value="68.0" /> <param name="input1" value="shrimp_wrapper_test2_end1.fastq" ftype="fastqsolexa"/> <param name="input2" value="shrimp_wrapper_test2_end2.fastq" ftype="fastqsolexa"/> <param name="insertion_size" value="600" /> <output name="output1" file="shrimp_wrapper_test2.out1" /> </test> --> </tests> <help> .. class:: warningmark IMPORTANT: This tool currently only supports data where the quality scores are integers or ASCII quality scores with base 64. Click pencil icon next to your dataset to set datatype to *fastqsolexa*. ----- **What it does** SHRiMP (SHort Read Mapping Package) is a software package for aligning genomic reads against a target genome. This wrapper post-processes the default SHRiMP/rmapper-ls output and generates a table with all information from reads and reference for the mapping. The tool takes single- or paired-end reads. For single-end reads, only uniquely mapped alignment is considered. In paired-end reads, only pairs that meet the following criteria will be used to generate the table: 1). the ends fall within the insertion size; 2). the ends are mapped at the opposite directions. If there are still multiple mappings after applying the criteria, this paired-end read will be discarded. ----- **Input formats** A multiple-fastq file, for example:: @seq1 TACCCGATTTTTTGCTTTCCACTTTATCCTACCCTT +seq1 hhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhhh ----- **Outputs** The tool gives two outputs. **Table output** Table output contains 8 columns:: 1 2 3 4 5 6 7 8 ---------------------------------------------------- chrM 14711 seq1 0 T A 40 1 chrM 14712 seq1 1 T T 40 1 where:: 1. (chrM) - Reference sequence id 2. (14711) - Position of the mapping in the reference 3. (seq1) - Read id 4. (0) - Position of the mapping in the read 5. (T) - Nucleotide in the reference 6. (A) - Nucleotide in the read 7. (40) - Quality score for the nucleotide in the position of the read 8. (1) - The number of times this position is covered by reads **SHRiMP output** This is the default output from SHRiMP/rmapper-ls:: 1 2 3 4 5 6 7 8 9 10 ------------------------------------------------------------------- seq1 chrM + 3644 3679 1 36 36 3600 36 where:: 1. (seq1) - Read id 2. (chrM) - Reference sequence id 3. (+) - Strand of the read 4. (3466) - Start position of the alignment in the reference 5. (3679) - End position of the alignment in the reference 6. (1) - Start position of the alignment in the read 7. (36) - End position of the alignment in the read 8. (36) - Length of the read 9. (3600) - Score 10. (36) - Edit string ----- **SHRiMP parameter list** The commonly used parameters with default value setting:: -s Spaced Seed (default: 111111011111) The spaced seed is a single contiguous string of 0's and 1's. 0's represent wildcards, or positions which will always be considered as matching, whereas 1's dictate positions that must match. A string of all 1's will result in a simple kmer scan. -n Seed Matches per Window (default: 2) The number of seed matches per window dictates how many seeds must match within some window length of the genome before that region is considered for Smith-Waterman alignment. A lower value will increase sensitivity while drastically increasing running time. Higher values will have the opposite effect. -t Seed Hit Taboo Length (default: 4) The seed taboo length specifies how many target genome bases or colors must exist prior to a previous seed match in order to count another seed match as a hit. -9 Seed Generation Taboo Length (default: 0) -w Seed Window Length (default: 115.00%) This parameter specifies the genomic span in bases (or colours) in which *seed_matches_per_window* must exist before the read is given consideration by the Simth-Waterman alignment machinery. -o Maximum Hits per Read (default: 100) This parameter specifies how many hits to remember for each read. If more hits are encountered, ones with lower scores are dropped to make room. -r Maximum Read Length (default: 1000) This parameter specifies the maximum length of reads that will be encountered in the dataset. If larger reads than the default are used, an appropriate value must be passed to *rmapper*. -d Kmer Std. Deviation Limit (default: -1 [None]) This option permits pruning read kmers, which occur with frequencies greater than *kmer_std_dev_limit* standard deviations above the average. This can shorten running time at the cost of some sensitivity. *Note*: A negative value disables this option. -m S-W Match Value (default: 100) The value applied to matches during the Smith-Waterman score calculation. -i S-W Mismatch Value (default: -150) The value applied to mismatches during the Smith-Waterman score calculation. -g S-W Gap Open Penalty (Reference) (default: -400) The value applied to gap opens along the reference sequence during the Smith-Waterman score calculation. *Note*: Note that for backward compatibility, if -g is set and -q is not set, the gap open penalty for the query will be set to the same value as specified for the reference. -q S-W Gap Open Penalty (Query) (default: -400) The value applied to gap opens along the query sequence during the Smith-Waterman score calculation. -e S-W Gap Extend Penalty (Reference) (default: -70) The value applied to gap extends during the Smith-Waterman score calculation. *Note*: Note that for backward compatibility, if -e is set and -f is not set, the gap exten penalty for the query will be set to the same value as specified for the reference. -f S-W Gap Extend Penalty (Query) (default: -70) The value applied to gap extends during the Smith-Waterman score calculation. -h S-W Hit Threshold (default: 68.00%) In letter-space, this parameter determines the threshold score for both vectored and full Smith-Waterman alignments. Any values less than this quantity will be thrown away. *Note* This option differs slightly in meaning between letter-space and color-space. ----- **Reference** **SHRiMP**: Stephen M. Rumble, Michael Brudno, Phil Lacroute, Vladimir Yanovsky, Marc Fiume, Adrian Dalca. shrimp at cs dot toronto dot edu. </help> </tool>