view tools/metag_tools/blat_coverage_report.xml @ 1:cdcb0ce84a1b

Uploaded

<tool id="generate_coverage_report" name="Polymorphism of the Reads">
	<description>the percentage of reads supporting each nucleotide at each location</description>
	<command interpreter="python">blat_coverage_report.py $input1 $output1</command>
	<inputs>	
		<param name="input1" type="data" format="tabular" label="Alignment result"/>
	</inputs>
	<outputs>
		<data name="output1" format="tabular"/>
	</outputs> 
	<tests>
		<test>
		<param name="input1" value="blat_coverage_report_test1.txt" ftype="tabular" />
		<output name="output1" file="blat_coverage_report_test1.out" />
		</test>
	</tests>
	<help>

.. class:: warningmark

**IMPORTANT**. Only works for BLAT **standard** or **pslx** output formats (hint: to output pslx format, add **-out=pslx** in the command).

-----
	
**What it does**
 
 The tool will generate a table of 6 columns as following:
 
- 1st column: chromosome id.

- 2nd column: chromosome location.

- 3rd column: the nucleotide from reference genome at the chromosome location (2nd column).

- 4th column: total coverage of the reads (number of reads that were mapped to the chromosome location).

- 5th column: percentage of reads that support nucleotide **A** at this location.

- 6th column: percentage of reads that support nucleotide **T** at this location.

- 7th column: percentage of reads that support nucleotide **C** at this location.

- 8th column: percentage of reads that support nucleotide **G** at this location.
 
 
-----

**Example**

- The BLAT pslx results look like the following (tab separated with sequence at the end)::

	30	0	0	0	0	0	0	0	+	seq0	30	0	30	chr	4639675	4549207	4549237	1	30,	0,	4549207,	cggacagcgccgccaccaacaaagccacca,	cggacagcgccgccaccaacaaagccacca,
	30	0	0	0	0	0	0	0	+	seq1	30	0	30	chr	4639675	614777	614807	1	30,	0,	614777,		aaaacaccggatgctccggcgctggcagat,	aaaacaccggatgctccggcgctggcagat,
	28	1	0	0	0	0	0	0	+	seq2	30	0	29	chr	4639675	3289283	3289312	1	29,	0,	3289283,	tttgcttttagtacaccggattcagaacc,	tttgctttcagtacaccggattcagaacc,
	30	0	0	0	0	0	0	0	+	seq4	30	0	30	chr	4639675	2665584	2665614	1	30,	0,	2665584,	cacgctacgtgcgcccccgcccagaaggcg,	cacgctacgtgcgcccccgcccagaaggcg,

	The 14th column is the chromosome id, and the 16th and 17th columns shows the reads were mapped to chromosome start and end locations.	

- The report showed overall coverage of reads on each chromosome location (partial result)::
 
   +-------+----------+------+------+--------+------+--------+------+
   | title | location | ref. | cov. |   A    |  T   |   C    |  G   |
   +-------+----------+------+------+--------+------+--------+------+	
   |   chr |   614777 |	 A   |  1   | A(100) | T(0) |	C(0) | G(0) |
   |   chr |   614778 |  A   |	1   | A(100) | T(0) |   C(0) | G(0) |
   |   chr |   614779 |  A   |  1   | A(100) | T(0) |   C(0) | G(0) |
   +-------+----------+------+------+--------+------+--------+------+	
	
-----

**Reference**
 
 **BLAT**: Kent, W James, BLAT--the BLAST-like alignment tool. (2002) Genome Research:12(4) 656-664.
	
	</help>
</tool>