Mercurial > repos > xuebing > sharplabtool
view tools/metag_tools/convert_SOLiD_color2nuc.py @ 1:cdcb0ce84a1b
Uploaded
author | xuebing |
---|---|
date | Fri, 09 Mar 2012 19:45:15 -0500 |
parents | 9071e359b9a3 |
children |
line wrap: on
line source
#!/usr/bin/env python """ convert SOLiD calor-base data to nucleotide sequence example: T011213122200221123032111221021210131332222101 TTGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT """ import sys, os def stop_err(msg): sys.stderr.write(msg) sys.stderr.write('\n') sys.exit() def color2base(color_seq): first_nuc = ['A','C','G','T'] code_matrix = {} code_matrix['0'] = ['A','C','G','T'] code_matrix['1'] = ['C','A','T','G'] code_matrix['2'] = ['G','T','A','C'] code_matrix['3'] = ['T','G','C','A'] overlap_nuc = '' nuc_seq = '' seq_prefix = prefix = color_seq[0].upper() color_seq = color_seq[1:] if not (seq_prefix in first_nuc): stop_err('The leading nucleotide is invalid. Must be one of the four nucleotides: A, T, C, G.\nThe file contains a %s' %seq_prefix ) for code in color_seq: if not (code in ['0','1','2','3']): stop_err('Expect digits (0, 1, 2, 3) in the color-cading data. File contains numbers other than the set.\nThe file contains a %s' %code) second_nuc = code_matrix[code] overlap_nuc = second_nuc[first_nuc.index(prefix)] nuc_seq += overlap_nuc prefix = overlap_nuc return seq_prefix, nuc_seq def __main__(): infilename = sys.argv[1] keep_prefix = sys.argv[2].lower() outfilename = sys.argv[3] outfile = open(outfilename,'w') prefix = '' color_seq = '' for i, line in enumerate(file(infilename)): line = line.rstrip('\r\n') if not line: continue if line.startswith("#"): continue if line.startswith(">"): if color_seq: prefix, nuc_seq = color2base(color_seq) if keep_prefix == 'yes': nuc_seq = prefix + nuc_seq outfile.write(title+'\n') outfile.write(nuc_seq+'\n') title = line color_seq = '' else: color_seq += line if color_seq: prefix, nuc_seq = color2base(color_seq) if keep_prefix == 'yes': nuc_seq = prefix + nuc_seq outfile.write(title+'\n') outfile.write(nuc_seq+'\n') outfile.close() if __name__=='__main__': __main__()