changeset 4:e35a3509c160 draft

planemo upload commit 3675b4447d11fb1cd75d505886e1bf693f9d07f5

--- a/rename.py	Thu Jul 26 13:02:23 2018 -0400
+++ b/rename.py	Thu Jul 26 15:46:24 2018 -0400
@@ -1,6 +1,6 @@
 """
 Call rename to rename scaffolds in reference genome so that the sequence names are less than 31 characters. Rename all scaffolds to scaffold_1, scaffold_2, ..., scaffold_N and provide a name mapping file
-Call truncate to truncate the scaffold names that are more than 31 characters. Replace non-ASCII character with '_'
+Call truncate to truncate the scaffold names that are more than 31 characters. Replace each invalid character (non-ASCII, '\t', '\n', '\x0b', '\x0c', '\r') with '_'
 """
 import sys
 import csv
@@ -21,7 +21,7 @@
                     writer.writerow([oldname.encode('utf-8'), newname])
                 out.write(line)
 
-def truncate(inputFile, outputFile):
+def truncate(inputFile, outputFile, valid_characters):
     names = []
     with codecs.open(outputFile, 'w', encoding='utf-8') as out:
         with codecs.open(inputFile, 'r', encoding='utf-8') as rf:
@@ -30,7 +30,7 @@
                 if ">" in l:
                     print l.encode('utf-8')
                     name = l[1:].rstrip()
-                    name = substituteNonAscii(name)
+                    name = substituteNonAscii(name, valid_characters)
                     if len(name) > 31:
                         name = name[:31]
                         print "\tTruncate the scaffold name to less than 31 characters: %s" % name
@@ -41,11 +41,11 @@
                     print "======================\n"
                 out.write(l)
 
-def substituteNonAscii(str):
+def substituteNonAscii(str, valid_charaters):
     l = []
     for c in str:
-        if c not in string.printable:
-            print "\tSubstitute Non-ASCII character %s with _" % c.encode('utf-8')
+        if c not in valid_charaters:
+            print "\tSubstitute invalid character %s with _" % c.encode('utf-8')
             c = '_'
         l.append(c)
     return "".join(l)
@@ -54,13 +54,14 @@
     inputfile = str(sys.argv[1])
     manipulate = str(sys.argv[2])
     outputfile = str(sys.argv[3])
+    valid_characters = string.letters + string.punctuation + string.digits + ' '
     if manipulate == "rename":
         indexfile = str(sys.argv[4])
         csvfile = open(indexfile, 'w')
         writer = csv.writer(csvfile)
         rename(inputfile, outputfile, writer)
     elif manipulate == "truncate":
-        truncate(inputfile, outputfile)
+        truncate(inputfile, outputfile, valid_characters)
 
 if __name__ == "__main__":
     main()

--- a/rename_scaffold.xml	Thu Jul 26 13:02:23 2018 -0400
+++ b/rename_scaffold.xml	Thu Jul 26 15:46:24 2018 -0400
@@ -1,4 +1,4 @@
-<tool id="rename_scaffold" name="rename the scaffolds" version="2.0">
+<tool id="rename_scaffold" name="rename the scaffolds" version="2.1">
     <description>a Galaxy tool to rename or truncate the scaffold names in the reference genome so that they won't exceed 31 characters</description>
 <stdio>
     <exit_code range="1:" />
@@ -55,11 +55,17 @@
         <param name="input" value="sequence_with_noascii_name_conflict.fa" />
         <param name="manipulate_selector" value="truncate" />
     </test>
+    <test>
+        <!-- Test input with tab -->
+        <param name="input" value="sequence_with_tab.fa" />
+        <param name="manipulate_selector" value="truncate" />
+        <output name="output" file="fixed_reference_with_tab.fasta" />
+    </test>
 </tests>
 <help><![CDATA[
 This tool is to rename scaffolds in the reference genome so that the sequence names are less than 31 characters. Rename all scaffolds to scaffold_1, scaffold_2, ..., scaffold_N and also output a name mapping file.
 
-Or truncate the scaffold names that are more than 31 characters and replace each non-ASCII character with '_'
+Or truncate the scaffold names that are more than 31 characters and replace each invalid character (non-ASCII, '\\t', '\\n', '\\x0b', '\\x0c', '\\r') with '_'
 ]]></help>
 <citations>
 </citations>

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fixed_reference_with_tab.fasta	Thu Jul 26 15:46:24 2018 -0400
@@ -0,0 +1,12 @@
+>contig1'abcd__* _ {/&
+AAAACTAATTTTATCAAAATCGGACAACTATATCATATAGCTGCCATACG
+AACGATCGGAAAATTGGTAAGTAAATAATTAAAAATATTATATCTTTGGT
+>contig2_| 757_763.ii215_ii225St
+AAAACTAATTTTATCAAAATCGGACAACTATATCATATAGCTGCCATACG
+AACGATCGGAAAATTGGTAAGTAAATAATTAAAAATATTATATCTTTGGT
+>contig3 | prediction on sequenc
+AAAACTAATTTTATCAAAATCGGACAACTATATCATATAGCTGCCATACG
+AACGATCGGAAAATTGGTAAGTAAATAATTAAAAATATTATATCTTTGGT
+>contig4 | 757_763.ii215_ii225St
+AAAACTAATTTTATCAAAATCGGACAACTATATCATATAGCTGCCATACG
+AACGATCGGAAAATTGGTAAGTAAATAATTAAAAATATTATATCTTTGGT

--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/sequence_with_tab.fa	Thu Jul 26 15:46:24 2018 -0400
@@ -0,0 +1,12 @@
+>contig1'abcdé	* _ {/&
+AAAACTAATTTTATCAAAATCGGACAACTATATCATATAGCTGCCATACG
+AACGATCGGAAAATTGGTAAGTAAATAATTAAAAATATTATATCTTTGGT
+>contig2	| 757â763.ii215âii225Stanke, M. and Waack
+AAAACTAATTTTATCAAAATCGGACAACTATATCATATAGCTGCCATACG
+AACGATCGGAAAATTGGTAAGTAAATAATTAAAAATATTATATCTTTGGT
+>contig3 | prediction on sequence number 1 (length = 1992969, name = scaffold1|size1992969) ----- # # Constraints/Hints: # (none) # Predicted genes for sequence number 1 on both strands # start gene g1 scaffold1|size1992969 AUGUSTUS gene 17453 19382 0.11 + . g6 scaffold1|size1992969 AUGUSTUS transcript 17453 19382 0.11 + . g6.t1 scaffold1|size1992969 AUGUSTUS start_codon 17453 17455
+AAAACTAATTTTATCAAAATCGGACAACTATATCATATAGCTGCCATACG
+AACGATCGGAAAATTGGTAAGTAAATAATTAAAAATATTATATCTTTGGT
+>contig4 | 757£763.ii215ôii225Stanke, M. and Waack
+AAAACTAATTTTATCAAAATCGGACAACTATATCATATAGCTGCCATACG
+AACGATCGGAAAATTGGTAAGTAAATAATTAAAAATATTATATCTTTGGT