Mercurial > repos > yufei-luo > s_mart
comparison SMART/Java/Python/structure/test/Test_Sequence.py @ 6:769e306b7933
Change the repository level.
author | yufei-luo |
---|---|
date | Fri, 18 Jan 2013 04:54:14 -0500 |
parents | |
children |
comparison
equal
deleted
inserted
replaced
5:ea3082881bf8 | 6:769e306b7933 |
---|---|
1 # Copyright INRA (Institut National de la Recherche Agronomique) | |
2 # http://www.inra.fr | |
3 # http://urgi.versailles.inra.fr | |
4 # | |
5 # This software is governed by the CeCILL license under French law and | |
6 # abiding by the rules of distribution of free software. You can use, | |
7 # modify and/ or redistribute the software under the terms of the CeCILL | |
8 # license as circulated by CEA, CNRS and INRIA at the following URL | |
9 # "http://www.cecill.info". | |
10 # | |
11 # As a counterpart to the access to the source code and rights to copy, | |
12 # modify and redistribute granted by the license, users are provided only | |
13 # with a limited warranty and the software's author, the holder of the | |
14 # economic rights, and the successive licensors have only limited | |
15 # liability. | |
16 # | |
17 # In this respect, the user's attention is drawn to the risks associated | |
18 # with loading, using, modifying and/or developing or reproducing the | |
19 # software by the user in light of its specific status of free software, | |
20 # that may mean that it is complicated to manipulate, and that also | |
21 # therefore means that it is reserved for developers and experienced | |
22 # professionals having in-depth computer knowledge. Users are therefore | |
23 # encouraged to load and test the software's suitability as regards their | |
24 # requirements in conditions enabling the security of their systems and/or | |
25 # data to be ensured and, more generally, to use and operate it in the | |
26 # same conditions as regards security. | |
27 # | |
28 # The fact that you are presently reading this means that you have had | |
29 # knowledge of the CeCILL license and that you accept its terms. | |
30 | |
31 | |
32 import unittest | |
33 from SMART.Java.Python.structure.Sequence import Sequence | |
34 | |
35 | |
36 class Test_Sequence(unittest.TestCase): | |
37 | |
38 def setUp(self): | |
39 self._bs = Sequence() | |
40 self._bs1 = Sequence() | |
41 | |
42 def test_getSize(self): | |
43 self._bs.setName("sequence1") | |
44 self._bs.setSequence("AGCGGACGATGCAGCATGCGAATGACGATA") | |
45 obsSize = self._bs.getSize() | |
46 expSize = 30 | |
47 self.assertEquals( expSize, obsSize ) | |
48 | |
49 def test_concatenate(self): | |
50 self._bs.setName("sequence") | |
51 self._bs.setSequence("GATGTGCAGACTTTTCACGCAGGACTACATCACTGT") | |
52 self._bs.setQuality("WWWVVVWPWWWVWWWWVVVVKVPWWVVWVWUUQUTQ") | |
53 self._bs1.setName("sequence1") | |
54 self._bs1.setSequence("GGAAACATATGCACATAAACGTTGAAATCATGCTTA") | |
55 self._bs1.setQuality("WWWWWWWWWWWWWWWWWVWWVWWVWWWWWWUUUUUU") | |
56 self._bs.concatenate(self._bs1) | |
57 expSeq = "GATGTGCAGACTTTTCACGCAGGACTACATCACTGTGGAAACATATGCACATAAACGTTGAAATCATGCTTA" | |
58 expQal = "WWWVVVWPWWWVWWWWVVVVKVPWWVVWVWUUQUTQWWWWWWWWWWWWWWWWWVWWVWWVWWWWWWUUUUUU" | |
59 self.assertEquals(expSeq, self._bs.getSequence()) | |
60 self.assertEquals(expQal, self._bs.getQuality()) | |
61 | |
62 def test_reverseComplement(self): | |
63 self._bs.setName("seq1") | |
64 self._bs.setSequence("TACGGC") | |
65 exp = "GCCGTA" | |
66 self._bs.reverseComplement() | |
67 obs = self._bs.getSequence() | |
68 self.assertEquals(exp, obs) | |
69 | |
70 def test_containsAmbiguousNucleotides(self): | |
71 self._bs.setName("seq1") | |
72 self._bs.setSequence("WCGTUacgtu") | |
73 self.assertTrue (self._bs.containsAmbiguousNucleotides()) | |
74 | |
75 def test_shrinkToFirstNucleotides(self): | |
76 self._bs.setName("seq1") | |
77 self._bs.setSequence("WCGTUacgtu") | |
78 self._bs.shrinkToFirstNucleotides(3) | |
79 expSeq = "WCG" | |
80 self.assertEquals(expSeq, self._bs.getSequence()) | |
81 | |
82 def test_shrinkToLastNucleotides(self): | |
83 self._bs.setName("seq1") | |
84 self._bs.setSequence("WCGTUacgtu") | |
85 self._bs.shrinkToLastNucleotides(5) | |
86 expSeq = "acgtu" | |
87 self.assertEquals(expSeq, self._bs.getSequence()) | |
88 | |
89 if __name__ == "__main__": | |
90 unittest.main() |