IMPORTANT. Only works for BLAT standard or pslx output formats (hint: to output pslx format, add -out=pslx in the command).
What it does
The tool will generate a table of 6 columns as following:
Example
The BLAT pslx results look like the following (tab separated with sequence at the end):
30 0 0 0 0 0 0 0 + seq0 30 0 30 chr 4639675 4549207 4549237 1 30, 0, 4549207, cggacagcgccgccaccaacaaagccacca, cggacagcgccgccaccaacaaagccacca, 30 0 0 0 0 0 0 0 + seq1 30 0 30 chr 4639675 614777 614807 1 30, 0, 614777, aaaacaccggatgctccggcgctggcagat, aaaacaccggatgctccggcgctggcagat, 28 1 0 0 0 0 0 0 + seq2 30 0 29 chr 4639675 3289283 3289312 1 29, 0, 3289283, tttgcttttagtacaccggattcagaacc, tttgctttcagtacaccggattcagaacc, 30 0 0 0 0 0 0 0 + seq4 30 0 30 chr 4639675 2665584 2665614 1 30, 0, 2665584, cacgctacgtgcgcccccgcccagaaggcg, cacgctacgtgcgcccccgcccagaaggcg, The 14th column is the chromosome id, and the 16th and 17th columns shows the reads were mapped to chromosome start and end locations.
The report showed overall coverage of reads on each chromosome location (partial result):
+-------+----------+------+------+--------+------+--------+------+ | title | location | ref. | cov. | A | T | C | G | +-------+----------+------+------+--------+------+--------+------+ | chr | 614777 | A | 1 | A(100) | T(0) | C(0) | G(0) | | chr | 614778 | A | 1 | A(100) | T(0) | C(0) | G(0) | | chr | 614779 | A | 1 | A(100) | T(0) | C(0) | G(0) | +-------+----------+------+------+--------+------+--------+------+
Reference
BLAT: Kent, W James, BLAT--the BLAST-like alignment tool. (2002) Genome Research:12(4) 656-664.