What it does
GlimmerHMM is a new gene finder based on a Generalized Hidden Markov Model (GHMM). Although the gene finder conforms to the overall mathematical framework of a GHMM, additionally it incorporates splice site models adapted from the GeneSplicer program and a decision tree adapted from GlimmerM. It also utilizes Interpolated Markov Models for the coding and noncoding models . Currently, GlimmerHMM's GHMM structure includes introns of each phase, intergenic regions, and four types of exons (initial, internal, final, and single). A basic user manual can be consulted here.
Example
Suppose you have the following DNA formatted sequences:
>SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other; cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctggRunning this tool will produce this:
ConsensusfromCH236920mapping GlimmerHMM mRNA 1 122 . + . ID=ConsensusfromCH236920mapping.path1.gene1;Name=ConsensusfromCH236920mapping.path1.gene1 ConsensusfromCH236920mapping GlimmerHMM CDS 1 122 . + 0 ID=ConsensusfromCH236920mapping.cds1.1; ConsensusfromCH236920mapping GlimmerHMM mRNA 14066 15205 . - . ID=ConsensusfromCH236920mapping.path1.gene2;Name=ConsensusfromCH236920mapping.path1.gene2 ConsensusfromCH236920mapping GlimmerHMM CDS 14066 15034 . - 0 ID=ConsensusfromCH236920mapping.cds2.1; ConsensusfromCH236920mapping GlimmerHMM CDS 15137 15205 . - 0 ID=ConsensusfromCH236920mapping.cds2.2; ConsensusfromCH236920mapping GlimmerHMM mRNA 19910 24210 . - . ID=ConsensusfromCH236920mapping.path1.gene3;Name=ConsensusfromCH236920mapping.path1.gene3