What it does
This tool renames the sequence identifiers in a FASTQ/A file.
Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc).
Example
The following Solexa-FASTQ file:
@CSHL_4_FC042GAMMII_2_1_517_596 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +CSHL_4_FC042GAMMII_2_1_517_596 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
Renamed to nucleotides sequence:
@GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40
Renamed to numeric counter:
@1 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +1 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40