What it does

This tool renames the sequence identifiers in a FASTQ/A file.

Use this tool at the beginning of your workflow, as a way to keep the original sequence (before trimming, clipping, barcode-removal, etc).

Example

The following Solexa-FASTQ file:

@CSHL_4_FC042GAMMII_2_1_517_596
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+CSHL_4_FC042GAMMII_2_1_517_596
40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40

Renamed to nucleotides sequence:

@GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40

Renamed to numeric counter:

@1
GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT
+1
40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40

This tool is based on FASTX-toolkit by Assaf Gordon.