What it does

GlimmerHMM is a new gene finder based on a Generalized Hidden Markov Model (GHMM). Although the gene finder conforms to the overall mathematical framework of a GHMM, additionally it incorporates splice site models adapted from the GeneSplicer program and a decision tree adapted from GlimmerM. It also utilizes Interpolated Markov Models for the coding and noncoding models . Currently, GlimmerHMM's GHMM structure includes introns of each phase, intergenic regions, and four types of exons (initial, internal, final, and single). A basic user manual can be consulted here.

Example

Suppose you have the following DNA formatted sequences:

>SQ   Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg

Running this tool will produce this:

ConsensusfromCH236920mapping  GlimmerHMM  mRNA  1       122     .   +   .   ID=ConsensusfromCH236920mapping.path1.gene1;Name=ConsensusfromCH236920mapping.path1.gene1
ConsensusfromCH236920mapping  GlimmerHMM  CDS   1       122     .   +   0   ID=ConsensusfromCH236920mapping.cds1.1;
ConsensusfromCH236920mapping  GlimmerHMM  mRNA  14066   15205   .   -   .   ID=ConsensusfromCH236920mapping.path1.gene2;Name=ConsensusfromCH236920mapping.path1.gene2
ConsensusfromCH236920mapping  GlimmerHMM  CDS   14066   15034   .   -   0   ID=ConsensusfromCH236920mapping.cds2.1;
ConsensusfromCH236920mapping  GlimmerHMM  CDS   15137   15205   .   -   0   ID=ConsensusfromCH236920mapping.cds2.2;
ConsensusfromCH236920mapping  GlimmerHMM  mRNA  19910   24210   .   -   .   ID=ConsensusfromCH236920mapping.path1.gene3;Name=ConsensusfromCH236920mapping.path1.gene3