For each VCF record, extract the flanking sequences, and write them as FASTA records suitable for alignment. This tool is intended for use in designing validation experiments. Primers extracted which would flank all of the alleles at multi-allelic sites. The name of the FASTA "reads" indicates the VCF record which they apply to. The form is >CHROM_POS_LEFT for the 3' primer and >CHROM_POS_RIGHT for the 5' primer, for example:

>20_233255_LEFT
CCATTGTATATATAGACCATAATTTCTTTATCCAATCATCTGTTGATGGA
>20_233255_RIGHT
ACTCAGTTGATTCCATACCTTTGCCATCATGAATCATGTTGTAATAAACA

Vcfprimers is a part of VCFlib toolkit developed by Erik Garrison (https://github.com/ekg/vcflib).