MLocARNA -- Multiple alignment of RNAs

MLocARNA is the (general, progressive) multiple RNA alignment tool of the LocARNA suite. It supports several alignment modes and can be adapted to specific needs by a broad range of parameters. Thus, there are parameters for

• scoring of the alignment, e.g. influencing the cost of insertions/deletions and the weight of sequence vs. structure similarity.
• RNA folding, which control the secondary RNA structure prediciton.
• heuristics, which trade alignment accuracy vs. computation speed. The huge complexity of simultaneous alignment and folding generally requires some heuristics for reasonable computation times. Some alignment instances and alignment modes will require relaxation of the default heuristics; in particular, local, constrained, and free end gap alignment, will often require turning off the "maximal difference for alignment traces" heuristic.
• constraints, which can be applied to include prior knowledge to improve the quality of results and/or speed of computation.

Technically, mlocarna constructs multiple alignments progressively based on pairwise alignments by locarna, locarna-p, or sparse, which perform variants of simultaneous RNA folding and alignment.

Input. Sequences can be given in plain fasta format like:

>fruA
CCUCGAGGGGAACCCGAAAGGGACCCGAGAGG
>fdhA
CGCCACCCUGCGAACCCAAUAUAAAAUAAUACAAGGGAGCAGGUGGCG
>vhuU
AGCUCACAACCGAACCCAUUUGGGAGGUUGUGAGCU

Morover, mlocarna supports structure constraints for folding and anchor constraints for alignment. Both types of constraints can be specified in extension of the standard fasta format via 'constraint lines'. Fasta-ish input with constraints looks like this:

>A
GACCCUGGGAACAUUAACUACUCUCGUUGGUGAUAAGGAACA
..((.(....xxxxxx...................))).xxx #S
..........000000.......................111 #1
..........123456.......................123 #2
>B
ACGGAGGGAAAGCAAGCCUUCUGCGACA
.(((....xxxxxx.......))).xxx #S
........000000...........111 #1
........123456...........123 #2

The same anchor constraints (like by the lines tagged #1, #2) can alternatively be specified in bed format by the entries:

A     10      16      first_box
B     8       14      first_box
A     39      42      ACA-box
B     25      28      ACA-box

where anchor regions (boxes) have arbitrary but matching names and contig/sequence names correspond to the sequence names of the fasta(-like) input.

Output.

The final alignment is reported in standard and/or variants of the clustal and stockholm format. Moreover, an archive with final and intermediary results of the mlocarna run can be returned.

For more information, see .. __: http://www.bioinf.uni-freiburg.de/Software/LocARNA/