What it does

This tool predicts open reading frames (ORFs) from a given DNA Sequence. That tool is not knowlegde-based.

The recommended way is to use a trained Glimmer3 with ICM model. Use the knowlegde-based version for that and insert/generate a training set.

Glimmer Overview

**************          **************          **************          **************
*            *          *            *          *            *          *            *
* long-orfs  *  ===>    *   Extract  *  ===>    * build-icm  *  ===>    *  glimmer3  *
*            *          *            *          *            *          *            *
**************          **************          **************          **************

Example

Suppose you have the following DNA sequences:

>SQ   Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg
ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag
cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc
cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc
ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg
.......

Running this tool will produce a FASTA file with predicted genes and glimmer output files like the following:

>SQ   Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other;
orf00001      577      699  +1     5.24
orf00003      800     1123  +2     5.18
orf00004     1144     3813  +1    10.62
orf00006     3857     6220  +2     6.07
orf00007     6226     7173  +1     1.69
orf00008     7187     9307  +2     8.95
orf00009     9424    10410  +1     8.29
orf00010    10515    11363  +3     7.00
orf00011    11812    11964  +1     2.80
orf00012    12360    13457  +3     4.80
orf00013    14379    14044  -1     7.41
orf00015    15029    14739  -3    12.43
orf00016    15066    15227  +3     1.91
orf00020    16061    15351  -3     2.83
orf00021    17513    17391  -3     2.20
orf00023    17529    17675  +3     0.11