needle reads any two sequences of the same type (DNA or protein).
Syntax
This tool uses the Needleman-Wunsch global alignment algorithm to find the optimum alignment (including gaps) of two sequences when considering their entire length.
You can view the original documentation here.
Example
Input File:
>hg18_dna range=chrX:151073054-151073136 5'pad=0 3'pad=0 revComp=FALSE strand=? repeatMasking=none TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG
If both Sequence1 and Sequence2 take the above file as input, Gap open penalty equals 10.0, Gap extension penalty equals 0.5, Brief identity and similarity is set to Yes, Output alignment file format is set to SRS pairs, the output file is:
# Program: needle # Rundate: Mon Apr 02 2007 14:23:16 # Align_format: srspair # Report_file: ./database/files/dataset_7.dat #======================================= # # Aligned_sequences: 2 # 1: hg18_dna # 2: hg18_dna # Matrix: EDNAFULL # Gap_penalty: 10.0 # Extend_penalty: 0.5 # # Length: 83 # Identity: 83/83 (100.0%) # Similarity: 83/83 (100.0%) # Gaps: 0/83 ( 0.0%) # Score: 415.0 # #======================================= hg18_dna 1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA 50 |||||||||||||||||||||||||||||||||||||||||||||||||| hg18_dna 1 TTTATGTCTATAATCCTTACCAAAAGTTACCTTGGAATAAGAAGAAGTCA 50 hg18_dna 51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG 83 ||||||||||||||||||||||||||||||||| hg18_dna 51 GTAAAAAGAAGGCTGTTGTTCCGTGAAATACTG 83 #--------------------------------------- #---------------------------------------