What it does

This tool processes the XML output of any NCBI blast tool (if you run your own blast jobs, the XML output can be generated with -m 7 option).

Output fields

This tools returns tab-delimited output with the following fields:

 Description                               Example
 ----------------------------------------- -----------------

 1. Name of the query sequence             Seq1
 2. Length of the query sequence           30
 3. Name of target sequence                gnl|BL_ORD_ID|0
 4. Length of target sequence              5528445
 5. Alignment bit score                    59.96
 6. E-value                                8.38112e-11
 7. Start of alignment within query        1
 8. End of alignment within query          30
 9. Start of alignment within target       5436010
10. End of alignment within target         5436039
11. Query frame                            1
12. Target frame                           1
13. Number of identical bases within       29
    the alignment
14. Alignment length                       30
15. Aligned portion (sequence) of query    CGGACAGCGCCGCCACCAACAAAGCCACCA
16. Aligned portion (sequence) of target   CGGACAGCGCCGCCACCAACAAAGCCATCA
17. Midline indicating positions of        ||||||||||||||||||||||||||| ||
    matches within the alignment

Note that this form of output does not contain alignment identify value. However, it can be computed by dividing the number of identical bases within the alignment (Field 13) by the alignment length (Field 14) using Text Manipulation->Compute tool