Galaxy |

PRINSEQ (version 0.20.4+galaxy2)

Is this library paired- or single-end?:

FASTQ file:

FASTQ files.

Apply filter treatments?:

Filter sequence based on their length?:

By default, sequences smaller than 60 bp are removed. No top threshold is defined

Filter too small sequences?:

By default, sequences smaller than 60 bp are removed.

Minimum length threshold to conserve sequences:

(-min_len)

Filter too big sequences?:

By default, no treatment based on a maximal length is made.

Filter sequences based on quality score?:

By default, sequences with a mean score below 15 are removed.

Filter sequences based on their minimum score?:

By default, no treatment based on a minimum score is made.

Filter sequences based on their maximum score?:

By default, no treatment based on a minimum score is made.

Filter sequences based on their mean score?:

By default, sequences with a mean score below 15 are removed.

Filter sequences based with too small mean score?:

By default, sequences with a mean score below 15 are removed.

Minimum mean score threshold to conserve sequences:

(-min_qual_mean)

Filter sequences based with too high mean score?:

By default, no treatment based on a maximum mean score is made.

Filter sequences based on their base content?:

By default, sequences with more than 2% of N bases are removed.

Filter sequences based on their GC percentage?:

By default, no treatment based on GC percentage is made.

Filter sequences based on their number of N bases?:

By default, no treatment based on N number is made.

Filter sequences based on their percentage of N bases?:

By default, sequences with more than 2% of N bases are removed.

Maximal N percentage threshold to conserve sequences:

(-ns_max_p)

Filter sequences with characters other than A, T, C, G and N?:

By default, this treatment is not made. (-noniupac)

Filter sequences based on their complexity?:

By default, no complexity filter is applied.

Apply trimming treatments?:

Trim all sequences from the 3'-end to a defined length?:

By default, no length trimming is made

Trim all sequences from the ends?:

By default, no position trimming is made

Trim tails?:

By default, no tail trimming is made

Trim sequence by quality score?:

By default, a 3'-end trimming is made to remove ends with a minimum quality score over 5 bp below 20

Trim sequence by quality score from the 5'-end?:

By default, no 5'-end quality trimming is made

Trim sequence by quality score from the 3'-end?:

By default, 3'-end trimming is made based on a score of 20

Quality score threshold to trim positions:

(-trim_qual_right)

Type of quality score calculation to use:

By default, min is used. (-trim_qual_type)

Rule tu use to compare quality score to calculated value:

By default, 'less than' is used. (-trim_qual_rule)

Size of the sliding window used to calculated quality score by type:

To stop at the first base that fails the rule defined, use a window size of 1 (default value). (-trim_qual_window)

Step size used to move the sliding window:

To move the window over all quality scores without missing any, the step size sould be less or equal to the window size. The default value is 1. (-trim_qual_step)

What it does

PRINSEQ is a tool for easy and rapid quality control and data processing of metagenomic and metatranscriptomic datasets. This tool allow to process the sequences with filtering and trimming. More information on PRINSEQ manual.

Input

The input file is sequence file in fastq format (sequences and quality):

@HWI-M00234:263:000000000-ADM55:1:1101:7508:4067 1:N:0:ATCACG
GGTGCACTAGGATCGTAGTTGGCTACTTTCCCGTTTTCAATGTATACGCAAGGTACACGGTCAGCGGT
+
CCCCCGFGED8DDCAFDAEE9DFGGGG9CFAFFCC@@CFGFGGCGFGG>GGGFFGDGEFFEFG8>4GF

Parameters

The parameters are numerous in PRINSEQ given the wanted treatments.

Several filter treatments are proposed:

Filters based on sequence length

Filters based on quality score

Filters based on base content

And several trimming treatments eliminate sequence parts:

Trim of ends

Trim of tails

Trim based quality score

All these treaments can be customed using proposed parameters.

Output

The output file is a sequence file with sequences and quality from input file which have undergone filter and trimming.