Subtype microbial whole-genome sequencing (WGS) data using single-nucleotide polymorphism (SNP) targeting k-mer subtyping schemes.
Usage
For more information, visit the biohansel project page or the biohansel read the docs page.
Example analysis results of a single FASTA file
Contents of results.tab:
sample scheme scheme_version subtype all_subtypes kmers_matching_subtype are_subtypes_consistent inconsistent_subtypes n_kmers_matching_all n_kmers_matching_all_expected n_kmers_matching_positive n_kmers_matching_positive_expected n_kmers_matching_subtype n_kmers_matching_subtype_expected file_path qc_status qc_message SRR1002850_SMALL heidelberg 0.5.0 2.2.2.2.1.4 2; 2.2; 2.2.2; 2.2.2.2; 2.2.2.2.1; 2.2.2.2.1.4 2154958-2.2.2.2.1.4; 1037658-2.2.2.2.1.4; 3785187-2.2.2.2.1.4 True 202 202 17 17 3 3 SRR1002850_SMALL.fasta PASS
Contents of match_results.tab:
kmername seq is_revcomp contig_id match_index refposition subtype is_pos_kmer sample file_path scheme scheme_version qc_status qc_message 2154958-2.2.2.2.1.4 GGCGCGCCACGGTTACTCCCCGGTGGTCAGCCG True NODE_1_length_726282_cov_40.4705_ID_1 13732 2154958 2.2.2.2.1.4 True SRR1002850_SMALL SRR1002850_SMALL.fasta heidelberg 0.5.0 PASS negative2131791-2.2.3.1.3 GCTGGGCGAAATGATGCAGTTCACCACTTGCTC True NODE_1_length_726282_cov_40.4705_ID_1 36900 2131791 2.2.3.1.3 False SRR1002850_SMALL SRR1002850_SMALL.fasta heidelberg 0.5.0 PASS Next 201 lines omitted.
Example analysis results of a single FASTQ readset
Contents of results.tab:
sample scheme scheme_version subtype all_subtypes kmers_matching_subtype are_subtypes_consistent inconsistent_subtypes n_kmers_matching_all n_kmers_matching_all_expected n_kmers_matching_positive n_kmers_matching_positive_expected n_kmers_matching_subtype n_kmers_matching_subtype_expected file_path avg_kmer_coverage qc_status qc_message SRR5646583_SMALL heidelberg 0.5.0 2.2.1.1.1.1 2; 2.2; 2.2.1; 2.2.1.1; 2.2.1.1.1; 2.2.1.1.1.1 1983064-2.2.1.1.1.1; 4211912-2.2.1.1.1.1 True 202 202 20 20 2 2 ['SRR5646583_SMALL_1.fastq', 'SRR5646583_SMALL_2.fastq'] 42.631 PASS
Contents of match_results.tab:
kmername seq freq refposition subtype is_pos_kmer is_kmer_freq_okay sample scheme scheme_version qc_status qc_message negative4642573-1.2 TACCAGGAAGTGCTGGAAGAGTTTAACGAACAT 62 4642573 1.2 False True SRR5646583_SMALL heidelberg 0.5.0 PASS 21097-2.2.1.1.1 GCAAATCGCGCCAGTCAAGTCCTCTTTTACCGT 42 21097 2.2.1.1.1 True True SRR5646583_SMALL heidelberg 0.5.0 PASS Next 202 lines omitted.
Example Subtype Metadata
A column with name subtype must exist and should have subtype designations that would appear in your biohansel results. There are no requirements for the number of columns or contents of those columns in the table - they can contain whatever you want. Metadata must be structured in a tab-delimited format (.tsv) to be a valid input.
subtype clade source disease_symptoms 1 I geese death 1.1 I moose burns 2.2.1.1.1 II mouse boils 2.2.2.2.1.4 IIa house rash
The biohansel results table will be joined with the subtype metadata table on the subtype field so if there are subtype metadata for your biohansel results, it will show up in the final output table. For example, if you have a sample that produces a result with subtype "1", there will also be columns "clade", "source" and "disease_symptoms" with "I", "geese" and "death", respectively.
Galaxy wrapper written by Matthew Gopez and Peter Kruczkiewicz at the Public Health Agency of Canada, National Microbiology Laboratory.