| Previous changeset 3:8abdedf55101 (2015-11-11) Next changeset 5:4bedca26c133 (2018-10-11) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tool_collections/fastx_toolkit/fastx_barcode_splitter commit bbb2e6b6769b03602a8ab97001f88fbec52080a1 |
|
modified:
fastx_barcode_splitter.xml test-data/fastx_barcode_splitter1.fastq test-data/fastx_barcode_splitter1.out |
|
added:
fastx_barcode_splitter.pl macros.xml test-data/fastx_barcode_splitter1_BC1.out test-data/fastx_barcode_splitter1_BC2.out test-data/fastx_barcode_splitter1_BC3.out test-data/fastx_barcode_splitter1_BC4.out test-data/fastx_barcode_splitter1_unmatched.out test-data/fastx_barcode_splitter_index.fastq |
|
removed:
fastx_barcode_splitter_galaxy_wrapper.sh tool_dependencies.xml |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 fastx_barcode_splitter.pl --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastx_barcode_splitter.pl Tue May 08 13:27:14 2018 -0400 |
| [ |
| b'@@ -0,0 +1,571 @@\n+#!/usr/bin/env perl\n+\n+# FASTX-toolkit - FASTA/FASTQ preprocessing tools.\n+# Copyright (C) 2009-2013 A. Gordon (assafgordon@gmail.com)\n+#\n+# Lance Parsons (lparsons@princeton.edu)\n+# 3/21/2011 - Modified to accept separate index file for barcodes\n+# 4/6/2011 - Modified to cleanup bad barcode identifiers (esp. useful for Galaxy)\n+# 4/28/2016 - Modified summary output to remove file paths and add comment\n+# character \'#\'\n+\n+# This program is free software: you can redistribute it and/or modify\n+# it under the terms of the GNU Affero General Public License as\n+# published by the Free Software Foundation, either version 3 of the\n+# License, or (at your option) any later version.\n+#\n+# This program is distributed in the hope that it will be useful,\n+# but WITHOUT ANY WARRANTY; without even the implied warranty of\n+# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the\n+# GNU Affero General Public License for more details.\n+#\n+# You should have received a copy of the GNU Affero General Public License\n+# along with this program. If not, see <http://www.gnu.org/licenses/>.\n+\n+use strict;\n+use warnings;\n+use IO::Handle;\n+use Data::Dumper;\n+use Getopt::Long;\n+use Carp;\n+\n+##\n+## This program splits a FASTQ/FASTA file into several smaller files,\n+## Based on barcode matching.\n+##\n+## run with "--help" for usage information\n+##\n+## Assaf Gordon <assafgordon@gmail.com> , 11sep2008\n+\n+# Forward declarations\n+sub load_barcode_file ($);\n+sub parse_command_line ;\n+sub match_sequences ;\n+sub mismatch_count($$) ;\n+sub print_results;\n+sub open_and_detect_input_format;\n+sub open_index_and_detect_input_format($);\n+sub read_index_record;\n+sub read_record;\n+sub write_record($);\n+sub usage();\n+\n+# Global flags and arguments,\n+# Set by command line argumens\n+my $barcode_file ;\n+my $barcodes_at_eol = 0 ;\n+my $barcodes_at_bol = 0 ;\n+my $index_read_file ;\n+my $exact_match = 0 ;\n+my $allow_partial_overlap = 0;\n+my $allowed_mismatches = 1;\n+my $newfile_suffix = \'\';\n+my $newfile_prefix ;\n+my $quiet = 0 ;\n+my $debug = 0 ;\n+my $fastq_format = 1;\n+my $index_fastq_format = 1;\n+my $read_id_check_strip_characters = 1;\n+\n+# Global variables\n+# Populated by \'create_output_files\'\n+my %filenames;\n+my %files;\n+my %counts = ( \'unmatched\' => 0 );\n+my $barcodes_length;\n+my @barcodes;\n+my $input_file_io;\n+\n+\n+# The Four lines per record in FASTQ format.\n+# (when using FASTA format, only the first two are used)\n+my $seq_name;\n+my $seq_bases;\n+my $seq_name2;\n+my $seq_qualities;\n+\n+# Values used for index read file\n+my $index_seq_name;\n+my $index_seq_bases;\n+my $index_seq_name2;\n+my $index_seq_qualities;\n+\n+#\n+# Start of Program\n+#\n+parse_command_line ;\n+\n+load_barcode_file ( $barcode_file ) ;\n+\n+open_and_detect_input_format;\n+\n+if (defined $index_read_file) {open_index_and_detect_input_format ( $index_read_file );}\n+\n+match_sequences ;\n+\n+print_results unless $quiet;\n+\n+#\n+# End of program\n+#\n+\n+sub parse_command_line {\n+ my $help;\n+\n+ usage() if (scalar @ARGV==0);\n+\n+ my $result = GetOptions ( "bcfile=s" => \\$barcode_file,\n+ "eol" => \\$barcodes_at_eol,\n+ "bol" => \\$barcodes_at_bol,\n+ "idxfile=s" => \\$index_read_file,\n+ "idxidstrip=i" => \\$read_id_check_strip_characters,\n+ "exact" => \\$exact_match,\n+ "prefix=s" => \\$newfile_prefix,\n+ "suffix=s" => \\$newfile_suffix,\n+ "quiet" => \\$quiet,\n+ "partial=i" => \\$allow_partial_overlap,\n+ "debug" => \\$debug,\n+ "mismatches=i" => \\$allowed_mismatches,\n+ "help" => \\$help\n+ ) ;\n+\n+ usage() if ($help);\n+\n+ die "Error: barcode file not specified (use \'--bcfile [FILENAME]\')\\n" unless defined $barcode_file;\n+ die "Error: prefix path/filename not specified (use \'--prefix [PATH]\')\\n" unless defined $newfile_prefix;\n+\n+ if (! defined $in'..b' programmers\n+ would call index 0.)\n+--eol - Try to match barcodes at the END of sequences.\n+ (What biologists would call the 3\' end, and programmers\n+ would call the end of the string.)\n+--idxfile FILE - Read barcodes from separate index file (fasta or fastq)\n+ NOTE: one of --bol, --eol, --idxfile must be specified,\n+ but not more than one.\n+--idxidstrip N - When using index file, strip this number of characters\n+ from the end of the sequence id before matching.\n+ Automatically detects CASAVA 1.8 format and strips at a\n+ space in the id, use 0 to disable this.\n+ (Default is 1).\n+--mismatches N - Max. number of mismatches allowed. default is 1.\n+--exact - Same as \'--mismatches 0\'. If both --exact and --mismatches\n+ are specified, \'--exact\' takes precedence.\n+--partial N - Allow partial overlap of barcodes. (see explanation below.)\n+ (Default is not partial matching)\n+--quiet - Don\'t print counts and summary at the end of the run.\n+ (Default is to print.)\n+--debug - Print lots of useless debug information to STDERR.\n+--help - This helpful help screen.\n+\n+Example (Assuming \'s_2_100.txt\' is a FASTQ file, \'mybarcodes.txt\' is\n+the barcodes file):\n+\n+ \\$ cat s_2_100.txt | $0 --bcfile mybarcodes.txt --bol --mismatches 2 \\\\\n+ --prefix /tmp/bla_ --suffix ".txt"\n+\n+Barcode file format\n+-------------------\n+Barcode files are simple text files. Each line should contain an identifier\n+(descriptive name for the barcode), and the barcode itself (A/C/G/T),\n+separated by a TAB character. Example:\n+\n+ #This line is a comment (starts with a \'number\' sign)\n+ BC1 GATCT\n+ BC2 ATCGT\n+ BC3 GTGAT\n+ BC4 TGTCT\n+\n+For each barcode, a new FASTQ file will be created (with the barcode\'s\n+identifier as part of the file name). Sequences matching the barcode\n+will be stored in the appropriate file.\n+\n+Running the above example (assuming "mybarcodes.txt" contains the above\n+barcodes), will create the following files:\n+ /tmp/bla_BC1.txt\n+ /tmp/bla_BC2.txt\n+ /tmp/bla_BC3.txt\n+ /tmp/bla_BC4.txt\n+ /tmp/bla_unmatched.txt\n+The \'unmatched\' file will contain all sequences that didn\'t match any barcode.\n+\n+Barcode matching\n+----------------\n+\n+** Without partial matching:\n+\n+Count mismatches between the FASTA/Q sequences and the barcodes.\n+The barcode which matched with the lowest mismatches count (providing the\n+count is small or equal to \'--mismatches N\') \'gets\' the sequences.\n+\n+Example (using the above barcodes):\n+Input Sequence:\n+GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG\n+\n+Matching with \'--bol --mismatches 1\':\n+GATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG\n+GATCT (1 mismatch, BC1)\n+ATCGT (4 mismatches, BC2)\n+GTGAT (3 mismatches, BC3)\n+TGTCT (3 mismatches, BC4)\n+\n+This sequence will be classified as \'BC1\' (it has the lowest mismatch count).\n+If \'--exact\' or \'--mismatches 0\' were specified, this sequence would be\n+classified as \'unmatched\' (because, although BC1 had the lowest mismatch count,\n+it is above the maximum allowed mismatches).\n+\n+Matching with \'--eol\' (end of line) does the same, but from the other side\n+of the sequence.\n+\n+** With partial matching (very similar to indels):\n+\n+Same as above, with the following addition: barcodes are also checked for\n+partial overlap (number of allowed non-overlapping bases is \'--partial N\').\n+\n+Example:\n+Input sequence is ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG\n+(Same as above, but note the missing \'G\' at the beginning.)\n+\n+Matching (without partial overlapping) against BC1 yields 4 mismatches:\n+ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG\n+GATCT (4 mismatches)\n+\n+Partial overlapping would also try the following match:\n+-ATTTACTATGTAAAGATAGAAGGAATAAGGTGAAG\n+GATCT (1 mismatch)\n+\n+Note: scoring counts a missing base as a mismatch, so the final\n+mismatch count is 2 (1 \'real\' mismatch, 1 \'missing base\' mismatch).\n+If running with \'--mismatches 2\' (meaning allowing upto 2 mismatches) - this\n+seqeunce will be classified as BC1.\n+\n+EOF\n+\n+exit 1;\n+}\n' |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 fastx_barcode_splitter.xml --- a/fastx_barcode_splitter.xml Wed Nov 11 12:38:37 2015 -0500 +++ b/fastx_barcode_splitter.xml Tue May 08 13:27:14 2018 -0400 |
| [ |
| @@ -1,38 +1,94 @@ -<tool id="cshl_fastx_barcode_splitter" version="1.0.0" name="Barcode Splitter"> +<tool id="cshl_fastx_barcode_splitter" version="1.0.1" name="Barcode Splitter"> <description></description> - <requirements> - <requirement type="package" version="0.0.13">fastx_toolkit</requirement> - </requirements> - <command interpreter="bash">fastx_barcode_splitter_galaxy_wrapper.sh '$BARCODE' '$input' "$input.name" "$output.files_path" --mismatches $mismatches --partial $partial $EOL > '$output' </command> - + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements" /> + <command detect_errors="aggressive"><![CDATA[ +mkdir split && +@CATS@ '$__tool_directory__/fastx_barcode_splitter.pl' --bcfile '$BARCODE' +--prefix 'split/' +--suffix '.$input.extension' +--mismatches $mismatches +--partial $partial +#if $refBarcodeLocation.barcodeLocation == "idxfile": + --idxfile '$refBarcodeLocation.idxfile' + --idxidstrip $refBarcodeLocation.idxidstrip +#else: + $refBarcodeLocation.EOL +#end if +> '$summary' + ]]></command> <inputs> - <param format="txt" name="BARCODE" type="data" label="Barcodes to use" /> - <param format="fasta,fastqsanger,fastqsolexa,fastqillumina" name="input" type="data" label="Library to split" /> + <param name="BARCODE" type="data" format="txt" label="Barcodes to use" /> + <param name="input" type="data" format="fasta,fastq,fastqsanger,fastqsolexa,fastqillumina" label="Library to split" /> - <param name="EOL" type="select" label="Barcodes found at"> - <option value="--bol">Start of sequence (5' end)</option> - <option value="--eol">End of sequence (3' end)</option> - </param> + <conditional name="refBarcodeLocation"> + <param name="barcodeLocation" type="select" label="Barcodes found at"> + <option value="bol">Start of sequence (5' end)</option> + <option value="eol">End of sequence (3' end)</option> + <option value="idxfile">Separate index file</option> + </param> + <when value="bol"> + <param name="EOL" type="hidden" value="--bol" /> + </when> + <when value="eol"> + <param name="EOL" type="hidden" value="--eol" /> + </when> + <when value="idxfile"> + <param argument="--idxidstrip" type="integer" value="1" label="Characters to strip from the end of the sequence id before matching" /> + <param argument="--idxfile" type="data" format="fasta,fastq,fastqsanger" label="Select index read file" /> + </when> + </conditional> + <param argument="--mismatches" type="integer" value="0" label="Number of allowed mismatches" /> + <param argument="--partial" type="integer" value="0" label="Number of allowed barcodes nucleotide deletions" /> + </inputs> - <param name="mismatches" type="integer" value="2" label="Number of allowed mismatches" /> + <outputs> + <data name="summary" format="tabular" label="${tool.name} on ${on_string}: Summary" /> + <collection name="split_output" type="list" format_source="input" label="${tool.name} on ${on_string}"> + <discover_datasets pattern="__designation_and_ext__" directory="split" visible="false" /> + </collection> + </outputs> - <param name="partial" type="integer" value="0" label="Number of allowed barcodes nucleotide deletions" /> - </inputs> - <outputs> - <data format="html" name="output" /> - </outputs> <tests> <test> <!-- Split a FASTQ file --> <param name="BARCODE" value="fastx_barcode_splitter1.txt" /> <param name="input" value="fastx_barcode_splitter1.fastq" ftype="fastqsolexa" /> - <param name="EOL" value="Start of sequence (5' end)" /> + <param name="barcodeLocation" value="bol" /> <param name="mismatches" value="2" /> <param name="partial" value="0" /> - <output name="output" file="fastx_barcode_splitter1.out" /> + <output name="summary" file="fastx_barcode_splitter1.out" /> + <output_collection name="split_output" type="list"> + <element name="BC1" ftype="fastqsolexa" file="fastx_barcode_splitter1_BC1.out" /> + <element name="BC2" ftype="fastqsolexa" file="fastx_barcode_splitter1_BC2.out" /> + <element name="BC3" ftype="fastqsolexa" file="fastx_barcode_splitter1_BC3.out" /> + <element name="BC4" ftype="fastqsolexa" file="fastx_barcode_splitter1_BC4.out" /> + <element name="unmatched" ftype="fastqsolexa" file="fastx_barcode_splitter1_unmatched.out" /> + </output_collection> + </test> + + <test> + <!-- Split a FASTQ file, using separate index read --> + <param name="BARCODE" value="fastx_barcode_splitter1.txt" /> + <param name="input" value="fastx_barcode_splitter1.fastq" ftype="fastqsolexa" /> + <param name="idxfile" value="fastx_barcode_splitter_index.fastq" ftype="fastqsolexa" /> + <param name="barcodeLocation" value="idxfile" /> + <param name="mismatches" value="2" /> + <param name="partial" value="0" /> + <output name="summary" file="fastx_barcode_splitter1.out" /> + <output_collection name="split_output" type="list"> + <element name="BC1" ftype="fastqsolexa" file="fastx_barcode_splitter1_BC1.out" /> + <element name="BC2" ftype="fastqsolexa" file="fastx_barcode_splitter1_BC2.out" /> + <element name="BC3" ftype="fastqsolexa" file="fastx_barcode_splitter1_BC3.out" /> + <element name="BC4" ftype="fastqsolexa" file="fastx_barcode_splitter1_BC4.out" /> + <element name="unmatched" ftype="fastqsolexa" file="fastx_barcode_splitter1_unmatched.out" /> + </output_collection> </test> </tests> - <help> + + <help><![CDATA[ **What it does** This tool splits a Solexa library (FASTQ file) or a regular FASTA file into several files, using barcodes as the split criteria. @@ -62,12 +118,12 @@ .. image:: barcode_splitter_output_example.png - ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. .. __: http://hannonlab.cshl.edu/fastx_toolkit/ - </help> + ]]></help> + <expand macro="citations" /> <!-- FASTX-barcode-splitter is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> </tool> |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 fastx_barcode_splitter_galaxy_wrapper.sh --- a/fastx_barcode_splitter_galaxy_wrapper.sh Wed Nov 11 12:38:37 2015 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| [ |
| @@ -1,80 +0,0 @@ -#!/bin/bash - -# FASTX-toolkit - FASTA/FASTQ preprocessing tools. -# Copyright (C) 2009 A. Gordon (gordon@cshl.edu) -# -# This program is free software: you can redistribute it and/or modify -# it under the terms of the GNU Affero General Public License as -# published by the Free Software Foundation, either version 3 of the -# License, or (at your option) any later version. -# -# This program is distributed in the hope that it will be useful, -# but WITHOUT ANY WARRANTY; without even the implied warranty of -# MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the -# GNU Affero General Public License for more details. -# -# You should have received a copy of the GNU Affero General Public License -# along with this program. If not, see <http://www.gnu.org/licenses/>. - -# -#This is a shell script wrapper for 'fastx_barcode_splitter.pl' -# -# 1. Output files are saved at the dataset's files_path directory. -# -# 2. 'fastx_barcode_splitter.pl' outputs a textual table. -# This script turns it into pretty HTML with working URL -# (so lazy users can just click on the URLs and get their files) - -BARCODE_FILE="$1" -FASTQ_FILE="$2" -LIBNAME="$3" -OUTPUT_PATH="$4" -shift 4 -# The rest of the parameters are passed to the split program - -if [ "$OUTPUT_PATH" == "" ]; then - echo "Usage: $0 [BARCODE FILE] [FASTQ FILE] [LIBRARY_NAME] [OUTPUT_PATH]" >&2 - exit 1 -fi - -#Sanitize library name, make sure we can create a file with this name -LIBNAME=${LIBNAME//\.gz/} -LIBNAME=${LIBNAME//\.txt/} -LIBNAME=${LIBNAME//[^[:alnum:]]/_} - -if [ ! -r "$FASTQ_FILE" ]; then - echo "Error: Input file ($FASTQ_FILE) not found!" >&2 - exit 1 -fi -if [ ! -r "$BARCODE_FILE" ]; then - echo "Error: barcode file ($BARCODE_FILE) not found!" >&2 - exit 1 -fi -mkdir -p "$OUTPUT_PATH" -if [ ! -d "$OUTPUT_PATH" ]; then - echo "Error: failed to create output path '$OUTPUT_PATH'" >&2 - exit 1 -fi - -PUBLICURL="" -BASEPATH="$OUTPUT_PATH/" -#PREFIX="$BASEPATH"`date "+%Y-%m-%d_%H%M__"`"${LIBNAME}__" -PREFIX="$BASEPATH""${LIBNAME}__" -SUFFIX=".txt" - -RESULTS=`zcat -f < "$FASTQ_FILE" | fastx_barcode_splitter.pl --bcfile "$BARCODE_FILE" --prefix "$PREFIX" --suffix "$SUFFIX" "$@"` -if [ $? != 0 ]; then - echo "error" -fi - -# -# Convert the textual tab-separated table into simple HTML table, -# with the local path replaces with a valid URL -echo "<html><body><table border=1>" -echo "$RESULTS" | sed -r "s|$BASEPATH(.*)|<a href=\"\\1\">\\1</a>|" | sed ' -i<tr><td> -s|\t|</td><td>|g -a<\/td><\/tr> -' -echo "<p>" -echo "</table></body></html>" |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Tue May 08 13:27:14 2018 -0400 |
| [ |
| @@ -0,0 +1,54 @@ +<?xml version="1.0"?> +<macros> + <token name="@CATS@"> + #if $input.is_of_type('fasta.gz', 'fastqsanger.gz', 'fastqsolexa.gz', 'fastqillumina.gz'): + zcat -f '$input' | + #elif $input.is_of_type('fastqsanger.bz2', 'fastqsolexa.bz2', 'fastqillumina.bz2'): + bzcat -f '$input' | + #else: + cat '$input' | + #end if + </token> + <token name="@FQQUAL@"> + <![CDATA[ + #if $input.is_of_type('fastqsanger', 'fastqsanger.gz', 'fastqsanger.bz2'): + -Q 33 + #elif $input.is_of_type('fastqsolexa', 'fastqsolexa.gz', 'fastqsolexa.bz2', 'fastqillumina', 'fastqillumina.gz', 'fastqillumina.bz2'): + -Q 64 + #end if + ]]> + </token> + <xml name="requirements"> + <requirements> + <requirement type="package" version="@VERSION@">fastx_toolkit</requirement> + <yield /> + </requirements> + </xml> + <token name="@VERSION@">0.0.14</token> + <token name="@SANGER@">fastqsanger,fastqsanger.gz,fastqsanger.bz2</token> + <token name="@SOLEXA@">fastqsolexa,fastqsolexa.gz,fastqsolexa.bz2</token> + <token name="@ILLUMINA@">fastqillumina,fastqillumina.gz,fastqillumina.bz2</token> + <token name="@FASTQS@">@SANGER@,@SOLEXA@,@ILLUMINA@</token> + <token name="@FASTAS@">fasta,fasta.gz</token> + <xml name="citations"> + <citations> + <citation type="bibtex"> + @UNPUBLISHED{agordon, + author = "Assaf Gordon", + title = "FASTQ/A short-reads pre-processing tools", + year = "2010", + note = "http://hannonlab.cshl.edu/fastx_toolkit/", + url = "http://hannonlab.cshl.edu/fastx_toolkit/"} + </citation> + </citations> + </xml> + <xml name="fasta_input"> + <param name="input" type="data" format="@FASTAS@" label="Input FASTA file" /> + </xml> + <xml name="fastq_input"> + <param name="input" type="data" format="@FASTQS@" label="Input FASTQ file" /> + </xml> + <xml name="fastx_input"> + <param name="input" type="data" format="@FASTAS@,@FASTQS@" label="Input file in FASTA or FASTQ format" /> + </xml> +</macros> |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 test-data/fastx_barcode_splitter1.fastq --- a/test-data/fastx_barcode_splitter1.fastq Wed Nov 11 12:38:37 2015 -0500 +++ b/test-data/fastx_barcode_splitter1.fastq Tue May 08 13:27:14 2018 -0400 |
| b |
| @@ -158,11 +158,11 @@ TAGTTGAGTATACACAT +CSHL_3_FC042AGLLWW:1:2:7:203 aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 +@CSHL_3_FC042AGLLWW:1:2:7:203/1 TAGTTTCTCTATGTACA -+CSHL_3_FC042AGLLWW:1:2:7:203 ++CSHL_3_FC042AGLLWW:1:2:7:203/1 aab^V^aU]`aa^aZaa -@CSHL_3_FC042AGLLWW:1:2:7:203 +@HWI-X00000:2:000000000-XXXXX:1:1117:19643:1028 1:N:0: TGTCTGAGTATACACAT -+CSHL_3_FC042AGLLWW:1:2:7:203 -aab^V^aU]`aa^aZaa \ No newline at end of file ++HWI-X00000:2:000000000-XXXXX:1:1117:19643:1028 1:N:0: +aab^V^aU]`aa^aZaa |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 test-data/fastx_barcode_splitter1.out --- a/test-data/fastx_barcode_splitter1.out Wed Nov 11 12:38:37 2015 -0500 +++ b/test-data/fastx_barcode_splitter1.out Tue May 08 13:27:14 2018 -0400 |
| b |
| @@ -1,24 +1,7 @@ -<html><body><table border=1> -<tr><td> -Barcode</td><td>Count</td><td>Location -</td></tr> -<tr><td> -BC1</td><td>11</td><td><a href="fastx_barcode_splitter1_fastq__BC1.txt">fastx_barcode_splitter1_fastq__BC1.txt</a> -</td></tr> -<tr><td> -BC2</td><td>12</td><td><a href="fastx_barcode_splitter1_fastq__BC2.txt">fastx_barcode_splitter1_fastq__BC2.txt</a> -</td></tr> -<tr><td> -BC3</td><td>9</td><td><a href="fastx_barcode_splitter1_fastq__BC3.txt">fastx_barcode_splitter1_fastq__BC3.txt</a> -</td></tr> -<tr><td> -BC4</td><td>1</td><td><a href="fastx_barcode_splitter1_fastq__BC4.txt">fastx_barcode_splitter1_fastq__BC4.txt</a> -</td></tr> -<tr><td> -unmatched</td><td>9</td><td><a href="fastx_barcode_splitter1_fastq__unmatched.txt">fastx_barcode_splitter1_fastq__unmatched.txt</a> -</td></tr> -<tr><td> -total</td><td>42 -</td></tr> -<p> -</table></body></html> +# Barcode Count +BC1 11 +BC2 12 +BC3 9 +BC4 1 +unmatched 9 +total 42 |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 test-data/fastx_barcode_splitter1_BC1.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastx_barcode_splitter1_BC1.out Tue May 08 13:27:14 2018 -0400 |
| b |
| @@ -0,0 +1,44 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCTAGTAGTAGTAGA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCTAGTAGTAGTAGA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCTAGTAGTAGTAGA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCTAGTAGTAGTAGA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCTAGTAGTAGTAGA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTCTAGTAGTAGTAGA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTCTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTCTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 test-data/fastx_barcode_splitter1_BC2.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastx_barcode_splitter1_BC2.out Tue May 08 13:27:14 2018 -0400 |
| b |
| @@ -0,0 +1,48 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCGTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCGTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCGTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCGTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTCGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTCGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTCTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTCGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 test-data/fastx_barcode_splitter1_BC3.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastx_barcode_splitter1_BC3.out Tue May 08 13:27:14 2018 -0400 |
| b |
| @@ -0,0 +1,36 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAATGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 test-data/fastx_barcode_splitter1_BC4.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastx_barcode_splitter1_BC4.out Tue May 08 13:27:14 2018 -0400 |
| b |
| @@ -0,0 +1,4 @@ +@HWI-X00000:2:000000000-XXXXX:1:1117:19643:1028 1:N:0: +TGTCTGAGTATACACAT ++HWI-X00000:2:000000000-XXXXX:1:1117:19643:1028 1:N:0: +aab^V^aU]`aa^aZaa |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 test-data/fastx_barcode_splitter1_unmatched.out --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastx_barcode_splitter1_unmatched.out Tue May 08 13:27:14 2018 -0400 |
| b |
| @@ -0,0 +1,36 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTACGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTACTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTACGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTTGAGTATACACAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V^aU]`aa^aZaa +@CSHL_3_FC042AGLLWW:1:2:7:203/1 +TAGTTTCTCTATGTACA ++CSHL_3_FC042AGLLWW:1:2:7:203/1 +aab^V^aU]`aa^aZaa |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 test-data/fastx_barcode_splitter_index.fastq --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fastx_barcode_splitter_index.fastq Tue May 08 13:27:14 2018 -0400 |
| b |
| @@ -0,0 +1,168 @@ +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GATCT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTCT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTCT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTCT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTAC ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTAC ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGTAC ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCGT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCGT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCGT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCGT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTC ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTC ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTC ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +ATCTC ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +GGAAT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203 +TAGTT ++CSHL_3_FC042AGLLWW:1:2:7:203 +aab^V +@CSHL_3_FC042AGLLWW:1:2:7:203/2 +TAGTT ++CSHL_3_FC042AGLLWW:1:2:7:203/2 +aab^V +@HWI-X00000:2:000000000-XXXXX:1:1117:19643:1028 3:N:0: +TGTCT ++HWI-X00000:2:000000000-XXXXX:1:1117:19643:1028 3:N:0: +aab^V |
| b |
| diff -r 8abdedf55101 -r 015dc921d814 tool_dependencies.xml --- a/tool_dependencies.xml Wed Nov 11 12:38:37 2015 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,6 +0,0 @@ -<?xml version="1.0"?> -<tool_dependency> - <package name="fastx_toolkit" version="0.0.13"> - <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> -</tool_dependency> |