| Previous changeset 0:d7bce63e6e09 (2013-09-25) Next changeset 2:d8a3d31554d7 (2018-05-08) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastx_renamer commit a1517c9d22029095120643bbe2c8fa53754dd2b7 |
|
modified:
fastx_renamer.xml tool_dependencies.xml |
| b |
| diff -r d7bce63e6e09 -r 02f8a17a4ebd fastx_renamer.xml --- a/fastx_renamer.xml Wed Sep 25 11:19:14 2013 -0400 +++ b/fastx_renamer.xml Wed Nov 11 12:39:46 2015 -0500 |
| [ |
| @@ -1,29 +1,32 @@ <tool id="cshl_fastx_renamer" name="Rename sequences" version="0.0.11" > - <description></description> + <description></description> <requirements> <requirement type="package" version="0.0.13">fastx_toolkit</requirement> </requirements> - <command>zcat -f $input | fastx_renamer -n $TYPE -o $output -v + <command> +<![CDATA[ +zcat -f < '$input' | fastx_renamer -n $TYPE -o '$output' -v #if $input.ext == "fastqsanger": --Q 33 + -Q 33 #end if - </command> +]]> + </command> - <inputs> - <param format="fastqsolexa,fasta,fastqsanger" name="input" type="data" label="FASTQ/A Library to rename" /> + <inputs> + <param format="fastqsolexa,fasta,fastqsanger" name="input" type="data" label="FASTQ/A Library to rename" /> - <param name="TYPE" type="select" label="Rename sequence identifiers to"> - <option value="SEQ">Nucleotides sequence</option> - <option value="COUNT">Numeric Counter</option> - </param> - </inputs> + <param name="TYPE" type="select" label="Rename sequence identifiers to"> + <option value="SEQ">Nucleotides sequence</option> + <option value="COUNT">Numeric Counter</option> + </param> + </inputs> - <outputs> - <data format="input" name="output" metadata_source="input" /> - </outputs> - -<help> - + <outputs> + <data format_source="input" name="output" metadata_source="input" /> + </outputs> + <tests> + </tests> + <help> **What it does** This tool renames the sequence identifiers in a FASTQ/A file. @@ -42,7 +45,7 @@ GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +CSHL_4_FC042GAMMII_2_1_517_596 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 - + Renamed to **nucleotides sequence**:: @GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT @@ -61,7 +64,7 @@ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. - .. __: http://hannonlab.cshl.edu/fastx_toolkit/ -</help> + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + </help> <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> </tool> |
| b |
| diff -r d7bce63e6e09 -r 02f8a17a4ebd tool_dependencies.xml --- a/tool_dependencies.xml Wed Sep 25 11:19:14 2013 -0400 +++ b/tool_dependencies.xml Wed Nov 11 12:39:46 2015 -0500 |
| b |
| @@ -1,6 +1,6 @@ <?xml version="1.0"?> <tool_dependency> <package name="fastx_toolkit" version="0.0.13"> - <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" /> + <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> </tool_dependency> |