| Previous changeset 11:efc56ee1ade4 (2015-11-11) Next changeset 13:7e6fd3d0f16e (2016-12-06) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/picard commit 7491208ca0c917a053798a48c3e54c3e30e95d92 |
|
modified:
picard_AddCommentsToBam.xml picard_AddOrReplaceReadGroups.xml picard_BedToIntervalList.xml picard_CleanSam.xml picard_CollectAlignmentSummaryMetrics.xml picard_CollectBaseDistributionByCycle.xml picard_CollectGcBiasMetrics.xml picard_CollectInsertSizeMetrics.xml picard_CollectRnaSeqMetrics.xml picard_CollectWgsMetrics.xml picard_DownsampleSam.xml picard_EstimateLibraryComplexity.xml picard_FastqToSam.xml picard_FilterSamReads.xml picard_FixMateInformation.xml picard_MarkDuplicates.xml picard_MarkDuplicatesWithMateCigar.xml picard_MeanQualityByCycle.xml picard_MergeBamAlignment.xml picard_MergeSamFiles.xml picard_NormalizeFasta.xml picard_QualityScoreDistribution.xml picard_ReorderSam.xml picard_ReplaceSamHeader.xml picard_RevertOriginalBaseQualitiesAndAddMateCigar.xml picard_RevertSam.xml picard_SamToFastq.xml picard_SortSam.xml picard_ValidateSamFile.xml picard_macros.xml test-data/picard_CASM_test1.tab test-data/picard_CollectGcBiasMetrics_test1.tab test-data/picard_CollectWgsMetrics_test1.tab test-data/picard_DownsampleSam_test1.bam test-data/picard_EstimateLibraryComplexity_test1.tab test-data/picard_FixMateInformation_test1.bam test-data/picard_MarkDuplicates_test1.bam test-data/picard_MergeBamAlignment_test1.bam test-data/picard_MergeBamAlignment_unaligned.bam test-data/picard_RevertOriginalBaseQualitiesAndAddMateCigar_test1.bam test-data/picard_SortSam_test1.bam |
|
added:
test-data/picard_SortSam_test1.sam |
|
removed:
tool_dependencies.xml |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_AddCommentsToBam.xml --- a/picard_AddCommentsToBam.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_AddCommentsToBam.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,9 +4,9 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard AddCommentsToBam INPUT="${inputFile}" OUTPUT="${outFile}" @@ -16,8 +16,8 @@ QUIET=true VERBOSITY=ERROR VALIDATION_STRINGENCY=${validation_stringency} - </command> - + ]]></command> + <inputs> <param format="bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset" /> <repeat name="comments" title="Comment" min="1" help="You can provide multiple comments"> @@ -31,11 +31,8 @@ <outputs> <data name="outFile" format="bam" label="${tool.name} on ${on_string}: BAM with comments"/> </outputs> - - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> - + + <tests> <test> <param name="inputFile" value="picard_AddCommentsToBam.bam" /> @@ -57,7 +54,7 @@ @description@ COMMENT=String - C=String Comments to add to the BAM file This option may be specified 0 or more times. + C=String Comments to add to the BAM file This option may be specified 0 or more times. @more_info@ </help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_AddOrReplaceReadGroups.xml --- a/picard_AddOrReplaceReadGroups.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_AddOrReplaceReadGroups.xml Sun Nov 27 15:11:50 2016 -0500 |
| b |
| @@ -5,12 +5,12 @@ <import>read_group_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"> @define_read_group_helpers@ #set $rg_auto_name = $read_group_name_default($inputFile) @set_read_group_vars@ @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard AddOrReplaceReadGroups INPUT="${inputFile}" $format_read_group("RGLB=", $rg_lb, '"') @@ -39,9 +39,6 @@ <data name="outFile" format="bam" label="${tool.name} on ${on_string}: BAM with replaced/modified readgroups"/> </outputs> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <tests> <test> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_BedToIntervalList.xml --- a/picard_BedToIntervalList.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_BedToIntervalList.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,21 +4,21 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ #set $picard_dict = "localref.dict" #set $ref_fasta = "localref.fa" ## This is done because picards "likes" .fa extension - ln -s "${reference_source.ref_file}" "${ref_fasta}" && + ln -s "${reference_source.ref_file}" "${ref_fasta}" && #if str( $reference_source.reference_source_selector ) == "history": - java -jar \$JAVA_JAR_PATH/picard.jar CreateSequenceDictionary REFERENCE="${ref_fasta}" OUTPUT="${picard_dict}" + picard CreateSequenceDictionary REFERENCE="${ref_fasta}" OUTPUT="${picard_dict}" QUIET=true VERBOSITY=ERROR - && + && #else: @@ -27,7 +27,7 @@ #end if - java -jar \$JAVA_JAR_PATH/picard.jar + picard BedToIntervalList INPUT="${inputFile}" OUTPUT="${outFile}" @@ -36,7 +36,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> @@ -71,13 +71,10 @@ <param name="reference_source_selector" value="history" /> <param name="ref_file" value="picard_BedToIntervalList_ref.fa" ftype="fasta" /> <param name="inputFile" value="picard_BedToIntervalList.bed" ftype="bed"/> - <output name="outFile" file="picard_BedToIntervalList_test1.pif" ftype="picard_interval_list" lines_diff="2" /> + <output name="outFile" file="picard_BedToIntervalList_test1.pif" ftype="picard_interval_list" lines_diff="8" /> </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_CleanSam.xml --- a/picard_CleanSam.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_CleanSam.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,16 +4,16 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard CleanSam INPUT="${inputFile}" OUTPUT="${outFile}" QUIET=true VERBOSITY=ERROR VALIDATION_STRINGENCY=${validation_stringency} - </command> + ]]></command> <inputs> <param name="inputFile" type="data" format="sam,bam" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset"/> @@ -27,9 +27,6 @@ </data> </outputs> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <tests> <test> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_CollectAlignmentSummaryMetrics.xml --- a/picard_CollectAlignmentSummaryMetrics.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_CollectAlignmentSummaryMetrics.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,22 +4,19 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ ##set up input files #set $reference_fasta_filename = "localref.fa" #if str( $reference_source.reference_source_selector ) == "history": - ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && + ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && #else: #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) #end if - java -jar \$JAVA_JAR_PATH/picard.jar + picard CollectAlignmentSummaryMetrics INPUT="${inputFile}" OUTPUT="${outFile}" @@ -40,7 +37,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset."/> <conditional name="reference_source"> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_CollectBaseDistributionByCycle.xml --- a/picard_CollectBaseDistributionByCycle.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_CollectBaseDistributionByCycle.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,21 +4,21 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements"> - <requirement type="package" version="3.1.2">R</requirement> + <requirement type="package" version="3.3.1">r</requirement> </expand> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ ##set up input files #set $reference_fasta_filename = "localref.fa" #if str( $reference_source.reference_source_selector ) == "history": - ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && + ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && #else: #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) #end if - java -jar \$JAVA_JAR_PATH/picard.jar + picard CollectBaseDistributionByCycle INPUT="${inputFile}" OUTPUT="${outFile}" @@ -32,7 +32,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset."/> <conditional name="reference_source"> @@ -76,9 +76,6 @@ </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_CollectGcBiasMetrics.xml --- a/picard_CollectGcBiasMetrics.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_CollectGcBiasMetrics.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,21 +4,21 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements"> - <requirement type="package" version="3.1.2">R</requirement> + <requirement type="package" version="3.3.1">r</requirement> </expand> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ ##set up input files #set $reference_fasta_filename = "localref.fa" - + #if str( $reference_source.reference_source_selector ) == "history": - ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && + ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && #else: #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) #end if - - java -jar \$JAVA_JAR_PATH/picard.jar + + picard CollectGcBiasMetrics INPUT="${inputFile}" OUTPUT="${outFile}" @@ -29,12 +29,12 @@ IS_BISULFITE_SEQUENCED="${is_bisulfite_sequenced}" REFERENCE_SEQUENCE="${reference_fasta_filename}" ASSUME_SORTED="${assume_sorted}" - + VALIDATION_STRINGENCY="${validation_stringency}" QUIET=true VERBOSITY=ERROR - - </command> + + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset."/> <conditional name="reference_source"> @@ -55,19 +55,19 @@ </conditional> <param name="window_size" type="integer" value="100" label="The size of windows on the genome that are used to bin reads" help="WINDOW_SIZE; default=100"/> <param name="minimum_genome_fraction" type="float" value="0.00005" label="For summary metrics, exclude GC windows that include less than this fraction of the genome" help="MINIMUM_GENOME_FRACTION; default=0.0005"/> - <param name="is_bisulfite_sequenced" type="boolean" label="Calculate the base distribution over PF (passing filtering) reads only" checked="true" truevalue="true" falsevalue="false" help="PF_READS_ONLY"/> + <param name="is_bisulfite_sequenced" type="boolean" label="Calculate the base distribution over PF (passing filtering) reads only" checked="true" truevalue="true" falsevalue="false" help="PF_READS_ONLY"/> <param name="assume_sorted" type="boolean" label="Assume the input file is already sorted" checked="true" truevalue="true" falsevalue="false" help="ASSUME_SORTED"/> - + <expand macro="VS" /> - + </inputs> - + <outputs> <data format="tabular" name="summaryFile" label="${tool.name} on ${on_string}: Summary stats"/> <data format="tabular" name="outFile" label="${tool.name} on ${on_string}: Summary data"/> <data format="pdf" name="pdfFile" label="${tool.name} on ${on_string}: Chart PDF"/> </outputs> - + <tests> <test> <param name="window_size" value="100" /> @@ -78,13 +78,10 @@ <param name="ref_file" value="picard_CollectGcBiasMetrics_ref.fa" /> <param name="inputFile" value="picard_CollectGcBiasMetrics.bam" ftype="bam" /> <output name="outFile" file="picard_CollectGcBiasMetrics_test1.tab" ftype="tabular" lines_diff="4"/> - </test> + </test> </tests> - - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> - + + <help> .. class:: infomark @@ -97,15 +94,15 @@ @description@ - ALIGNED_READS_ONLY=Boolean If set to true, calculate the base distribution over aligned reads only. Default value: - false. Possible values: {true, false} + ALIGNED_READS_ONLY=Boolean If set to true, calculate the base distribution over aligned reads only. Default value: + false. Possible values: {true, false} - PF_READS_ONLY=Boolean If set to true calculate the base distribution over PF reads only. Default value: false. - This option can be set to 'null' to clear the default value. Possible values: {true, - false} + PF_READS_ONLY=Boolean If set to true calculate the base distribution over PF reads only. Default value: false. + This option can be set to 'null' to clear the default value. Possible values: {true, + false} ASSUME_SORTED=Boolean - AS=Boolean If true (default), then the sort order in the header file will be ignored. Default: True + AS=Boolean If true (default), then the sort order in the header file will be ignored. Default: True @more_info@ |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_CollectInsertSizeMetrics.xml --- a/picard_CollectInsertSizeMetrics.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_CollectInsertSizeMetrics.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,21 +4,21 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements"> - <requirement type="package" version="3.1.2">R</requirement> + <requirement type="package" version="3.3.1">r</requirement> </expand> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ ##set up input files #set $reference_fasta_filename = "localref.fa" #if str( $reference_source.reference_source_selector ) == "history": - ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && + ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && #else: #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) #end if - java -jar \$JAVA_JAR_PATH/picard.jar + picard CollectInsertSizeMetrics INPUT="${inputFile}" OUTPUT="${outFile}" @@ -38,7 +38,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset."/> <conditional name="reference_source"> @@ -91,9 +91,6 @@ </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_CollectRnaSeqMetrics.xml --- a/picard_CollectRnaSeqMetrics.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_CollectRnaSeqMetrics.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,9 +4,9 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements"> - <requirement type="package" version="3.1.2">R</requirement> + <requirement type="package" version="3.3.1">r</requirement> </expand> - <command> + <command detect_errors="exit_code"><![CDATA[ ## Set up input files @@ -15,7 +15,7 @@ #set $reference_fasta_filename = "localref.fa" #if str( $reference_source.reference_source_selector ) == "history": - ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && + ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && #else: #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) #end if @@ -23,12 +23,12 @@ ## refFlat data ## The awk line below converts a file obtained from UCSC as specified in the tool help to refFlat format - grep -v '^#' ${refFlat} | awk '{print $11"\t"$1"\t"$2"\t"$3"\t"$4"\t"$5"\t"$6"\t"$7"\t"$8"\t"$9"\t"$10}' > refFlat.tab && + grep -v '^#' ${refFlat} | awk '{print $11"\t"$1"\t"$2"\t"$3"\t"$4"\t"$5"\t"$6"\t"$7"\t"$8"\t"$9"\t"$10}' > refFlat.tab && ## Start picard command @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard CollectRnaSeqMetrics REF_FLAT=refFlat.tab @@ -55,7 +55,7 @@ VERBOSITY=ERROR VALIDATION_STRINGENCY=${validation_stringency} - </command> + ]]></command> <inputs> <param format="sam,bam" type="data" name="inputFile" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset" /> @@ -77,7 +77,7 @@ <param format="tabular" name="refFlat" type="data" label="Gene annotations in refFlat form" help="See "Obtaining gene annotations in refFlat format" below for help" /> <param name="ribosomal_intervals" format="picard_interval_list" type="data" optional="True" label="Location of rRNA sequences in genome, in interval_list format" help="RIBOSOMAL_INTERVALS; If not specified no bases will be identified as being ribosomal. The list of intervals can be geberated from BED or Interval datasets using Galaxy BedToIntervalList tool"/> <param name="strand_specificity" type="select" label="What is the RNA-seq library strand specificity" help="STRAND_SPECIFICITY; For unpaired reads, use FIRST_READ_TRANSCRIPTION_STRAND if the reads are expected to be on the transcription strand."> - <option value="NONE" select="True">None</option> + <option value="NONE" selected="True">None</option> <option value="FIRST_READ_TRANSCRIPTION_STRAND">First read transcription strand</option> <option value="SECOND_READ_TRANSCRIPTION_STRAND">Second read transcription strand</option> </param> @@ -102,9 +102,6 @@ <data format="tabular" name="outFile" label="${tool.name} on ${on_string}: Summary stats"/> </outputs> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <tests> <test> <param name="reference_source_selector" value="history"/> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_CollectWgsMetrics.xml --- a/picard_CollectWgsMetrics.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_CollectWgsMetrics.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,19 +4,19 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ ##set up input files #set $reference_fasta_filename = "localref.fa" #if str( $reference_source.reference_source_selector ) == "history": - ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && + ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && #else: #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) #end if - java -jar \$JAVA_JAR_PATH/picard.jar + picard CollectWgsMetrics INPUT="${inputFile}" OUTPUT="${outFile}" @@ -29,7 +29,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset"/> <conditional name="reference_source"> @@ -73,9 +73,6 @@ </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_DownsampleSam.xml --- a/picard_DownsampleSam.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_DownsampleSam.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,10 +4,9 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ - java -jar - \$JAVA_JAR_PATH/picard.jar + picard DownsampleSam INPUT="${inputFile}" OUTPUT="${outFile}" @@ -16,7 +15,7 @@ QUIET=true VERBOSITY=ERROR VALIDATION_STRINGENCY=${validation_stringency} - </command> + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM or BAM dataset" /> <param name="probability" type="float" min="0.0" max="1.0" label="Probability (between 0 and 1) that any given read will be kept" help="PROBABILITY; specify 1 to keep all reads, 0.1 to keep 10% of the reads" value="1" /> @@ -26,9 +25,6 @@ </inputs> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <outputs> <data name="outFile" format="bam" label="${tool.name} on ${on_string}: downsampled BAM"/> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_EstimateLibraryComplexity.xml --- a/picard_EstimateLibraryComplexity.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_EstimateLibraryComplexity.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,10 +4,10 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard EstimateLibraryComplexity INPUT="${inputFile}" @@ -25,7 +25,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset" /> <param name="min_identical_bases" type="integer" value="5" label="The minimum number of bases at the starts of reads that must be identical for reads to be grouped together for duplicate detection" help="MIN_IDENTICAL_BASES; In effect total_reads / 4^max_id_bases reads will be compared at a time, so lower numbers will produce more accurate results but consume exponentially more memory and CPU; default=5"/> @@ -63,9 +63,6 @@ </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_FastqToSam.xml --- a/picard_FastqToSam.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_FastqToSam.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,13 +4,10 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard FastqToSam #if str( $input_type.input_type_selector ) == "se": @@ -70,7 +67,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <conditional name="input_type"> <param name="input_type_selector" type="select" label="What is your input data" help="Select between single end, paired end, and collections. See help below for full explanation of dataset types"> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_FilterSamReads.xml --- a/picard_FilterSamReads.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_FilterSamReads.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,12 +4,12 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ ##Sam Sorting is performed here because FilterSamReads requires input to be in query-sorted order - java -jar \$JAVA_JAR_PATH/picard.jar + picard SortSam INPUT="${inputFile}" OUTPUT=query_sorted_bam.bam @@ -18,9 +18,9 @@ QUIET=true VERBOSITY=ERROR - && + && - java -jar \$JAVA_JAR_PATH/picard.jar + picard FilterSamReads INPUT=query_sorted_bam.bam FILTER="${filter_type.filter}" @@ -35,7 +35,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param name="inputFile" type="data" format="sam,bam" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset"/> <conditional name="filter_type"> @@ -69,20 +69,17 @@ <param name="filter" value="includeReadList"/> <param name="read_list_file" value="picard_FilterSamReads_read_list_file.tab" ftype="tabular"/> <param name="validation_stringency" value="LENIENT"/> - <output name="outFile" file="picard_FilterSamReads_include_reads_test1.bam" ftype="bam" lines_diff="2"/> + <output name="outFile" file="picard_FilterSamReads_include_reads_test1.bam" ftype="bam" lines_diff="4"/> </test> <test> <param name="inputFile" value="picard_FilterSamReads.bam" ftype="bam"/> <param name="filter" value="excludeReadList"/> <param name="read_list_file" value="picard_FilterSamReads_read_list_file.tab" ftype="tabular"/> <param name="validation_stringency" value="LENIENT"/> - <output name="outFile" file="picard_FilterSamReads_exclude_reads_test2.bam" ftype="bam" lines_diff="2"/> + <output name="outFile" file="picard_FilterSamReads_exclude_reads_test2.bam" ftype="bam" lines_diff="4"/> </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_FixMateInformation.xml --- a/picard_FixMateInformation.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_FixMateInformation.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,10 +4,10 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard FixMateInformation INPUT="${inputFile}" OUTPUT="${outFile}" @@ -19,7 +19,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param name="inputFile" multiple="True" type="data" format="sam,bam" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset"/> <param name="add_mate_cigar" type="boolean" checked="true" truevalue="True" falsevalue="False" label="Adds the mate CIGAR tag (MC) if true, does not if false" help="ADD_MATE_CIGAR; default=True"/> @@ -39,13 +39,10 @@ <param name="add_mate_cigar" value="True"/> <param name="assume_sorted" value="False"/> <param name="validation_stringency" value="LENIENT"/> - <output name="outFile" file="picard_FixMateInformation_test1.bam" ftype="bam" lines_diff="2"/> + <output name="outFile" file="picard_FixMateInformation_test1.bam" ftype="bam" lines_diff="4"/> </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_MarkDuplicates.xml --- a/picard_MarkDuplicates.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_MarkDuplicates.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,33 +4,33 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ - - java -jar \$JAVA_JAR_PATH/picard.jar + + picard MarkDuplicates - + INPUT="${inputFile}" OUTPUT="${outFile}" - + METRICS_FILE="${metrics_file}" #for $element in $comments: COMMENT="${element.comment}" #end for REMOVE_DUPLICATES="${remove_duplicates}" ASSUME_SORTED="${assume_sorted}" - + DUPLICATE_SCORING_STRATEGY="${duplicate_scoring_strategy}" - + #import pipes READ_NAME_REGEX=${ pipes.quote( str( $read_name_regex ) ) or "''" } OPTICAL_DUPLICATE_PIXEL_DISTANCE="${optical_duplicate_pixel_distance}" - + VALIDATION_STRINGENCY="${validation_stringency}" QUIET=true VERBOSITY=ERROR - - </command> + + ]]></command> <inputs> <param format="bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset"/> <repeat name="comments" title="Comment" min="0" help="You can provide multiple comments"> @@ -54,14 +54,14 @@ <param name="optical_duplicate_pixel_distance" type="integer" value="100" min="0" max="500" label="The maximum offset between two duplicte clusters in order to consider them optical duplicates" help="OPTICAL_DUPLICATE_PIXEL_DISTANCE; default=100"/> <expand macro="VS" /> - - </inputs> - + + </inputs> + <outputs> <data format="txt" name="metrics_file" label="${tool.name} on ${on_string}: MarkDuplicate metrics"/> <data format="bam" name="outFile" label="${tool.name} on ${on_string}: MarkDuplicates BAM output"/> </outputs> - + <tests> <test> <param name="inputFile" value="picard_MarkDuplicates.bam" ftype="bam"/> @@ -72,14 +72,11 @@ <param name="optical_duplicate_pixel_distance" value="100"/> <param name="duplicate_scoring_strategy" value="SUM_OF_BASE_QUALITIES"/> <param name="validation_stringency" value="LENIENT"/> - <output name="outFile" file="picard_MarkDuplicates_test1.bam" ftype="bam" lines_diff="2"/> + <output name="outFile" file="picard_MarkDuplicates_test1.bam" ftype="bam" lines_diff="4"/> </test> </tests> - - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> - + + <help> **Purpose** @@ -90,34 +87,34 @@ @description@ - COMMENT=String - CO=String Comment(s) to include in the output file's header. This option may be specified 0 or - more times. + COMMENT=String + CO=String Comment(s) to include in the output file's header. This option may be specified 0 or + more times. + + REMOVE_DUPLICATES=Boolean If true do not write duplicates to the output file instead of writing them with + appropriate flags set. Default value: false. - REMOVE_DUPLICATES=Boolean If true do not write duplicates to the output file instead of writing them with - appropriate flags set. Default value: false. - - READ_NAME_REGEX=String Regular expression that can be used to parse read names in the incoming SAM file. Read - names are parsed to extract three variables: tile/region, x coordinate and y coordinate. - These values are used to estimate the rate of optical duplication in order to give a more - accurate estimated library size. Set this option to null to disable optical duplicate - detection. The regular expression should contain three capture groups for the three - variables, in order. It must match the entire read name. Note that if the default regex - is specified, a regex match is not actually done, but instead the read name is split on - colon character. For 5 element names, the 3rd, 4th and 5th elements are assumed to be - tile, x and y values. For 7 element names (CASAVA 1.8), the 5th, 6th, and 7th elements - are assumed to be tile, x and y values. Default value: + READ_NAME_REGEX=String Regular expression that can be used to parse read names in the incoming SAM file. Read + names are parsed to extract three variables: tile/region, x coordinate and y coordinate. + These values are used to estimate the rate of optical duplication in order to give a more + accurate estimated library size. Set this option to null to disable optical duplicate + detection. The regular expression should contain three capture groups for the three + variables, in order. It must match the entire read name. Note that if the default regex + is specified, a regex match is not actually done, but instead the read name is split on + colon character. For 5 element names, the 3rd, 4th and 5th elements are assumed to be + tile, x and y values. For 7 element names (CASAVA 1.8), the 5th, 6th, and 7th elements + are assumed to be tile, x and y values. Default value: [a-zA-Z0-9]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*. - + DUPLICATE_SCORING_STRATEGY=ScoringStrategy - DS=ScoringStrategy The scoring strategy for choosing the non-duplicate among candidates. Default value: - SUM_OF_BASE_QUALITIES. Possible values: {SUM_OF_BASE_QUALITIES, TOTAL_MAPPED_REFERENCE_LENGTH} - + DS=ScoringStrategy The scoring strategy for choosing the non-duplicate among candidates. Default value: + SUM_OF_BASE_QUALITIES. Possible values: {SUM_OF_BASE_QUALITIES, TOTAL_MAPPED_REFERENCE_LENGTH} + OPTICAL_DUPLICATE_PIXEL_DISTANCE=Integer - The maximum offset between two duplicte clusters in order to consider them optical - duplicates. This should usually be set to some fairly small number (e.g. 5-10 pixels) - unless using later versions of the Illumina pipeline that multiply pixel values by 10, in - which case 50-100 is more normal. Default value: 100. + The maximum offset between two duplicte clusters in order to consider them optical + duplicates. This should usually be set to some fairly small number (e.g. 5-10 pixels) + unless using later versions of the Illumina pipeline that multiply pixel values by 10, in + which case 50-100 is more normal. Default value: 100. @more_info@ |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_MarkDuplicatesWithMateCigar.xml --- a/picard_MarkDuplicatesWithMateCigar.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_MarkDuplicatesWithMateCigar.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,10 +4,10 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard MarkDuplicatesWithMateCigar INPUT="${inputFile}" @@ -35,7 +35,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset"/> <param name="comment" type="text" label="Add this comment to BAM dataset"/> @@ -46,7 +46,7 @@ <param name="assume_sorted" type="boolean" label="Assume the input file is already sorted" checked="true" truevalue="true" falsevalue="false" help="ASSUME_SORTED; default=True"/> <param name="duplicate_scoring_strategy" type="select" label="The scoring strategy for choosing the non-duplicate among candidates" help="DUPLICATE_SCORING_STRATEGY; default=TOTAL_MAPPED_REFERENCE_LENGTH"> - <option value="TOTAL_MAPPED_REFERENCE_LENGTH" select="True">TOTAL_MAPPED_REFERENCE_LENGTH</option> + <option value="TOTAL_MAPPED_REFERENCE_LENGTH" selected="True">TOTAL_MAPPED_REFERENCE_LENGTH</option> <option value="SUM_OF_BASE_QUALITIES">SUM_OF_BASE_QUALITIES</option> </param> @@ -84,9 +84,6 @@ </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_MeanQualityByCycle.xml --- a/picard_MeanQualityByCycle.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_MeanQualityByCycle.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,21 +4,21 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements"> - <requirement type="package" version="3.1.2">R</requirement> + <requirement type="package" version="3.3.1">r</requirement> </expand> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ ##set up input files #set $reference_fasta_filename = "localref.fa" #if str( $reference_source.reference_source_selector ) == "history": - ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && + ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && #else: #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) #end if - java -jar \$JAVA_JAR_PATH/picard.jar + picard MeanQualityByCycle INPUT="${inputFile}" OUTPUT="${outFile}" @@ -33,7 +33,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" label="SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset."/> <conditional name="reference_source"> @@ -77,9 +77,6 @@ </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_MergeBamAlignment.xml --- a/picard_MergeBamAlignment.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_MergeBamAlignment.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,20 +4,20 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ #set $picard_dict = "localref.dict" #set $ref_fasta = "localref.fa" ## This is done because picards "likes" .fa extension - ln -s "${reference_source.ref_file}" "${ref_fasta}" && + ln -s "${reference_source.ref_file}" "${ref_fasta}" && #if str( $reference_source.reference_source_selector ) == "history": - java -jar \$JAVA_JAR_PATH/picard.jar CreateSequenceDictionary REFERENCE="${ref_fasta}" OUTPUT="${picard_dict}" + picard CreateSequenceDictionary REFERENCE="${ref_fasta}" OUTPUT="${picard_dict}" QUIET=true VERBOSITY=ERROR - && + && #else: @@ -25,7 +25,7 @@ #end if - java -jar \$JAVA_JAR_PATH/picard.jar + picard MergeBamAlignment UNMAPPED_BAM="${unmapped_bam}" @@ -85,7 +85,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> @@ -194,13 +194,10 @@ <param name="clip_overlapping_reads" value="True"/> <param name="include_secondary_alignments" value="True"/> <param name="add_mate_cigar" value="True"/> - <output name="outFile" file="picard_MergeBamAlignment_test1.bam" ftype="bam" lines_diff="2"/> + <output name="outFile" file="picard_MergeBamAlignment_test1.bam" ftype="bam" lines_diff="4"/> </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_MergeSamFiles.xml --- a/picard_MergeSamFiles.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_MergeSamFiles.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,10 +4,10 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard MergeSamFiles #for $element in $inputFile: @@ -28,7 +28,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" multiple="True" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset"/> <param name="merge_sequence_dictionaries" type="boolean" label="Merge the sequence dictionaries of the datasets being merged" help="MERGE_SEQUENCE_DICTIONARIES; default=False"/> @@ -52,13 +52,10 @@ <param name="assume_sorted" value="False"/> <param name="merge_sequence_dictionaries" value="False"/> <param name="validation_stringency" value="LENIENT"/> - <output name="outFile" file="picard_MergeSamFiles_test1.bam" ftype="bam" lines_diff="2"/> + <output name="outFile" file="picard_MergeSamFiles_test1.bam" ftype="bam" lines_diff="4"/> </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_NormalizeFasta.xml --- a/picard_NormalizeFasta.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_NormalizeFasta.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,15 +4,15 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ ## Two lines below are due to the fact that picard likes fasta files to have extension .fa #set $fasta_file="local_fasta.fa" - ln -s "${inputFile}" "${fasta_file}" && + ln -s "${inputFile}" "${fasta_file}" && - java -jar \$JAVA_JAR_PATH/picard.jar + picard NormalizeFasta INPUT="${fasta_file}" @@ -23,7 +23,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="fasta" name="inputFile" type="data" label="FASTA dataset or dataset collection" help="If empty, upload or import a FASTA dataset" /> <param name="line_length" type="integer" value="100" min="1" max="200" label="The line length to be used for the output fasta file" help="LINE_LENGTH; default=100"/> @@ -43,9 +43,6 @@ </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_QualityScoreDistribution.xml --- a/picard_QualityScoreDistribution.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_QualityScoreDistribution.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,21 +4,21 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements"> - <requirement type="package" version="3.1.2">R</requirement> + <requirement type="package" version="3.3.1">r</requirement> </expand> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ ##set up input files #set $reference_fasta_filename = "localref.fa" #if str( $reference_source.reference_source_selector ) == "history": - ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && + ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" && #else: #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path ) #end if - java -jar \$JAVA_JAR_PATH/picard.jar + picard QualityScoreDistribution INPUT="${inputFile}" OUTPUT="${outFile}" @@ -34,7 +34,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset"/> <conditional name="reference_source"> @@ -80,9 +80,6 @@ </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_ReorderSam.xml --- a/picard_ReorderSam.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_ReorderSam.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,20 +4,20 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ #set $picard_dict = "localref.dict" #set $ref_fasta = "localref.fa" ## This is done because picards "likes" .fa extension - ln -s "${reference_source.ref_file}" "${ref_fasta}" && + ln -s "${reference_source.ref_file}" "${ref_fasta}" && #if str( $reference_source.reference_source_selector ) == "history": - java -jar \$JAVA_JAR_PATH/picard.jar CreateSequenceDictionary REFERENCE="${ref_fasta}" OUTPUT="${picard_dict}" + picard CreateSequenceDictionary REFERENCE="${ref_fasta}" OUTPUT="${picard_dict}" QUIET=true VERBOSITY=ERROR - && + && #else: @@ -25,7 +25,7 @@ #end if - java -jar \$JAVA_JAR_PATH/picard.jar + picard ReorderSam INPUT="${inputFile}" OUTPUT="${outFile}" @@ -37,7 +37,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> @@ -76,13 +76,10 @@ <param name="inputFile" value="picard_ReorderSam.bam" ftype="bam"/> <param name="allow_incomplete_dict_concordance" value="false"/> <param name="allow_contig_length_discordance" value="false"/> - <output name="outFile" file="picard_ReorderSam_test1.bam" ftype="bam" lines_diff="2"/> + <output name="outFile" file="picard_ReorderSam_test1.bam" ftype="bam" lines_diff="4"/> </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_ReplaceSamHeader.xml --- a/picard_ReplaceSamHeader.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_ReplaceSamHeader.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,15 +4,15 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ ## Two lines below are due to the fact that picard likes fasta files to have extension .fa #set $fasta_file="local_fasta.fa" - ln -s "${inputFile}" "${fasta_file}" && + ln -s "${inputFile}" "${fasta_file}" && - java -jar \$JAVA_JAR_PATH/picard.jar + picard ReplaceSamHeader INPUT="${inputFile}" @@ -22,7 +22,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection (header recepient dataset)" help="If empty, upload or import a SAM/BAM dataset"/> <param name="header" type="data" format="sam,bam" label="SAM/BAM dataset from which Header will be read (header source dataset)" help="HEADER; If empty, upload or import a SAM/BAM dataset"/> @@ -40,9 +40,6 @@ </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_RevertOriginalBaseQualitiesAndAddMateCigar.xml --- a/picard_RevertOriginalBaseQualitiesAndAddMateCigar.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_RevertOriginalBaseQualitiesAndAddMateCigar.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,10 +4,10 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard RevertOriginalBaseQualitiesAndAddMateCigar INPUT="${inputFile}" @@ -21,7 +21,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" multiple="True" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset"/> <param name="restore_original_qualities" type="boolean" checked="True" label="Restore original qualities from the OQ field to the QUAL field if available" help="RESTORE_ORIGINAL_QUALITIES; default=True"/> @@ -41,13 +41,10 @@ <param name="restore_original_qualities" value="True"/> <param name="max_records_to_examine" value="10000"/> <param name="validation_stringency" value="LENIENT"/> - <output name="outFile" file="picard_RevertOriginalBaseQualitiesAndAddMateCigar_test1.bam" ftype="bam" lines_diff="2"/> + <output name="outFile" file="picard_RevertOriginalBaseQualitiesAndAddMateCigar_test1.bam" ftype="bam" lines_diff="4"/> </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_RevertSam.xml --- a/picard_RevertSam.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_RevertSam.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,10 +4,10 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard RevertSam INPUT="${inputFile}" @@ -31,7 +31,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" multiple="True" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset"/> <param name="restore_original_qualities" type="boolean" checked="True" label="Restore original qualities from the OQ field to the QUAL field if available" help="RESTORE_ORIGINAL_QUALITIES; default=True"/> @@ -70,13 +70,10 @@ <param name="library_name" value="null"/> <param name="sort_order" value="coordinate"/> <param name="validation_stringency" value="LENIENT"/> - <output name="outFile" file="picard_RevertSam_test1.bam" ftype="bam" lines_diff="2"/> + <output name="outFile" file="picard_RevertSam_test1.bam" ftype="bam" lines_diff="4"/> </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_SamToFastq.xml --- a/picard_SamToFastq.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_SamToFastq.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,13 +4,13 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ - echo "BAM" > $report && ## This is necessary for output dataset detection (see output tags below) + echo "BAM" > $report && ## This is necessary for output dataset detection (see output tags below) @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard SamToFastq INPUT="${inputFile}" @@ -50,7 +50,7 @@ QUIET=true VERBOSITY=ERROR - </command> + ]]></command> <inputs> <param format="sam,bam" name="inputFile" type="data" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset"/> @@ -100,9 +100,6 @@ </test> </tests> - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> <help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_SortSam.xml --- a/picard_SortSam.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_SortSam.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -4,44 +4,64 @@ <import>picard_macros.xml</import> </macros> <expand macro="requirements" /> - <command> + <command detect_errors="exit_code"><![CDATA[ + #if $sort_order == "queryname": + #set $output = "output.sam" + ln -s '${outFile}' output.sam && + #else: + #set $output = $outFile + #end if @java_options@ - java -jar \$JAVA_JAR_PATH/picard.jar + picard SortSam INPUT="${inputFile}" - OUTPUT="${outFile}" + OUTPUT='${output}' SORT_ORDER="${sort_order}" QUIET=true VERBOSITY=ERROR VALIDATION_STRINGENCY=${validation_stringency} - </command> - + ]]></command> + <inputs> <param name="inputFile" type="data" format="sam,bam" label="Select SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset"/> - <param name="sort_order" type="select" display="radio" label="Sort order" help="SORT_ORDER; default=coordinate"> + <param name="sort_order" type="select" display="radio" label="Sort order" help="SORT_ORDER; default=coordinate. Selecting Queryname will output SAM file, as Galaxy does not support BAM files that are not coordinate sorted."> <option value="coordinate" selected="True">Coordinate</option> <option value="queryname">Queryname</option> </param> <expand macro="VS" /> </inputs> - + <outputs> - <data name="outFile" format="bam" label="${tool.name} on ${on_string}: BAM sorted in ${sort_order} order"> + <data name="outFile" format="bam" label="${tool.name} on ${on_string}: Alignment sorted in ${sort_order} order"> + <change_format> + <when input="sort_order" value="queryname" format="sam"/> + </change_format> </data> </outputs> - - <stdio> - <exit_code range="1:" level="fatal"/> - </stdio> - + + <tests> + <!-- This test fails when setting metadata on non-coordinate sorted bam files. + This should be handled better in Galaxy (info as of release 16.0). + Workaroudn is to produce queryname sorted sam files. <test> <param name="inputFile" ftype="bam" value="picard_SortSam.bam" /> <param name="sort_order" value="queryname"/> - <output name="outFile" file="picard_SortSam_test1.bam" ftype="bam" lines_diff="2"/> + <output name="outFile" file="picard_SortSam_test1.bam" ftype="bam" lines_diff="4"/> + </test> + --> + <test> + <param name="inputFile" ftype="bam" value="picard_SortSam.bam" /> + <param name="sort_order" value="queryname"/> + <output name="outFile" file="picard_SortSam_test1.sam" ftype="sam" lines_diff="4" compare="contains"/> + </test> + <test> + <param name="inputFile" ftype="bam" value="picard_SortSam.bam" /> + <param name="sort_order" value="coordinate"/> + <output name="outFile" file="picard_SortSam_test1.bam" ftype="bam" lines_diff="4"/> </test> </tests> - + <help> .. class:: infomark @@ -56,7 +76,7 @@ SORT_ORDER=SortOrder SO=SortOrder Sort order of output file. You can either sort by queryname or by coordinate. - + @more_info@ </help> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_ValidateSamFile.xml --- a/picard_ValidateSamFile.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_ValidateSamFile.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| b'@@ -4,49 +4,52 @@\n <import>picard_macros.xml</import>\n </macros>\n <expand macro="requirements" />\n- <command>\n- \n+ <stdio>\n+ <exit_code range="1:" level="warning"/>\n+ </stdio>\n+ <command><![CDATA[\n+\n ##set the maximum number of open file to hard maximum or 4096 if on a mac (mac gives \'unlimited\' as output of `ulimit -Hn` command\n- \n- [ `ulimit -Hn` = unlimited ] && ulimit -Sn 4096 || ulimit -Sn `ulimit -Hn`\n- \n- &&\n- \n+\n+ [ `ulimit -Hn` = unlimited ] && ulimit -Sn 4096 || ulimit -Sn `ulimit -Hn`\n+\n+ &&\n+\n ##set up input files\n \n #set $reference_fasta_filename = "localref.fa"\n- \n+\n #if str( $reference_source.reference_source_selector ) == "history":\n- ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" &&\n+ ln -s "${reference_source.ref_file}" "${reference_fasta_filename}" &&\n #else:\n #set $reference_fasta_filename = str( $reference_source.ref_file.fields.path )\n #end if\n- \n+\n @java_options@\n- \n- java -jar \\$JAVA_JAR_PATH/picard.jar\n+\n+ picard\n ValidateSamFile\n- \n+\n INPUT="${inputFile}"\n OUTPUT="${outFile}"\n MODE="${mode}"\n- \n+\n #if str( $ignore ) != "None":\n #for $element in str( $ignore ).split(\',\'): ## See trello card https://trello.com/c/9nW02Zhd\n IGNORE="${element}"\n #end for\n #end if\n- \n+\n MAX_OUTPUT="${max_output}"\n REFERENCE_SEQUENCE="${reference_fasta_filename}"\n IGNORE_WARNINGS="${ignore_warnings}"\n IS_BISULFITE_SEQUENCED="${is_bisulfite_sequenced}"\n MAX_OPEN_TEMP_FILES=`ulimit -Sn`\n- \n+\n VERBOSITY=ERROR\n QUIET=true\n- \n- </command>\n+\n+ ]]></command>\n <inputs>\n <param format="sam,bam" name="inputFile" type="data" label="SAM/BAM dataset or dataset collection" help="If empty, upload or import a SAM/BAM dataset." />\n <conditional name="reference_source">\n@@ -63,11 +66,11 @@\n <validator type="no_options" message="A built-in dictionary is not available for the build associated with the selected input file"/>\n </param>\n </when>\n- <when value="history"> \n+ <when value="history">\n <param name="ref_file" type="data" format="fasta" label="Use the following dataset to create dictionary" help="You can upload a FASTA sequence to the history from which Picard will automatically generate dictionary using CreateSequenceDictionary command" />\n </when>\n </conditional>\n- \n+\n <param name="mode" type="select" label="Select output mode" help="MODE">\n <option value="VERBOSE">Verbose</option>\n <option value="SUMMARY">Summary</option>\n@@ -135,13 +138,13 @@\n <param name="ignore_warnings" type="boolean" label="If true, only report errors and ignore warnings" help="IGNORE_WARNINGS; default=False"/>\n <param name="validate_index" type="boolean" checked="True" label="If true and input is a BAM file with an index file, also validates the index" help="VALIDATE_INDEX; default=True"/>\n <param name="is_bisulfite_sequenced" type="boolean" label="Whether the SAM or BAM file consists of bisulfite sequenced reads" help="IS_BISULFITE_SEQUENCED; If so, C->T is not counted as an error in computing the value of the NM tag; default=False"/>\n- \n- </inputs> \n- \n+\n+ </inputs>\n+\n <outputs>\n <data format="txt" name="outFile" label="${tool.name} on ${on_string}: BAM validation summary"/>\n </outputs>\n- \n+\n <tests>\n <test>\n <param name="inputFile" value="picard_ValidateSamFile.bam" ftype="bam"/>\n@@ -156,11 +159,7 @@\n <output name="outFile" file="picard_ValidateSamFile_test1.txt" ftype="txt"/>\n </test>\n </tests>\n- \n- <stdio>\n- <exit_code range="1:" level="warning"/>\n- </stdio>\n- \n+\n <help>\n \n **Purpose**\n@@ -172,52 +171,52 @@\n @description@\n \n MODE=Mode\n- M=Mode Mode of output Default value: VERBOSE. This option can be set to \'null\' to clear the \n- '..b"G_NM, MISSING_TAG_NM, MISSING_HEADER,\n+ MISSING_SEQUENCE_DICTIONARY, MISSING_READ_GROUP, RECORD_OUT_OF_ORDER,\n+ READ_GROUP_NOT_FOUND, RECORD_MISSING_READ_GROUP, INVALID_INDEXING_BIN,\n+ MISSING_VERSION_NUMBER, INVALID_VERSION_NUMBER, TRUNCATED_FILE,\n+ MISMATCH_READ_LENGTH_AND_QUALS_LENGTH, EMPTY_READ, CIGAR_MAPS_OFF_REFERENCE,\n+ MISMATCH_READ_LENGTH_AND_E2_LENGTH, MISMATCH_READ_LENGTH_AND_U2_LENGTH,\n+ E2_BASE_EQUALS_PRIMARY_BASE, BAM_FILE_MISSING_TERMINATOR_BLOCK, UNRECOGNIZED_HEADER_TYPE,\n+ POORLY_FORMATTED_HEADER_TAG, HEADER_TAG_MULTIPLY_DEFINED,\n+ HEADER_RECORD_MISSING_REQUIRED_TAG, INVALID_DATE_STRING, TAG_VALUE_TOO_LARGE,\n+ INVALID_INDEX_FILE_POINTER, INVALID_PREDICTED_MEDIAN_INSERT_SIZE,\n+ DUPLICATE_READ_GROUP_ID, MISSING_PLATFORM_VALUE, INVALID_PLATFORM_VALUE,\n+ DUPLICATE_PROGRAM_GROUP_ID, MATE_NOT_FOUND, MATES_ARE_SAME_END,\n+ MISMATCH_MATE_CIGAR_STRING, MATE_CIGAR_STRING_INVALID_PRESENCE} This option may be\n+ specified 0 or more times.\n+\n MAX_OUTPUT=Integer\n- MO=Integer The maximum number of lines output in verbose mode Default value: 100. This option can \n- be set to 'null' to clear the default value. \n- \n+ MO=Integer The maximum number of lines output in verbose mode Default value: 100. This option can\n+ be set to 'null' to clear the default value.\n+\n REFERENCE_SEQUENCE=File\n- R=File Reference sequence file, the NM tag check will be skipped if this is missing Default \n- value: null. \n- \n- IGNORE_WARNINGS=Boolean If true, only report errors and ignore warnings. Default value: false. This option can \n- be set to 'null' to clear the default value. Possible values: {true, false} \n- \n- VALIDATE_INDEX=Boolean If true and input is a BAM file with an index file, also validates the index. Default \n- value: true. This option can be set to 'null' to clear the default value. Possible \n- values: {true, false} \n- \n+ R=File Reference sequence file, the NM tag check will be skipped if this is missing Default\n+ value: null.\n+\n+ IGNORE_WARNINGS=Boolean If true, only report errors and ignore warnings. Default value: false. This option can\n+ be set to 'null' to clear the default value. Possible values: {true, false}\n+\n+ VALIDATE_INDEX=Boolean If true and input is a BAM file with an index file, also validates the index. Default\n+ value: true. This option can be set to 'null' to clear the default value. Possible\n+ values: {true, false}\n+\n IS_BISULFITE_SEQUENCED=Boolean\n- BISULFITE=Boolean Whether the SAM or BAM file consists of bisulfite sequenced reads. If so, C->T is not \n- counted as an error in computing the value of the NM tag. Default value: false. This \n- option can be set to 'null' to clear the default value. Possible values: {true, false} \n- \n+ BISULFITE=Boolean Whether the SAM or BAM file consists of bisulfite sequenced reads. If so, C->T is not\n+ counted as an error in computing the value of the NM tag. Default value: false. This\n+ option can be set to 'null' to clear the default value. Possible values: {true, false}\n+\n @more_info@\n \n </help>\n" |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a picard_macros.xml --- a/picard_macros.xml Wed Nov 11 12:23:17 2015 -0500 +++ b/picard_macros.xml Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -7,20 +7,20 @@ </param> </xml> - <token name="@TOOL_VERSION@">1.136</token> + <token name="@TOOL_VERSION@">2.7.1</token> <xml name="requirements"> <requirements> - <requirement type="package" version="1.136">picard</requirement> + <requirement type="package" version="2.7.1">picard</requirement> <yield/> </requirements> </xml> - <token name="@java_options@"> - _JAVA_OPTIONS=\${_JAVA_OPTIONS:-'-Xmx2048m -Xms256m'} && - export _JAVA_OPTIONS && - </token> - + <token name="@java_options@"><![CDATA[ + _JAVA_OPTIONS=\${_JAVA_OPTIONS:-'-Xmx2048m -Xms256m'} && + export _JAVA_OPTIONS && + ]]></token> + <token name="@more_info@"> ------ @@ -28,7 +28,7 @@ Additional information about Picard tools is available from Picard web site at http://broadinstitute.github.io/picard/. </token> - + <token name="@description@"> ------ @@ -49,7 +49,7 @@ .. csv-table:: :header-rows: 1 - + Tag,Importance,Definition,Meaning "ID","Required","Read group identifier. Each @RG line must have a unique ID. The value of ID is used in the RG tags of alignment records. Must be unique among all read groups in header section. Read group IDs may be modified when merging SAM files in order to handle collisions.","Ideally, this should be a globally unique identify across all sequencing data in the world, such as the Illumina flowcell + lane name and number. Will be referenced by each read with the RG:Z field, allowing tools to determine the read group information associated with each read, including the sample from which the read came. Also, a read group is effectively treated as a separate run of the NGS instrument in tools like base quality score recalibration (a GATK component) -- all reads within a read group are assumed to come from the same instrument run and to therefore share the same error model." "SM","Sample. Use pool name where a pool is being sequenced.","Required. As important as ID.","The name of the sample sequenced in this read group. GATK tools treat all read groups with the same SM value as containing sequencing data for the same sample. Therefore it's critical that the SM field be correctly specified, especially when using multi-sample tools like the Unified Genotyper (a GATK component)." @@ -65,13 +65,13 @@ @RG ID:FLOWCELL1.LANE2 PL:illumina LB:LIB-DAD-1 SM:DAD PI:200 @RG ID:FLOWCELL1.LANE3 PL:illumina LB:LIB-DAD-2 SM:DAD PI:400 @RG ID:FLOWCELL1.LANE4 PL:illumina LB:LIB-DAD-2 SM:DAD PI:400 - + Mom's data: @RG ID:FLOWCELL1.LANE5 PL:illumina LB:LIB-MOM-1 SM:MOM PI:200 @RG ID:FLOWCELL1.LANE6 PL:illumina LB:LIB-MOM-1 SM:MOM PI:200 @RG ID:FLOWCELL1.LANE7 PL:illumina LB:LIB-MOM-2 SM:MOM PI:400 @RG ID:FLOWCELL1.LANE8 PL:illumina LB:LIB-MOM-2 SM:MOM PI:400 - + Kid's data: @RG ID:FLOWCELL2.LANE1 PL:illumina LB:LIB-KID-1 SM:KID PI:200 @RG ID:FLOWCELL2.LANE2 PL:illumina LB:LIB-KID-1 SM:KID PI:200 @@ -89,6 +89,6 @@ </token> - + </macros> |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a test-data/picard_CASM_test1.tab --- a/test-data/picard_CASM_test1.tab Wed Nov 11 12:23:17 2015 -0500 +++ b/test-data/picard_CASM_test1.tab Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -1,12 +1,12 @@ ## htsjdk.samtools.metrics.StringHeader -# picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=100000 ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG, METRIC_ACCUMULATION_LEVEL=None] IS_BISULFITE_SEQUENCED=false INPUT=/Users/anton/galaxy-central/database/files/000/dataset_616.dat OUTPUT=/Users/anton/galaxy-central/database/files/000/dataset_639.dat REFERENCE_SEQUENCE=localref.fa ASSUME_SORTED=true VERBOSITY=ERROR QUIET=true VALIDATION_STRINGENCY=LENIENT METRIC_ACCUMULATION_LEVEL=[ALL_READS] STOP_AFTER=0 COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false +# picard.analysis.CollectAlignmentSummaryMetrics MAX_INSERT_SIZE=100000 METRIC_ACCUMULATION_LEVEL=[ALL_READS] IS_BISULFITE_SEQUENCED=false REFERENCE_SEQUENCE=localref.fa INPUT=/tmp/tmppFEHK6/files/000/dataset_1.dat OUTPUT=/tmp/tmppFEHK6/files/000/dataset_3.dat ASSUME_SORTED=true VERBOSITY=ERROR QUIET=true VALIDATION_STRINGENCY=LENIENT EXPECTED_PAIR_ORIENTATIONS=[FR] ADAPTER_SEQUENCE=[AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCGATCTCGTATGCCGTCTTCTGCTTG, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT, AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG] STOP_AFTER=0 COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json ## htsjdk.samtools.metrics.StringHeader -# Started on: Thu Oct 02 13:35:09 EDT 2014 +# Started on: Sun Nov 27 10:07:49 CET 2016 ## METRICS CLASS picard.analysis.AlignmentSummaryMetrics CATEGORY TOTAL_READS PF_READS PCT_PF_READS PF_NOISE_READS PF_READS_ALIGNED PCT_PF_READS_ALIGNED PF_ALIGNED_BASES PF_HQ_ALIGNED_READS PF_HQ_ALIGNED_BASES PF_HQ_ALIGNED_Q20_BASES PF_HQ_MEDIAN_MISMATCHES PF_MISMATCH_RATE PF_HQ_ERROR_RATE PF_INDEL_RATE MEAN_READ_LENGTH READS_ALIGNED_IN_PAIRS PCT_READS_ALIGNED_IN_PAIRS BAD_CYCLES STRAND_BALANCE PCT_CHIMERAS PCT_ADAPTER SAMPLE LIBRARY READ_GROUP -FIRST_OF_PAIR 100 100 1 0 100 1 17831 100 17831 16865 1 0.008188 0.008188 0 251 99 0.99 0 0.46 0 0 -SECOND_OF_PAIR 100 100 1 0 99 0.99 17907 99 17907 16887 1 0.008879 0.008879 0 251 99 1 0 0.545455 0 0 -PAIR 200 200 1 0 199 0.995 35738 199 35738 33752 1 0.008534 0.008534 0 251 198 0.994975 0 0.502513 0 0 +FIRST_OF_PAIR 100 100 1 0 100 1 17831 100 17831 16865 1 0.008132 0.008132 0 251 99 0.99 0 0.46 0.74 0 +SECOND_OF_PAIR 100 100 1 0 99 0.99 17907 99 17907 16887 1 0.008824 0.008824 0 251 99 1 0 0.545455 0.676768 0 +PAIR 200 200 1 0 199 0.995 35738 199 35738 33752 1 0.008479 0.008479 0 251 198 0.994975 0 0.502513 0.708543 0 |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a test-data/picard_CollectGcBiasMetrics_test1.tab --- a/test-data/picard_CollectGcBiasMetrics_test1.tab Wed Nov 11 12:23:17 2015 -0500 +++ b/test-data/picard_CollectGcBiasMetrics_test1.tab Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -1,48 +1,110 @@ ## htsjdk.samtools.metrics.StringHeader -# picard.analysis.CollectGcBiasMetrics REFERENCE_SEQUENCE=localref.fa INPUT=/Users/anton/galaxy-central/database/files/000/dataset_616.dat OUTPUT=/Users/anton/galaxy-central/database/files/000/dataset_707.dat CHART_OUTPUT=/Users/anton/galaxy-central/database/files/000/dataset_708.dat SUMMARY_OUTPUT=/Users/anton/galaxy-central/database/files/000/dataset_706.dat WINDOW_SIZE=100 MINIMUM_GENOME_FRACTION=5.0E-5 ASSUME_SORTED=true IS_BISULFITE_SEQUENCED=true VERBOSITY=ERROR QUIET=true VALIDATION_STRINGENCY=LENIENT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false +# picard.analysis.CollectGcBiasMetrics CHART_OUTPUT=/tmp/tmp_TYiPX/files/000/dataset_5.dat SUMMARY_OUTPUT=/tmp/tmp_TYiPX/files/000/dataset_3.dat SCAN_WINDOW_SIZE=100 MINIMUM_GENOME_FRACTION=5.0E-5 IS_BISULFITE_SEQUENCED=true INPUT=/tmp/tmp_TYiPX/files/000/dataset_1.dat OUTPUT=/tmp/tmp_TYiPX/files/000/dataset_4.dat ASSUME_SORTED=true VERBOSITY=ERROR QUIET=true VALIDATION_STRINGENCY=LENIENT REFERENCE_SEQUENCE=localref.fa METRIC_ACCUMULATION_LEVEL=[ALL_READS] STOP_AFTER=0 COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json ## htsjdk.samtools.metrics.StringHeader -# Started on: Sat Oct 04 11:22:58 EDT 2014 +# Started on: Sun Nov 27 10:39:24 CET 2016 ## METRICS CLASS picard.analysis.GcBiasDetailMetrics -GC WINDOWS READ_STARTS MEAN_BASE_QUALITY NORMALIZED_COVERAGE ERROR_BAR_WIDTH -24 2 0 0 0 0 -25 15 0 0 0 0 -26 13 0 0 0 0 -27 18 0 0 0 0 -28 50 5 21 4.843529 2.166092 -29 47 0 0 0 0 -30 63 0 0 0 0 -31 97 4 20 1.997332 0.998666 -32 167 3 23 0.870095 0.50235 -33 178 4 22 1.088434 0.544217 -34 225 8 22 1.722144 0.60887 -35 291 5 22 0.832222 0.372181 -36 391 1 21 0.123875 0.123875 -37 506 4 24 0.382888 0.191444 -38 570 0 0 0 0 -39 640 0 0 0 0 -40 729 0 0 0 0 -41 846 1 24 0.057252 0.057252 -42 1060 1 24 0.045694 0.045694 -43 1182 13 22 0.532706 0.147746 -44 1113 8 22 0.348142 0.123087 -45 1161 7 20 0.29203 0.110377 -46 1113 5 20 0.217589 0.097309 -47 1035 8 23 0.374379 0.132363 -48 956 9 23 0.455981 0.151994 -49 913 1 24 0.053051 0.053051 -50 785 5 22 0.308505 0.137968 -51 607 5 22 0.398973 0.178426 -52 436 104 22 11.553373 1.132901 -53 354 13 23 1.778697 0.493322 -54 288 0 0 0 0 -55 232 6 21 1.252637 0.511387 -56 133 0 0 0 0 -57 108 2 24 0.89695 0.634239 -58 65 0 0 0 0 -59 38 0 0 0 0 -60 29 0 0 0 0 -61 10 0 0 0 0 -62 2 0 0 0 0 +ACCUMULATION_LEVEL GC WINDOWS READ_STARTS MEAN_BASE_QUALITY NORMALIZED_COVERAGE ERROR_BAR_WIDTH SAMPLE LIBRARY READ_GROUP +All Reads 0 0 118 20 0 0 +All Reads 1 0 0 0 0 0 +All Reads 2 0 0 0 0 0 +All Reads 3 0 0 0 0 0 +All Reads 4 0 0 0 0 0 +All Reads 5 0 0 0 0 0 +All Reads 6 0 0 0 0 0 +All Reads 7 0 0 0 0 0 +All Reads 8 0 0 0 0 0 +All Reads 9 0 0 0 0 0 +All Reads 10 0 0 0 0 0 +All Reads 11 0 0 0 0 0 +All Reads 12 0 0 0 0 0 +All Reads 13 0 0 0 0 0 +All Reads 14 0 0 0 0 0 +All Reads 15 0 0 0 0 0 +All Reads 16 0 0 0 0 0 +All Reads 17 0 0 0 0 0 +All Reads 18 0 0 0 0 0 +All Reads 19 0 0 0 0 0 +All Reads 20 0 0 0 0 0 +All Reads 21 0 0 0 0 0 +All Reads 22 0 0 0 0 0 +All Reads 23 0 0 0 0 0 +All Reads 24 2 0 0 0 0 +All Reads 25 15 0 0 0 0 +All Reads 26 13 0 0 0 0 +All Reads 27 18 0 0 0 0 +All Reads 28 50 5 21 4.843529 2.166092 +All Reads 29 47 0 0 0 0 +All Reads 30 63 0 0 0 0 +All Reads 31 97 4 20 1.997332 0.998666 +All Reads 32 167 3 23 0.870095 0.50235 +All Reads 33 178 4 22 1.088434 0.544217 +All Reads 34 225 8 22 1.722144 0.60887 +All Reads 35 291 5 22 0.832222 0.372181 +All Reads 36 391 1 21 0.123875 0.123875 +All Reads 37 506 4 24 0.382888 0.191444 +All Reads 38 570 0 0 0 0 +All Reads 39 640 0 0 0 0 +All Reads 40 729 0 0 0 0 +All Reads 41 846 1 24 0.057252 0.057252 +All Reads 42 1060 1 24 0.045694 0.045694 +All Reads 43 1182 13 22 0.532706 0.147746 +All Reads 44 1113 8 22 0.348142 0.123087 +All Reads 45 1161 7 20 0.29203 0.110377 +All Reads 46 1113 5 20 0.217589 0.097309 +All Reads 47 1035 8 23 0.374379 0.132363 +All Reads 48 956 9 23 0.455981 0.151994 +All Reads 49 913 1 24 0.053051 0.053051 +All Reads 50 785 5 22 0.308505 0.137968 +All Reads 51 607 5 22 0.398973 0.178426 +All Reads 52 436 104 22 11.553373 1.132901 +All Reads 53 354 13 23 1.778697 0.493322 +All Reads 54 288 0 0 0 0 +All Reads 55 232 6 21 1.252637 0.511387 +All Reads 56 133 0 0 0 0 +All Reads 57 108 2 24 0.89695 0.634239 +All Reads 58 65 0 0 0 0 +All Reads 59 38 0 0 0 0 +All Reads 60 29 0 0 0 0 +All Reads 61 10 0 0 0 0 +All Reads 62 2 0 0 0 0 +All Reads 63 0 0 0 0 0 +All Reads 64 0 0 0 0 0 +All Reads 65 0 0 0 0 0 +All Reads 66 0 0 0 0 0 +All Reads 67 0 0 0 0 0 +All Reads 68 0 0 0 0 0 +All Reads 69 0 0 0 0 0 +All Reads 70 0 0 0 0 0 +All Reads 71 0 0 0 0 0 +All Reads 72 0 0 0 0 0 +All Reads 73 0 0 0 0 0 +All Reads 74 0 0 0 0 0 +All Reads 75 0 0 0 0 0 +All Reads 76 0 0 0 0 0 +All Reads 77 0 0 0 0 0 +All Reads 78 0 0 0 0 0 +All Reads 79 0 0 0 0 0 +All Reads 80 0 0 0 0 0 +All Reads 81 0 0 0 0 0 +All Reads 82 0 0 0 0 0 +All Reads 83 0 0 0 0 0 +All Reads 84 0 0 0 0 0 +All Reads 85 0 0 0 0 0 +All Reads 86 0 0 0 0 0 +All Reads 87 0 0 0 0 0 +All Reads 88 0 0 0 0 0 +All Reads 89 0 0 0 0 0 +All Reads 90 0 0 0 0 0 +All Reads 91 0 0 0 0 0 +All Reads 92 0 0 0 0 0 +All Reads 93 0 0 0 0 0 +All Reads 94 0 0 0 0 0 +All Reads 95 0 0 0 0 0 +All Reads 96 0 0 0 0 0 +All Reads 97 0 0 0 0 0 +All Reads 98 0 0 0 0 0 +All Reads 99 0 0 0 0 0 +All Reads 100 0 0 0 0 0 |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a test-data/picard_CollectWgsMetrics_test1.tab --- a/test-data/picard_CollectWgsMetrics_test1.tab Wed Nov 11 12:23:17 2015 -0500 +++ b/test-data/picard_CollectWgsMetrics_test1.tab Sun Nov 27 15:11:50 2016 -0500 |
| b |
| @@ -1,11 +1,11 @@ ## htsjdk.samtools.metrics.StringHeader -# picard.analysis.CollectWgsMetrics INPUT=/Users/anton/galaxy-central/database/files/000/dataset_773.dat OUTPUT=/Users/anton/galaxy-central/database/files/000/dataset_802.dat REFERENCE_SEQUENCE=localref.fa MINIMUM_MAPPING_QUALITY=20 MINIMUM_BASE_QUALITY=20 COVERAGE_CAP=250 VERBOSITY=ERROR QUIET=true VALIDATION_STRINGENCY=LENIENT STOP_AFTER=-1 COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false +# picard.analysis.CollectWgsMetrics INPUT=/tmp/tmpOXrG6f/files/000/dataset_1.dat OUTPUT=/tmp/tmpOXrG6f/files/000/dataset_3.dat REFERENCE_SEQUENCE=localref.fa MINIMUM_MAPPING_QUALITY=20 MINIMUM_BASE_QUALITY=20 COVERAGE_CAP=250 VERBOSITY=ERROR QUIET=true VALIDATION_STRINGENCY=LENIENT LOCUS_ACCUMULATION_CAP=100000 STOP_AFTER=-1 INCLUDE_BQ_HISTOGRAM=false COUNT_UNPAIRED=false SAMPLE_SIZE=10000 COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=500000 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json ## htsjdk.samtools.metrics.StringHeader -# Started on: Tue Oct 07 15:46:29 EDT 2014 +# Started on: Sun Nov 27 10:15:01 CET 2016 ## METRICS CLASS picard.analysis.CollectWgsMetrics$WgsMetrics -GENOME_TERRITORY MEAN_COVERAGE SD_COVERAGE MEDIAN_COVERAGE MAD_COVERAGE PCT_EXC_MAPQ PCT_EXC_DUPE PCT_EXC_UNPAIRED PCT_EXC_BASEQ PCT_EXC_OVERLAP PCT_EXC_CAPPED PCT_EXC_TOTAL PCT_5X PCT_10X PCT_15X PCT_20X PCT_25X PCT_30X PCT_40X PCT_50X PCT_60X PCT_70X PCT_80X PCT_90X PCT_100X -16568 2.915983 3.836089 2 2 0 0 0 0 0.008069 0 0.008069 0.240464 0.055831 0.02541 0.011045 0 0 0 0 0 0 0 0 0 +GENOME_TERRITORY MEAN_COVERAGE SD_COVERAGE MEDIAN_COVERAGE MAD_COVERAGE PCT_EXC_MAPQ PCT_EXC_DUPE PCT_EXC_UNPAIRED PCT_EXC_BASEQ PCT_EXC_OVERLAP PCT_EXC_CAPPED PCT_EXC_TOTAL PCT_1X PCT_5X PCT_10X PCT_15X PCT_20X PCT_25X PCT_30X PCT_40X PCT_50X PCT_60X PCT_70X PCT_80X PCT_90X PCT_100X HET_SNP_SENSITIVITY HET_SNP_Q +16568 2.915862 3.835741 2 2 0 0 0 0.000041 0.008069 0 0.00811 0.684633 0.240464 0.055831 0.02541 0.010985 0 0 0 0 0 0 0 0 0 0.54448 3 ## HISTOGRAM java.lang.Integer coverage count @@ -17,8 +17,8 @@ 5 1247 6 672 7 468 -8 361 -9 311 +8 362 +9 310 10 210 11 95 12 78 @@ -28,8 +28,8 @@ 16 29 17 31 18 53 -19 61 -20 65 +19 62 +20 64 21 74 22 32 23 12 |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a test-data/picard_DownsampleSam_test1.bam |
| b |
| Binary file test-data/picard_DownsampleSam_test1.bam has changed |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a test-data/picard_EstimateLibraryComplexity_test1.tab --- a/test-data/picard_EstimateLibraryComplexity_test1.tab Wed Nov 11 12:23:17 2015 -0500 +++ b/test-data/picard_EstimateLibraryComplexity_test1.tab Sun Nov 27 15:11:50 2016 -0500 |
| [ |
| @@ -1,11 +1,11 @@ ## htsjdk.samtools.metrics.StringHeader -# picard.sam.markduplicates.EstimateLibraryComplexity INPUT=[/Users/anton/galaxy-central/database/files/000/dataset_951.dat] OUTPUT=/Users/anton/galaxy-central/database/files/001/dataset_1073.dat MIN_IDENTICAL_BASES=5 MAX_DIFF_RATE=0.03 MIN_MEAN_QUALITY=20 MAX_GROUP_RATIO=500 READ_NAME_REGEX=[a-zA-Z0-9]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*. OPTICAL_DUPLICATE_PIXEL_DISTANCE=100 VERBOSITY=ERROR QUIET=true VALIDATION_STRINGENCY=LENIENT COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=3472024 CREATE_INDEX=false CREATE_MD5_FILE=false +# picard.sam.markduplicates.EstimateLibraryComplexity INPUT=[/tmp/tmpiSG3kJ/files/000/dataset_1.dat] OUTPUT=/tmp/tmpiSG3kJ/files/000/dataset_2.dat MIN_IDENTICAL_BASES=5 MAX_DIFF_RATE=0.03 MIN_MEAN_QUALITY=20 MAX_GROUP_RATIO=500 READ_NAME_REGEX=[a-zA-Z0-9]+:[0-9]:([0-9]+):([0-9]+):([0-9]+).*. OPTICAL_DUPLICATE_PIXEL_DISTANCE=100 VERBOSITY=ERROR QUIET=true VALIDATION_STRINGENCY=LENIENT MAX_READ_LENGTH=0 MIN_GROUP_COUNT=2 COMPRESSION_LEVEL=5 MAX_RECORDS_IN_RAM=3098916 CREATE_INDEX=false CREATE_MD5_FILE=false GA4GH_CLIENT_SECRETS=client_secrets.json ## htsjdk.samtools.metrics.StringHeader -# Started on: Fri Oct 17 13:39:31 EDT 2014 +# Started on: Sun Nov 27 10:17:54 CET 2016 ## METRICS CLASS picard.sam.DuplicationMetrics -LIBRARY UNPAIRED_READS_EXAMINED READ_PAIRS_EXAMINED UNMAPPED_READS UNPAIRED_READ_DUPLICATES READ_PAIR_DUPLICATES READ_PAIR_OPTICAL_DUPLICATES PERCENT_DUPLICATION ESTIMATED_LIBRARY_SIZE -Unknown 0 982 0 0 116 0 0.118126 3822 +LIBRARY UNPAIRED_READS_EXAMINED READ_PAIRS_EXAMINED SECONDARY_OR_SUPPLEMENTARY_RDS UNMAPPED_READS UNPAIRED_READ_DUPLICATES READ_PAIR_DUPLICATES READ_PAIR_OPTICAL_DUPLICATES PERCENT_DUPLICATION ESTIMATED_LIBRARY_SIZE +Unknown 0 982 0 0 0 116 0 0.118126 3822 ## HISTOGRAM java.lang.Integer duplication_group_count Unknown |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a test-data/picard_FixMateInformation_test1.bam |
| b |
| Binary file test-data/picard_FixMateInformation_test1.bam has changed |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a test-data/picard_MarkDuplicates_test1.bam |
| b |
| Binary file test-data/picard_MarkDuplicates_test1.bam has changed |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a test-data/picard_MergeBamAlignment_test1.bam |
| b |
| Binary file test-data/picard_MergeBamAlignment_test1.bam has changed |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a test-data/picard_MergeBamAlignment_unaligned.bam |
| b |
| Binary file test-data/picard_MergeBamAlignment_unaligned.bam has changed |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a test-data/picard_RevertOriginalBaseQualitiesAndAddMateCigar_test1.bam |
| b |
| Binary file test-data/picard_RevertOriginalBaseQualitiesAndAddMateCigar_test1.bam has changed |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a test-data/picard_SortSam_test1.bam |
| b |
| Binary file test-data/picard_SortSam_test1.bam has changed |
| b |
| diff -r efc56ee1ade4 -r 05087b27692a tool_dependencies.xml --- a/tool_dependencies.xml Wed Nov 11 12:23:17 2015 -0500 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 |
| b |
| @@ -1,9 +0,0 @@ -<?xml version="1.0"?> -<tool_dependency> - <package name="picard" version="1.136"> - <repository changeset_revision="3e9c24e5325b" name="package_picard_1_136" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="R" version="3.1.2"> - <repository changeset_revision="c987143177d4" name="package_r_3_1_2" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> -</tool_dependency> |