| Previous changeset 85:3b2ff9864995 (2024-04-09) Next changeset 87:de8fb46bc3ef (2024-04-10) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/jbrowse2 commit f09abc1f5ef8d261dff2d1b0063fff99a1b25f93 |
|
modified:
jbrowse2.xml |
|
added:
test-data/jbrowse2_result02.zip test-data/merlin_tab.maf |
| b |
| diff -r 3b2ff9864995 -r 0fae1d68347f jbrowse2.xml --- a/jbrowse2.xml Tue Apr 09 00:26:49 2024 +0000 +++ b/jbrowse2.xml Wed Apr 10 06:08:39 2024 +0000 |
| b |
| b'@@ -361,7 +361,8 @@\n name="category"\n type="text"\n value="Default"\n- help="Organise your tracks into Categories for a nicer end-user experience. You can use #date# and it will be replaced with the current date in \'yyyy-mm-dd\' format, which is very useful for repeatedly updating a JBrowse instance when member databases / underlying tool versions are updated." optional="False"/>\n+ help="Organise your tracks into Categories for a nicer end-user experience. You can use #date# and it will be replaced with the current date in \'yyyy-mm-dd\' format,\n+ which is very useful for repeatedly updating a JBrowse instance when member databases / underlying tool versions are updated." optional="False"/>\n <repeat name="data_tracks" title="Annotation Track">\n <conditional name="data_format" label="Track Data Selection Options">\n <param type="select" label="Track Type" name="data_format_select">\n@@ -381,7 +382,9 @@\n <expand macro="input_conditional" label="BlastXML Track Data" format="blastxml" />\n \n <param label="Features used in Blast Search"\n- help="in GFF3. This is used so we know where to map features. E.g. where results of which CDS Protein32 match up to. The query IDs in your blast results should MATCH some feature IDs in your GFF3 file. This is an optional field and is most useful if using JBrowse to display protein blast results on a DNA genome. blastn results don\'t need this, blastp results on a protein sequence don\'t need this."\n+ help="in GFF3. This is used so we know where to map features. E.g. where results of which CDS Protein32 match up to. The query IDs in your blast results should MATCH some feature\n+ IDs in your GFF3 file. This is an optional field and is most useful if using JBrowse to display protein blast results on a DNA genome. blastn results don\'t need this,\n+ blastp results on a protein sequence don\'t need this."\n format="gff3"\n name="blast_parent"\n optional="true"\n@@ -418,7 +421,8 @@\n name="name"\n type="text"\n value="match"\n- help="Match_parts have options for the parent feature type, such as cDNA_match, match, translated_nucleotide_match, etc. Please select the appropriate one here. You can leave empty to try autodetection (only works with CanvasFeatures track type)."\n+ help="Match_parts have options for the parent feature type, such as cDNA_match, match, translated_nucleotide_match, etc.\n+ Please select the appropriate one here. You can leave empty to try autodetection (only works with CanvasFeatures track type)."\n optional="True"/>\n </when>\n <when value="false" />\n@@ -480,6 +484,191 @@\n </outputs>\n <tests>\n <test>\n+ <repeat name="assemblies">\n+ <conditional name="reference_genome">\n+ <param name="genome_type_select" value="history"/>\n+ <param name="genome" location="https://galaxy.genomicsvl-students.cloud.edu.au/jbrowse/merlin/Merlin" />\n+ <param name="genome.ext" value="fasta"/>\n+ </conditional>\n+ <repeat name="track_groups">\n+ <param name="category" value="Assembly properties"/>\n+ <repeat name="data_tracks">\n+ <conditional name="data_format">\n+ <param name="data_format_select" value="gff"/>\n+ <condi'..b'roperties"/>\n+ <repeat name="data_tracks">\n+ <conditional name="data_format">\n+ <param name="data_format_select" value="hic"/>\n+ <conditional name="useuri">\n+ <param name="insource" value="uri"/>\n+ <param name="annouri" value="https://s3.amazonaws.com/igv.broadinstitute.org/data/hic/intra_nofrag_30.hic"/>\n+ <param name="annoname" value="humanhic"/>\n+ </conditional>\n+ </conditional>\n+ </repeat>\n+ </repeat>\n+ </repeat>\n+ <section name="jbgen">\n+ <param name="zipOut" value="true" />\n+ </section>\n+ <output name="output" file="jbrowse2_result02.zip" ftype="zip" compare="sim_size">\n+ <assert_contents>\n+ <has_archive_member path=".*" n="616" delta="10"/>\n+ <has_archive_member path="index.html"/>\n+ <has_archive_member path="static/media/roboto-latin-400-normal.3f2b9a42f643e62a49b7.woff"/>\n+ <has_archive_member path="manifest.json">\n+ <has_text text="favicon.ico"/>\n+ <has_text text="background_color"/>\n+ </has_archive_member>\n+ <has_archive_member path="galaxy.xml">\n+ <is_valid_xml />\n+ <xml_element path="./metadata/general/session_name" n="1">\n+ <has_text_matching expression="New session"/>\n+ <not_has_text text="Newton"/>\n+ </xml_element>\n+ </has_archive_member>\n+ <has_archive_member path="merlin.gff3_0.gff3.gz"/>\n+ <has_archive_member path="merlin.bw_1.bigwig"/>\n+ <has_archive_member path="test-6.bed_2.bed.gz"/>\n+ <has_archive_member path="merlin.vcf_3.vcf.tbi"/>\n+ <has_archive_member path="merlin.cram_4.cram"/>\n+ <has_archive_member path="merlin-sample.bam_5.bam"/>\n+ <has_archive_member path="merlinlastz.maf_6.maf.sorted.bed.gz.tbi"/>\n+ <has_archive_member path="merlin.blastxml_7.blastxml.gz"/>\n+ <has_archive_member path="dm3test.cool_8.cool.hic"/>\n+ <has_archive_member path="peach-grape-map.paf_9.paf"/>\n+ <has_archive_member path="Merlin.fa.gz.fai"/>\n+ <has_archive_member path="config.json">\n+ <has_json_property_with_text property="name" text="Merlin" />\n+ </has_archive_member>\n+\n+ </assert_contents>\n+ </output>\n+ </test>\n+ <test>\n <repeat name="assemblies">\n <conditional name="reference_genome">\n <param name="genome_type_select" value="history"/>\n@@ -834,7 +1023,6 @@\n </output>\n </test>\n \n-\n <!-- TODO add a synteny test -->\n <!-- TODO add a bam and a cram test -->\n <!-- TODO add an hic test -->\n@@ -898,6 +1086,18 @@\n Annotation Tracks\n -----------------\n \n+MAF\n+~~~\n+\n+For history references, the name of the reference genome dataset in your history is very important for MAF tracks,\n+because it becomes the "dbkey" for that reference. So, it must be exactly the same as the genome name (dbkey) used\n+when making the MAF, typically in the Lastz tool.\n+\n+If you used "hg38" as the reference in Lastz, that is exactly what the reference fasta should be named for any MAF track.\n+Change it using the "pencil" icon on the reference data in your history. Any other name, such as "hg38.fasta"\n+will cause the MAF track to show no data since there are no matches with that reference dbkey.\n+\n+\n GFF3/BED\n ~~~~~~~~\n \n' |
| b |
| diff -r 3b2ff9864995 -r 0fae1d68347f test-data/jbrowse2_result02.zip |
| b |
| Binary file test-data/jbrowse2_result02.zip has changed |
| b |
| diff -r 3b2ff9864995 -r 0fae1d68347f test-data/merlin_tab.maf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/merlin_tab.maf Wed Apr 10 06:08:39 2024 +0000 |
| b |
| @@ -0,0 +1,37 @@ +##maf version=1 scoring=lastz.v1.04.22 +# lastz.v1.04.22 --strand=both --ambiguous=iupac --traceback=160M --format=maf --action:target=multiple +# +# hsp_threshold = 3000 +# gapped_threshold = 3000 +# x_drop = 910 +# y_drop = 9400 +# gap_open_penalty = 400 +# gap_extend_penalty = 30 +# A C G T +# A 91 -114 -31 -123 +# C -114 100 -125 -31 +# G -31 -125 100 -114 +# T -123 -31 -114 91 +a score=5703 +s Merlin.Merlin 1320 60 + 172788 ATGTAAGCTCAGGAGCTCCACACGCAACAGGAACACAACCTGTGAACATTATCACAGTAT +s Merlin1.Merlin 0 60 + 60 ATGTAAGCTCAGGAGCTCCACACGCAACAGGAACACAACCTGTGAACATTATCACAGTAT + +a score=5595 +s Merlin.Merlin 4020 60 + 172788 ATGAATTTATCAGTCCAATACTTAAAATGAATACGAAGTAAATCTATGCCTAATACTAAT +s Merlin2.Merlin 0 60 + 60 ATGAATTTATCAGTCCAATACTTAAAATGAATACGAAGTAAATCTATGCCTAATACTAAT + +a score=5667 +s Merlin.Merlin 5220 60 + 172788 TAATCAACGTGTGATGCTTCAAGCCAAGCTTAGGAATAGAAATGGTTTTGCCATTGACTT +s Merlin3.Merlin 0 60 + 60 TAATCAACGTGTGATGCTTCAAGCCAAGCTTAGGAATAGAAATGGTTTTGCCATTGACTT + +a score=5640 +s Merlin.Merlin 7740 60 + 172788 AAAAGCTTATTGCTTAAGCCTACAGTTAAACTCGCTATTCCAGTTAAATGCGATAAATGT +s Merlin4.Merlin 0 60 + 60 AAAAGCTTATTGCTTAAGCCTACAGTTAAACTCGCTATTCCAGTTAAATGCGATAAATGT + +a score=5649 +s Merlin.Merlin 9720 60 + 172788 TTTTCTTTGCTAATTTAACACCAAGAGCTGCAATCCATTGGTTTCTTCGTTTATATCCTG +s Merlin5.Merlin 0 60 + 60 TTTTCTTTGCTAATTTAACACCAAGAGCTGCAATCCATTGGTTTCTTCGTTTATATCCTG + +a score=5658 +s Merlin.Merlin 10380 60 + 172788 ATACTGCATCCTTTTGATACCAATGCGGTTCAATTTGAGTGTTACCAGAGTATATCTTGA +s Merlin6.Merlin 0 60 + 60 ATACTGCATCCTTTTGATACCAATGCGGTTCAATTTGAGTGTTACCAGAGTATATCTTGA |