| Previous changeset 2:7d16de45c021 (2019-11-28) Next changeset 4:08d873cdd5f6 (2024-03-20) |
|
Commit message:
"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/obitools commit 5d3c7a7b3f7d687bb03ef7993ddf1a6507d655bd" |
|
modified:
macros.xml obiclean.xml test-data/output_ngsfilter_error_3.fastq test-data/output_ngsfilter_unidentified.fastq test-data/output_obisort.fastq |
|
added:
test-data/illuminapairedend.output.fastq.gz test-data/output_ngsfilter_error_3.fastq.gz test-data/output_obiannotate.fasta.gz test-data/output_obiclean_advanced.fasta.gz test-data/output_obigrep_predicat.fasta.gz test-data/output_obiuniq.fasta.gz test-data/output_obiuniq_family.fasta.gz test-data/wolf_small.F.fastq.gz test-data/wolf_small.R.fastq.gz |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 macros.xml --- a/macros.xml Thu Nov 28 15:51:35 2019 -0500 +++ b/macros.xml Mon May 10 19:35:45 2021 +0000 |
| [ |
| @@ -6,7 +6,8 @@ </requirements> </xml> - <token name="@TOOL_VERSION@">1.2.11</token> + <token name="@TOOL_VERSION@">1.2.13</token> + <token name="@PROFILE@">21.01</token> <xml name="stdio"> <stdio> @@ -14,6 +15,80 @@ </stdio> </xml> + <token name="@INPUT_FORMATS@">fastqsanger,fastqsanger.gz,fastqsolexa,fastqsolexa.gz,fasta,fasta.gz</token> + <token name="@GUNZIP_INPUT@"><![CDATA[ + #if $input.ext.endswith(".gz") + gunzip -c '$input' > input && + #else + ln -s '$input' input && + #end if + ]]></token> + <token name="@GZIP_OUTPUT@"><![CDATA[ + #if $input.ext.endswith(".gz") + | gzip -c + #end if + ]]></token> + + <!-- generate galaxy.json to determine output format + - by default same as input + - if out_format can be specified + - fasta/fastq depending on $out_format (if != "") + - or fasta if the tool does not support choosing the output format, e.g. obiuniq which always outputs fasta + - gz if $input is zipped + + A list of outputs to include in the json can be given by + setting a variable $outputs = [...] listing pairs of output names and the actual output + (defaults to [("output", $output)]) + --> + <token name="@GENERATE_GALAXY_JSON@"><![CDATA[ + #import json + + #try: + #silent $outputs[0] + #except + #set outputs = [("output", $output)] + #end try + + #if $input.ext.startswith("fastq") + #set ext = "fastqsanger" + #else if $input.ext.startswith("fasta") + #set ext = "fasta" + #end if + + #try + #if $out_format == "fasta" + #set ext = "fasta" + #else if $out_format == "fastq" + #set ext = "fastqsanger" + #end if + #except + #set ext = "fasta" + #end try + + #if $input.ext.endswith(".gz") + #set ext = ext + ".gz" + #end if + + #set gxy_json = {} + #for oname, o in $outputs + #silent gxy_json[oname] = {"ext": ext} + #end for + && echo '${json.dumps(gxy_json)}' >> galaxy.json + ]]></token> + + <token name="@OUT_FORMAT@"><![CDATA[ + #if $out_format + --${out_format}-output + #end if + ]]></token> + + <xml name="out_format_macro"> + <param name="out_format" type="select" optional="true" label="Output data type" help="For FASTA/Q the the default output type is the same as the input type"> + <option value="fasta">fasta</option> + <option value="fastq">fastq</option> + </param> + </xml> + <token name="@OBITOOLS_LINK@"> <![CDATA[ -------- @@ -105,15 +180,43 @@ <option value="taxid">taxid</option> </xml> - <xml name="inputtype"> - <option value="--genbank">genbank</option> - <option value="--embl">embl</option> - <option value="--sanger">sanger</option> - <option value="--solexa">solexa</option> - <option value="--ecopcr">ecopcr</option> - <option value="--ecopcrdb">ecopcrdb</option> - <option value="--fasta" selected="true">fasta</option> + <xml name="input_format_options_macro"> + <section name="input_format_options" title="Input format options" expanded="false"> + <param name="options_inputtype" type="select" optional="true" label="Specify the input datatype" help="default: determine automatically (should only be necessay for non FASTA/FASTQ datasets)"> + <option value="--genbank">genbank</option> + <option value="--embl">embl</option> + <option value="--sanger">sanger</option> + <option value="--solexa">solexa</option> + <option value="--ecopcr">ecopcr</option> + <option value="--ecopcrdb">ecopcrdb</option> + <option value="--fasta">fasta (including obitools fasta extentions)</option> + <option value="--raw-fasta">raw fasta (more tolerant format variant)</option> + </param> + <param name="options_seqtype" type="select" optional="true" label="Specify the sequence datatype" > + <option value="--nuc">nucleic</option> + <option value="--prot">protein</option> + </param> + </section> </xml> + + <token name="@INPUT_FORMAT@"><![CDATA[ + #if $input_format_options.options_inputtype + $input_format_options.options_inputtype + #else + #if $input.ext.startswith("fasta") + --fasta + #else if $input.ext.startswith("fastqsolexa") + ## input file is in fastq nucleic format produced by solexa sequencer + --solexa + #else + ## input file is in sanger fastq nucleic format (standard fastq) + --sanger + #end if + #end if + #if $input_format_options.options_seqtype + $input_format_options.options_seqtype + #end if + ]]></token> <xml name="sanitizer"> <sanitizer invalid_char="test"> |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 obiclean.xml --- a/obiclean.xml Thu Nov 28 15:51:35 2019 -0500 +++ b/obiclean.xml Mon May 10 19:35:45 2021 +0000 |
| [ |
| @@ -1,76 +1,76 @@ -<tool id="obi_clean" name="obiclean" version="@TOOL_VERSION@"> - <description>tags a set of sequences for PCR/sequencing errors identification</description> - <macros> - <import>macros.xml</import> - </macros> - <expand macro="requirements"/> - <expand macro="stdio"/> - - <command> - - <![CDATA[ - obiclean - - #if $distance - -d '$distance' - #end if - #if $key - -s '$key' - #end if - #if $ratio - -r '$ratio' - #end if - ${head} - - '$input'>'$output' - - - ]]> - - </command> - - <inputs> - <param name="input" type="data" format="fasta" label="Input sequences file" /> - <param name="distance" type="integer" value="1" optional="true" label="Maximum numbers of differences between two variant sequences (default: 1)" /> - <param name="key" type="text" optional="true" label="Specify an attribute containing sample definition" /> - <param name="ratio" optional="true" type="float" value="1" label="Threshold ratio between counts (rare/abundant counts) of two sequence records so that the less abundant one is a variant of the more abundant (default: 1, i.e. all less abundant sequences are variants)" /> - <param name="head" type="boolean" checked="false" truevalue="-H" falsevalue="" label="Do you want to select only sequences with the head status in a least one sample?" /> - </inputs> - <outputs> - <data format="fasta" name="output" label="output with ${tool.name} on ${on_string}" /> - </outputs> - <tests> - <test> - <param name="input" value="output_obiannotate.fasta" /> - <param name="head" value="True"/> - <output name="output" file="output_obiclean_simple.fasta" ftype="fasta"/> - </test> - <test> - <param name="input" value="output_obiannotate.fasta" /> - <param name="key" value="merged_sample"/> - <param name="ratio" value="0.05"/> - <param name="head" value="False"/> - <output name="output" file="output_obiclean_advanced.fasta" ftype="fasta"/> - </test> - </tests> - <help><![CDATA[ - -.. class:: infomark - -**What it does** - -obijoinpairedend aims at joining the two reads of a paired-end library. - -For this purpose, it concatenates sequence merging the forward read and the reversed-complemented reverse read. - -The program uses as input one or two sequences reads files. - -If two files are used one of them must be specified using the -r option. Sequence records corresponding to the same read pair must be in the same order in the two files. -If just one file is provided, sequence records are supposed to be all of the same length. The first half of the sequence is used as forward read, the second half is used as the reverse read. - -@OBITOOLS_LINK@ - - ]]> - </help> - <expand macro="citation" /> - </tool> +<tool id="obi_clean" name="obiclean" version="@TOOL_VERSION@" profile="@PROFILE@"> + <description>tags a set of sequences for PCR/sequencing errors identification</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="requirements"/> + <expand macro="stdio"/> + + <command><![CDATA[ + @GUNZIP_INPUT@ + obiclean + --without-progress-bar + #if $distance + -d '$distance' + #end if + #if $key + -s '$key' + #end if + #if $ratio + -r '$ratio' + #end if + ${head} + @INPUT_FORMAT@ + @OUT_FORMAT@ + input + @GZIP_OUTPUT@ + >'$output' + @GENERATE_GALAXY_JSON@ + ]]></command> + <inputs> + <param name="input" type="data" format="@INPUT_FORMATS@" label="Input sequences file" /> + <param name="distance" type="integer" value="1" optional="true" label="Maximum numbers of differences between two variant sequences (default: 1)" /> + <param name="key" type="text" optional="true" label="Specify an attribute containing sample definition" /> + <param name="ratio" optional="true" type="float" value="1" label="Threshold ratio between counts (rare/abundant counts) of two sequence records so that the less abundant one is a variant of the more abundant (default: 1, i.e. all less abundant sequences are variants)" /> + <param name="head" type="boolean" checked="false" truevalue="-H" falsevalue="" label="Do you want to select only sequences with the head status in a least one sample?" /> + <expand macro="input_format_options_macro"/> + <expand macro="out_format_macro"/> + </inputs> + <outputs> + <data format="auto" name="output"/> + </outputs> + <tests> + <test> + <param name="input" value="output_obiannotate.fasta" /> + <param name="head" value="True"/> + <output name="output" file="output_obiclean_simple.fasta" ftype="fasta"/> + </test> + <test> + <param name="input" value="output_obiannotate.fasta.gz" /> + <param name="key" value="merged_sample"/> + <param name="ratio" value="0.05"/> + <param name="head" value="False"/> + <output name="output" file="output_obiclean_advanced.fasta.gz" ftype="fasta.gz" decompress="true"/> + </test> + </tests> + <help><![CDATA[ + +.. class:: infomark + +**What it does** + +obijoinpairedend aims at joining the two reads of a paired-end library. + +For this purpose, it concatenates sequence merging the forward read and the reversed-complemented reverse read. + +The program uses as input one or two sequences reads files. + +If two files are used one of them must be specified using the -r option. Sequence records corresponding to the same read pair must be in the same order in the two files. +If just one file is provided, sequence records are supposed to be all of the same length. The first half of the sequence is used as forward read, the second half is used as the reverse read. + +@OBITOOLS_LINK@ + + ]]> + </help> + <expand macro="citation" /> + </tool> |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 test-data/illuminapairedend.output.fastq.gz |
| b |
| Binary file test-data/illuminapairedend.output.fastq.gz has changed |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 test-data/output_ngsfilter_error_3.fastq |
| b |
| Binary file test-data/output_ngsfilter_error_3.fastq has changed |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 test-data/output_ngsfilter_error_3.fastq.gz |
| b |
| Binary file test-data/output_ngsfilter_error_3.fastq.gz has changed |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 test-data/output_ngsfilter_unidentified.fastq |
| b |
| Binary file test-data/output_ngsfilter_unidentified.fastq has changed |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 test-data/output_obiannotate.fasta.gz |
| b |
| Binary file test-data/output_obiannotate.fasta.gz has changed |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 test-data/output_obiclean_advanced.fasta.gz |
| b |
| Binary file test-data/output_obiclean_advanced.fasta.gz has changed |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 test-data/output_obigrep_predicat.fasta.gz |
| b |
| Binary file test-data/output_obigrep_predicat.fasta.gz has changed |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 test-data/output_obisort.fastq --- a/test-data/output_obisort.fastq Thu Nov 28 15:51:35 2019 -0500 +++ b/test-data/output_obisort.fastq Mon May 10 19:35:45 2021 +0000 |
| b |
| b"@@ -1,172 +1,232 @@\n->HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP count=64; merged_sample={'26a_F040644': 64}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=99; obiclean_headcount=1; seq_rank=5; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'h'}; obiclean_head=True; \n-ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca\n-gcctgaaactcaaaggacttggcggtgctttacatccct\n->HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB count=61; merged_sample={'29a_F260619': 30, '15a_F730814': 31}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=2; seq_rank=4; obiclean_samplecount=2; obiclean_status={'29a_F260619': 'h', '15a_F730814': 'h'}; obiclean_head=True; \n-ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat\n-agcttaaaactcaaaggacttggcggtgctttataccctt\n->HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB count=46; merged_sample={'13a_F730603': 46}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=1; seq_rank=8; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'h'}; obiclean_head=True; \n-ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat\n-agcttaaaactcaaaggacttggcggtgctttataccctt\n->HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB count=7; merged_sample={'29a_F260619': 7}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=4; obiclean_headcount=0; seq_rank=16; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; \n+@HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP count=64; merged_sample={'26a_F040644': 64}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=99; obiclean_headcount=1; seq_rank=5; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'h'}; obiclean_head=True; \n+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB count=61; merged_sample={'29a_F260619': 30, '15a_F730814': 31}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=2; seq_rank=4; obiclean_samplecount=2; obiclean_status={'29a_F260619': 'h', '15a_F730814': 'h'}; obiclean_head=True; \n+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB count=46; merged_sample={'13a_F730603': 46}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=1; seq_rank=8; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'h'}; obiclean_head=True; \n+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB count=7; merged_sample={'29a_F260619': 7}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=4; obiclean_headcount=0; seq_rank=16; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; \n tttt\n->HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP count=3; merged_sample={'29a_F260619': 3}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=6; obiclean_samplecount=1; obiclean_status={'29a_F260619': 's'}; obiclean_head=True; \n-ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac\n-agcttaaaactcaaaggacttggcggtgctttataccctt\n->HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS_SUB_SUB count=2; merged_sample={'29a_F260619': 2}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=7; obiclean_sample"..b"M_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=51; obiclean_samplecount=1; obiclean_status={'29a_F260619': 'i'}; obiclean_head=False; \n+ttagccctaaacacaagtaattaatataacaaaataattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=52; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; \n+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtagtactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=53; obiclean_samplecount=1; obiclean_status={'26a_F040644': 's'}; obiclean_head=True; \n+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaatagcctgaaactcaaaggacttggcggtgctttacatccct\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=54; obiclean_samplecount=1; obiclean_status={'15a_F730814': 'i'}; obiclean_head=False; \n+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactgccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=55; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; \n+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactacgagcaacagcctgaaactcaaaggacttggcggtgctttacatccct\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=56; obiclean_samplecount=1; obiclean_status={'15a_F730814': 's'}; obiclean_head=True; \n+ttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctatagcttaaaactcaaaggacttggcggtgctttataccctt\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=57; obiclean_samplecount=1; obiclean_status={'13a_F730603': 'i'}; obiclean_head=False; \n+ctagccttaaacacaaatagttatgcagacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n+@HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=58; obiclean_samplecount=1; obiclean_status={'26a_F040644': 'i'}; obiclean_head=False; \n+ttagccctaaacatgaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct\n++\n+IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII\n" |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 test-data/output_obiuniq.fasta.gz |
| b |
| Binary file test-data/output_obiuniq.fasta.gz has changed |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 test-data/output_obiuniq_family.fasta.gz |
| b |
| Binary file test-data/output_obiuniq_family.fasta.gz has changed |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 test-data/wolf_small.F.fastq.gz |
| b |
| Binary file test-data/wolf_small.F.fastq.gz has changed |
| b |
| diff -r 7d16de45c021 -r 12baadec7809 test-data/wolf_small.R.fastq.gz |
| b |
| Binary file test-data/wolf_small.R.fastq.gz has changed |