| Previous changeset 2:694b0f55b744 (2020-08-04) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/idba_ud commit 9c0a7395ca18043ae2dd957f39f47b65c938750a |
|
modified:
idba_ud.xml macros.xml test-data/out/scaffold.fa |
| b |
| diff -r 694b0f55b744 -r 1542a2fffe0c idba_ud.xml --- a/idba_ud.xml Tue Aug 04 05:50:30 2020 -0400 +++ b/idba_ud.xml Thu Jul 21 13:34:59 2022 +0000 |
| b |
| @@ -2,6 +2,7 @@ <description> Iterative de Bruijn Graph Assembler for data with highly uneven depth </description> + <expand macro="bio_tools"/> <macros> <import>macros.xml</import> </macros> @@ -59,7 +60,7 @@ <not_has_text text="--no_correct" /> <not_has_text text="--pre_correction" /> </assert_command> - <output name="output" file="out/scaffold.fa" ftype="fasta"/> + <output name="output" file="out/scaffold.fa" ftype="fasta" compare="re_match"/> </test> <!-- read levels test --> <test> @@ -74,7 +75,7 @@ <has_text text="--read_level_4" /> <has_text text="--read_level_5" /> </assert_command> - <output name="output" file="out/scaffold.fa" ftype="fasta" lines_diff="2"/> + <output name="output" file="out/scaffold.fa" ftype="fasta" compare="re_match"/> </test> <!-- k-mer options --> <test> @@ -99,7 +100,7 @@ <has_text text="--min_support 2" /> <has_text text="--seed_kmer 29" /> </assert_command> - <output name="output" file="out/scaffold.fa" lines_diff="2"/> + <output name="output" file="out/scaffold.fa" compare="re_match"/> </test> <!-- filter options --> <test> @@ -112,7 +113,7 @@ <has_text text="--similar 0.96" /> <has_text text="--max_mismatch 2" /> </assert_command> - <output name="output" file="out/scaffold.fa" lines_diff="2"/> + <output name="output" file="out/scaffold.fa" compare="re_match"/> </test> <!-- min-pairs and other options --> <test> @@ -127,7 +128,7 @@ <has_text text="--no_correct" /> <has_text text="--pre_correction" /> </assert_command> - <output name="output" file="out/scaffold.fa" lines_diff="2"/> + <output name="output" file="out/scaffold.fa" compare="re_match"/> </test> </tests> <expand macro="help" more_help="IDBA-UD is an extension of IDBA algorithm for Short Reads Sequencing data with Highly Uneven Sequencing Depth. IDBA-UD also iterates from small k to a large k. In each iteration, short and low-depth contigs are removed iteratively with cutoff threshold from low to high to reduce the errors in low-depth and high-depth regions. Paired-end reads are aligned to contigs and assembled locally to generate some missing k-mers in low-depth regions. With these technologies, IDBA-UD can iterate k value of de Bruijn graph to a very large value with less gaps and less branches to form long contigs in both low-depth and high-depth regions."/> |
| b |
| diff -r 694b0f55b744 -r 1542a2fffe0c macros.xml --- a/macros.xml Tue Aug 04 05:50:30 2020 -0400 +++ b/macros.xml Thu Jul 21 13:34:59 2022 +0000 |
| b |
| @@ -6,7 +6,11 @@ <yield/> </requirements> </xml> - + <xml name="bio_tools"> + <xrefs> + <xref type="bio.tools">idba</xref> + </xrefs> + </xml> <xml name="main_input"> <param argument="--read" type="data" format="fasta" label="Fasta read file. Lower or equal to 600b"/> <param argument="--long_read" type="data" format="fasta" optional="true" label="Fasta long read file. More than 600b"/> |
| b |
| diff -r 694b0f55b744 -r 1542a2fffe0c test-data/out/scaffold.fa --- a/test-data/out/scaffold.fa Tue Aug 04 05:50:30 2020 -0400 +++ b/test-data/out/scaffold.fa Thu Jul 21 13:34:59 2022 +0000 |
| [ |
| @@ -1,2 +1,2 @@ >scaffold_0 -GAAAAACGCGCTTGCAGATGGGTCGCAGGTTACTTCCTTGCGCACAGGATATAGTTATACCAGCGTTATTGTCGTTAGTGGTGAGTCGTCGGTATATCTGAATGGAGATACGACAATCAGCGGAGAATTCCCTCTGGGGTTTGCCGGGGTTATTCGGGTACAGGATAAAGCTTTGCTGGAAATTGGCAGTGGCGCTACGCTAACAATGCAGGATATTGACAGTTTTGAACATCATGGGACAAGAACCCTGGATTTGCCCCTATATTTCCAGACATCTGTTATCACTTAACCCATTACAAGCCCGCTGCCGCAGATATTCCCGTGGCGAGCGATAACCCAGCGCACTATGCGGATGCCATTCGTTATAATGCTCGAACGCCTCTGCAAGGTTCTTTGCTGCCGTTAACCCGTCTGGTTTGGGCATGATACTGATGTAGTCACGCTTTATCGTTTTCACGAAGCTCTCTGCTATTCCGTTACTCTCCGGACTCCGCACCGCCGTGTTCTTCGGTTCAAGTCCCAACATCCGGGCGAACTGGCGTGTTTCATTAGCCCGGTAGCATGAACCATTATCCGTCAGCCACTCCACTGGAGACGACGGAAGATCGTTGCCGAAGCGGCGTTCCACCGCTCCCAGCATGACGTCCTGTACTGTTTCACTGTTGAAGCCGCCGGTAGTGACCGCCCAGTGCAGTGCCTCACGATCACAGCAGTCCAGCGCGAACGTGACACGCAGTCTCTCTCCGTTA +[ATCG]+ \ No newline at end of file |