| Previous changeset 0:04614cf6ed39 (2013-09-25) Next changeset 2:ce309f4ff17f (2018-05-08) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tool_collections/fastx_toolkit/fastq_to_fasta commit a1517c9d22029095120643bbe2c8fa53754dd2b7 |
|
modified:
fastq_to_fasta.xml tool_dependencies.xml |
| b |
| diff -r 04614cf6ed39 -r 186b8d913e6c fastq_to_fasta.xml --- a/fastq_to_fasta.xml Wed Sep 25 11:04:26 2013 -0400 +++ b/fastq_to_fasta.xml Wed Nov 11 12:38:08 2015 -0500 |
| b |
| @@ -1,9 +1,9 @@ -<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA"> +<tool id="cshl_fastq_to_fasta" name="FASTQ to FASTA" version="1.0.0"> <description>converter</description> <requirements> <requirement type="package" version="0.0.13">fastx_toolkit</requirement> </requirements> - <command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v + <command>gunzip -cf $input | fastq_to_fasta $SKIPN $RENAMESEQ -o $output -v #if $input.ext == "fastqsanger": -Q 33 #end if @@ -61,22 +61,22 @@ GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT +CSHL_4_FC042GAMMII_2_1_517_596 40 40 40 40 40 40 40 40 40 40 38 40 40 40 40 40 14 40 40 40 40 40 36 40 13 14 24 24 9 24 9 40 10 10 15 40 - + Will be converted to FASTA (with 'rename sequence names' = NO):: >CSHL_4_FC042GAMMII_2_1_517_596 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT - + Will be converted to FASTA (with 'rename sequence names' = YES):: >1 GGTCAATGATGAGTTGGCACTGTAGGCACCATCAAT - + ------ This tool is based on `FASTX-toolkit`__ by Assaf Gordon. - .. __: http://hannonlab.cshl.edu/fastx_toolkit/ + .. __: http://hannonlab.cshl.edu/fastx_toolkit/ </help> <!-- FASTQ-to-FASTA is part of the FASTX-toolkit, by A.Gordon (gordon@cshl.edu) --> </tool> |
| b |
| diff -r 04614cf6ed39 -r 186b8d913e6c tool_dependencies.xml --- a/tool_dependencies.xml Wed Sep 25 11:04:26 2013 -0400 +++ b/tool_dependencies.xml Wed Nov 11 12:38:08 2015 -0500 |
| b |
| @@ -1,6 +1,6 @@ <?xml version="1.0"?> <tool_dependency> <package name="fastx_toolkit" version="0.0.13"> - <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="http://toolshed.g2.bx.psu.edu" /> + <repository changeset_revision="ec66ae4c269b" name="package_fastx_toolkit_0_0_13" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> </tool_dependency> |