Next changeset 1:4768f7f8e93f (2023-02-17) |
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bakta/integron_finder commit 6e0d10965c02c249844f1eddd1c7442990695a6a |
added:
integron_finder.xml macro.xml test-data/covar.txt test-data/input.fasta test-data/integron_log test-data/integrons_table.tsv test-data/summary.tsv test-data/test10_integrons_table.tsv test-data/test1_integron_log test-data/test1_integrons_table.tsv test-data/test1_summary.tsv test-data/test2_integron_log test-data/test2_integrons_table.tsv test-data/test2_summary.tsv test-data/test3_integron_log test-data/test3_integrons_table.tsv test-data/test4_integrons_table.tsv test-data/test5_integrons_table.tsv test-data/test5_summary.tsv test-data/test6_integrons_table.tsv test-data/test7_integrons_table.tsv test-data/test8_integrons_table.tsv test-data/test9_integrons_table.tsv test-data/test9_summary.tsv test-data/topology.txt |
b |
diff -r 000000000000 -r 1ae00120dd24 integron_finder.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/integron_finder.xml Thu Sep 22 13:51:14 2022 +0000 |
[ |
b'@@ -0,0 +1,228 @@\n+<tool id="integron_finder" name="Integron Finder" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="@PROFILE@">\n+ <description> is a program that detects integrons in DNA sequences</description>\n+ <macros>\n+ <import>macro.xml</import>\n+ </macros>\n+ <expand macro="edam_info"/>\n+ <expand macro="xrefs"/>\n+ <expand macro="requirements"/>\n+ <command detect_errors="aggressive"><![CDATA[\n+ integron_finder\n+ \'$sequence\'\n+ --cpu @THREADS@\n+ --keep-tmp\n+ $local_max\n+ #if $type_replicon\n+ $type_replicon\n+ #end if\n+ #if $topology_file\n+ --topology-file \'$topology_file\'\n+ #end if\n+ $promoter_attI\n+ -dt $settings.attc_settings.dist_thresh\n+ --calin-threshold $settings.attc_settings.calin_threshold\n+ --max-attc-size $settings.attc_settings.max_attc_size\n+ --min-attc-size $settings.attc_settings.min_attc_size\n+ $settings.attc_settings.keep_palindromes\n+ #if $settings.attc_settings.covar_matrix\n+ --attc-model \'$settings.attc_settings.covar_matrix\'\n+ #end if\n+ $settings.protein_settings.no_proteins\n+ $settings.protein_settings.union_integrases\n+ $settings.protein_settings.func_annot\n+ $gbk\n+ $pdf\n+ && mv Results_Integron_Finder_* Results_Integron_Finder\n+ ]]></command>\n+ <inputs>\n+ <param type="data" name="sequence" format="fasta" label="Replicon file" help="Replicon can be entire chromosome, contif, PCR fragments..." />\n+ <param name="local_max" argument="--local-max" type="boolean" checked="false" truevalue="--local-max" falsevalue="" label="Thorough local detection" help="This option allows a more sensitive search. I will be slower (dependant on the number of hits) if integrons are found, but will be as fast if nothing is detected and will not increase the false positive rate." />\n+\t <param name="type_replicon" type="select" optional="true" label="Default replicons topology" help="Set the default topology for replicons, linear, circular (deault: no topology)">\n+\t <option value="--linear">linear (--linear)</option>\n+\t <option value="--circ">circular (--circ)</option>\n+\t </param>\n+ <param name="topology_file" argument="--topology-file" type="data" format="txt" optional="true" label="Select a topology file from your history"/>\n+ <param name="promoter_attI" argument="--promoter-attI" type="boolean" checked="false" truevalue="--promoter-attI" falsevalue="" label="Search also for promoter and attI sites?" />\n+ <param argument="--gbk" type="boolean" checked="false" truevalue="--gbk" falsevalue="" label="Genbank output?" help="Generate a GenBank file with the sequence annotated with the same annotations than .integrons file."/>\n+ <param argument="--pdf" type="boolean" checked="false" truevalue="--pdf" falsevalue="" label="pdf output?" help="For each complete integron, a simple graphic of the region is depicted (in pdf format)"/>\n+ <section name="settings" title="Advanced Parameters" expanded="False">\n+ <section name="attc_settings" title="Attc options" expanded="False">\n+ <param name="dist_thresh" argument="--distance-thresh" type="integer" value="4000" label="Threshold for clustering (in base)" min="0" help="By default, to cluster an array of attC sites and an integron integrase, they must be less than 4 kb apart. You can here change this value." />\n+ <param name="calin_threshold" type="integer" value="2" label="Threshold to filter CALIN" min="0" help="Keep \'CALIN\' only if attC sites number >= calin-threshold" />\n+ <param name="max_attc_size" type="integer" value="200" label="Maximum value for attC size" min="0"/>\n+ <param name="min_attc_size" type="integer" value="40" label="Minimum value for attC size" min="0" />\n+ <param name="keep_palindromes'..b' expect_num_outputs="2">\n+ <param name="sequence" value="input.fasta"/>\n+ <param name="no_logfile" value="true"/>\n+ <section name="settings">\n+ <section name="attc_settings">\n+ <param name="dist_thresh" value="2000"/>\n+ <param name="calin_threshold" value="3"/>\n+ <param name="max_attc_size" value="188"/>\n+ <param name="min_attc_size" value="30"/>\n+ <param name="keep_palindromes" value=""/>\n+ </section>\n+ </section>\n+ <output name="integrons_table" value="test7_integrons_table.tsv" lines_diff="3" />\n+ <output name="summary" value="summary.tsv" lines_diff="3" />\n+ </test>\n+ <test expect_num_outputs="2">\n+ <param name="sequence" value="input.fasta"/>\n+ <param name="no_logfile" value="true"/>\n+ <section name="settings">\n+ <section name="attc_settings">\n+ <param name="covar_matrix" value="covar.txt"/>\n+ </section>\n+ </section>\n+ <output name="integrons_table" value="test8_integrons_table.tsv" lines_diff="10" />\n+ <output name="summary" value="summary.tsv" lines_diff="3" />\n+ </test>\n+ <test expect_num_outputs="2">\n+ <param name="sequence" value="input.fasta"/>\n+ <param name="no_logfile" value="true"/>\n+ <section name="settings">\n+ <section name="protein_settings">\n+ <param name="no_proteins" value="true"/>\n+ </section>\n+ </section>\n+ <output name="integrons_table" value="test9_integrons_table.tsv" lines_diff="3" />\n+ <output name="summary" value="test9_summary.tsv" lines_diff="3" />\n+ </test>\n+ <test expect_num_outputs="2">\n+ <param name="sequence" value="input.fasta"/>\n+ <param name="no_logfile" value="true"/>\n+ <section name="settings">\n+ <section name="protein_settings">\n+ <param name="union_integrases" value="true" />\n+ <param name="func_annot" value="true"/>\n+ </section>\n+ </section>\n+ <output name="integrons_table" value="test10_integrons_table.tsv" lines_diff="3" />\n+ <output name="summary" value="summary.tsv" lines_diff="3" />\n+ </test>\n+ </tests>\n+ <help><![CDATA[\n+\n+How does it work ?\n+==================\n+\n+- First, IntegronFinder annotates the DNA sequence\'s CDS with Prodigal.\n+\n+- Second, IntegronFinder detects independently integron integrase and *attC*\n+ recombination sites. The Integron integrase is detected by using the intersection\n+ of two HMM profiles:\n+\n+ - one specific of tyrosine-recombinase (PF00589)\n+ - one specific of the integron integrase, near the patch III domain of tyrosine recombinases.\n+\n+The *attC* recombination site is detected with a covariance model (CM), which\n+models the secondary structure in addition to the few conserved sequence\n+positions.\n+\n+\n+- Third, the results are integrated, and IntegronFinder distinguishes 3 types of\n+ elements:\n+\n+ - complete integron\n+ Integron with integron integrase nearby *attC* site(s)\n+ - In0 element\n+ Integron integrase only, without any *attC* site nearby\n+ - CALIN element\n+ Cluster of *attC* sites Lacking INtegrase nearby.\n+ A rule of thumb to avoid false positive is to filter out singleton of\n+ *attC* site.\n+\n+IntegronFinder can also annotate gene cassettes (CDS nearby *attC* sites) using\n+Resfams, a database of HMM profiles aiming at annotating antibiotic resistance\n+genes. This database is provided but the user can add any other HMM profiles\n+database of its own interest.\n+\n+When available, IntegronFinder annotates the promoters and attI sites by pattern\n+matching.\n+ ]]></help>\n+ <expand macro="citations"/>\n+</tool>\n' |
b |
diff -r 000000000000 -r 1ae00120dd24 macro.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macro.xml Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,40 @@ +<macros> + <token name="@TOOL_VERSION@">2.0.2</token> + <token name="@VERSION_SUFFIX@">0</token> + <token name="@PROFILE@">21.05</token> + <token name="@THREADS@">\${GALAXY_SLOTS:-2}</token> + <xml name="requirements"> + <requirements> + <requirement type="package" version="3.3.2">hmmer</requirement> + <requirement type="package" version="1.1.4">infernal</requirement> + <requirement type="package" version="2.6.3">prodigal</requirement> + <requirement type="package" version="@TOOL_VERSION@">integron_finder</requirement> + </requirements> + </xml> + <xml name="edam_info"> + <edam_topics> + <edam_topic>topic_0085</edam_topic> + <edam_topic>topic_0798</edam_topic> + <edam_topic>topic_3047</edam_topic> + <edam_topic>topic_0091</edam_topic> + <edam_topic>topic_0080</edam_topic> + </edam_topics> + <edam_operations> + <edam_operation>operation_0239</edam_operation> + <edam_operation>operation_3430</edam_operation> + <edam_operation>operation_3087</edam_operation> + <edam_operation>operation_0362</edam_operation> + </edam_operations> + </xml> + <xml name="xrefs"> + <xrefs> + <xref type='bio.tools'>integron_finder</xref> + </xrefs> + </xml> + + <xml name="citations"> + <citations> + <citation type="doi">10.1101/2022.02.28.482270 </citation> + </citations> + </xml> +</macros> |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/covar.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/covar.txt Thu Sep 22 13:51:14 2022 +0000 |
[ |
b'@@ -0,0 +1,377 @@\n+INFERNAL1/a [1.1 | October 2013]\n+NAME attC_4\n+STATES 145\n+NODES 35\n+CLEN 47\n+W 895\n+ALPH RNA\n+RF yes\n+CONS yes\n+MAP yes\n+DATE Mon Jan 19 20:03:31 2015\n+COM [1] cmbuild --hand attc_4.cm attc_train_set_4.sto\n+COM [2] cmcalibrate attc_4.cm\n+PBEGIN 0.05\n+PEND 0.05\n+WBETA 1e-07\n+QDBBETA1 1e-07\n+QDBBETA2 1e-15\n+N2OMEGA 1.52588e-05\n+N3OMEGA 1.52588e-05\n+ELSELF -0.08926734\n+NSEQ 96\n+EFFN 96.000000\n+CKSUM 3931512547\n+NULL 0.000 0.000 0.000 0.000\n+EFP7GF -9.9186 0.72993\n+ECMLC 0.63005 -4.33175 4.20996 1600000 260875 0.004600\n+ECMGC 0.41832 -12.02668 0.81138 1600000 85985 0.004652\n+ECMLI 0.58141 -4.10957 4.92170 1600000 228880 0.005243\n+ECMGI 0.42824 -10.63745 1.38026 1600000 68728 0.005820\n+CM\n+ [ ROOT 0 ] - - - - - -\n+ S 0 -1 0 1 6 1 2 895 1874 -12.592 -12.531 -0.002 -11.308 -11.588 -11.983\n+ IL 1 1 2 1 6 1 6 897 1875 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000\n+ IR 2 2 3 2 5 1 7 897 1875 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000\n+ [ MATP 1 ] 1 141 G C [ ]\n+ MP 3 2 3 7 6 2 17 896 1874 -12.592 -12.531 -0.002 -11.308 -11.588 -11.983 -3.249 -1.316 -1.827 1.518 -2.413 -6.970 -1.008 -1.669 -6.771 3.266 -7.041 -1.135 -0.432 -6.231 -1.090 -5.342\n+ ML 4 2 3 7 6 1 4 893 1872 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094\n+ MR 5 2 3 7 6 1 4 893 1871 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094\n+ D 6 2 3 7 6 0 0 887 1865 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319\n+ IL 7 7 5 7 6 1 6 895 1873 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000\n+ IR 8 8 6 8 5 1 6 895 1873 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000\n+ [ MATP 2 ] 2 140 c g R m\n+ MP 9 8 6 13 6 2 16 894 1872 -12.592 -12.531 -0.002 -11.308 -11.588 -11.983 -4.164 -4.362 -2.109 -0.857 -0.435 -2.882 2.773 -0.766 -4.417 1.213 -4.988 -2.366 1.504 -1.682 -0.391 -1.681\n+ ML 10 8 6 13 6 1 4 891 1870 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094\n+ MR 11 8 6 13 6 1 4 891 1869 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094\n+ D 12 8 6 13 6 0 0 885 1864 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319\n+ IL 13 13 5 13 6 1 6 893 1871 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 0.000 0.000 0.000 0.000\n+ IR 14 14 6 14 5 1 6 893 1871 -2.408 -0.496 -5.920 -4.087 -5.193 0.000 0.000 0.000 0.000\n+ [ MATP 3 ] 3 139 C G s i\n+ MP 15 14 6 19 6 2 14 892 1870 -12.592 -12.531 -0.002 -11.308 -11.588 -11.983 -1.807 -6.286 -6.486 1.123 -2.471 -7.327 3.283 -0.390 -6.409 -2.191 -2.297 -4.092 0.801 -6.656 -1.251 -2.606\n+ ML 16 14 6 19 6 1 4 889 1868 -6.250 -6.596 -1.310 -1.005 -6.446 -3.975 0.368 -0.385 -0.191 0.094\n+ MR 17 14 6 19 6 1 3 889 1867 -6.988 -5.717 -1.625 -5.695 -0.829 -3.908 0.368 -0.385 -0.191 0.094\n+ D 18 14 6 19 6 0 0 884 1862 -9.049 -7.747 -3.544 -4.226 -4.244 -0.319\n+ IL 19 19 5 19 6 1 5 891 1869 -2.579 -2.842 -0.760 -4.497 -5.274 -4.934 '..b'1.46634 0.26236 1.09861 0.40547\n+ 26 3.71435 3.19641 2.84131 0.13197 120 U p - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 27 3.18123 2.23054 1.18098 0.60877 121 U r - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 28 0.12234 4.14596 3.30449 2.77083 122 A i - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 29 0.95560 2.00635 1.26122 1.62135 123 a m - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 30 2.43472 0.49870 1.89972 1.86145 124 C ] - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 31 2.36885 1.91431 2.24466 0.42617 125 U = - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 32 1.99009 0.61165 1.59584 2.13601 126 C = - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 33 1.12677 1.78023 0.92633 2.19536 127 g = - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 34 1.00976 2.60221 0.63685 3.42260 128 G = - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03382 6.88959 3.43454 1.46634 0.26236 1.09861 0.40547\n+ 35 1.59086 0.80252 1.35196 2.41555 129 c = - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.44710 6.85787 1.02314 1.46634 0.26236 3.51631 0.03016\n+ 36 3.12832 0.30189 2.27881 2.16819 130 C = - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 2.11131 6.41406 0.13093 1.46634 0.26236 5.92595 0.00267\n+ 37 0.57651 1.86795 1.86012 2.05532 131 A = - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.27640 4.32946 1.47704 1.46634 0.26236 6.81245 0.00110\n+ 38 2.96395 2.86913 3.49326 0.14939 132 U = - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03415 4.08721 4.08721 1.46634 0.26236 6.83026 0.00108\n+ 39 2.96395 2.86913 3.49326 0.14939 133 U = - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03415 4.08721 4.08721 1.46634 0.26236 6.83026 0.00108\n+ 40 3.29366 0.12992 3.86188 2.75374 134 C = - -\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.03415 4.08721 4.08721 1.46634 0.26236 0.00967 4.64385\n+ 41 5.61227 6.76634 0.00620 6.58877 135 G [ - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00205 6.88254 6.88254 1.46634 0.26236 0.22559 1.59970\n+ 42 7.50523 6.97196 6.53815 0.00294 136 U R - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 43 7.47647 6.84256 6.54333 0.00308 137 U p - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 44 0.12946 3.82317 2.57597 3.75121 138 A r - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 45 1.95767 3.97633 0.44327 1.61886 139 G i - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 46 1.46810 1.73501 0.72259 2.22795 140 g m - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00204 6.88959 6.88959 1.46634 0.26236 1.09861 0.40547\n+ 47 2.71772 0.47057 2.52869 1.47157 141 C ] - >\n+ 1.38629 1.38629 1.38629 1.38629\n+ 0.00102 6.88857 * 1.46634 0.26236 0.00000 *\n+//\n' |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/input.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/input.fasta Thu Sep 22 13:51:14 2022 +0000 |
b |
b'@@ -0,0 +1,340 @@\n+>ACBA.007.P01_13 08-JUN-2013 20301 bp Acinetobacter baumannii MDR-ZJ06 plasmid pMDR-ZJ06, complete\n+TGCTGCTTGGATGCCCGAGGCATAGACTGTACAAAAAAACAGTCATAACAAGCCATGAAA\n+ACCGCCACTGCGCCGTTACCACCGCTGCGTTCGGTCAAGGTTCTGGACCAGTTGCGTGAG\n+CGCATACGCTACTTGCATTACAGTTTACGAACCGAACAGGCTTATGTCAACTGGGTTCGT\n+GCCTTCATCCGTTTCCACGGTGTGCGTCACCCGGCAACCTTGGGCAGCAGCGAAGTCGAG\n+GCATTTCTGTCCTGGCTGGCGAACGAGCGCAAGGTTTCGGTCTCCACGCATCGTCAGGCA\n+TTGGCGGCCTTGCTGTTCTTCTACGGCAAGGTGCTGTGCACGGATCTGCCCTGGCTTCAG\n+GAGATCGGAAGACCTCGGCCGTCGCGGCGCTTGCCGGTGGTGCTGACCCCGGATGAAGTG\n+GTTCGCATCCTCGGTTTTCTGGAAGGCGAGCATCGTTTGTTCGCCCAGCTTCTGTATGGA\n+ACGGGCATGCGGATCAGTGAGGGTTTGCAACTGCGGGTCAAGGATCTGGATTTCGATCAC\n+GGCACGATCATCGTGCGGGAGGGCAAGGGCTCCAAGGATCGGGCCTTGATGTTACCCGAG\n+AGCTTGGCACCCAGCCTGCGCGAGCAGCTGTCGCGTGCACGGGCATGGTGGCTGAAGGAC\n+CAGGCCGAGGGCCGCAGCGGCGTTGCGCTTCCCGACGCCCTTGAGCGGAAGTATCCGCGC\n+GCCGGGCATTCCTGGCCGTGGTTCTGGGTTTTTGCGCAGCACACGCATTCGACCGATCCA\n+CGGAGCGGTGTCGTGCGTCGCCATCACATGTATGACCAGACCTTTCAGCGCGCCTTCAAA\n+CGTGCCGTAGAAGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAA\n+GGCCTTACATTTCAAAAACTCTGCTTACCAGGCGCATTTCGCCCAGGGGATCACCATAAT\n+AAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACGCATCACCTCAATACCTTTGATGGTGG\n+CGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGTTGATTATCCGTTTCAGTTTGC\n+CATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACG\n+GGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCG\n+TGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACC\n+GGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGC\n+TGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCA\n+TGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTT\n+CAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTT\n+CAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGG\n+CCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCA\n+TCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCCAAGCGCGG\n+TGTCCGGAATTTCAGGTTTGTGTCTCTACAAAGACTAACTATCAGAAAAACTCATCGAGC\n+ATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGC\n+CGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGG\n+TATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCA\n+AAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGC\n+AAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCA\n+AAATCACTAGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGACGAAAT\n+ACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAAC\n+ACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAAT\n+GCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAA\n+TGCTTGATAGTCGGAAGAGGCATAAATGCCGTCAGCCAGTTTAGTCTGACCATCTCATCT\n+GTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATTGGGC\n+TTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATCTA\n+TACCCATATAAATCAGCATCCAGGTTGGAATTTAATCGCGGCCTCGAGCAAGACGTTTCC\n+CGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATT\n+GTTCATGATGATATATTTTTATCGGCACTGTTGCAAATAGTCGGTGGTGATAAACTTATC\n+ATCCCCTTTTGCTGATGGAGCTGCACATGAACCCATTCAAAGGCCGGCATTTTCAGCGTG\n+ACATCATTCTGTGGGCCGTACGCTGGTACTGCAAATACGGCACTGTTGCAAAGTTAGCGA\n+TGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACATTTCAAAAACTCTGCTTACCAGGCG\n+CATTTCGCCCAGGGGATCACCATAATAAAATGCTGAGGCCTGGCCTTTGCGTAGTGCACG\n+CATCACCTCAATACCTTTGATGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGT\n+GGCGTTGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTT\n+AATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGC\n+GCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCAC\n+GTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAG\n+ATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCC\n+ATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCA\n+GTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGT\n+GGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGAT\n+GCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCC\n+TTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCG\n+ACTATTTGCAACAGTGCCGTGTACATCGAAATACGGCTTATCAGGCGTTAAAAGATGCTT\n+GCGATGACTTGTTTGCAAGACAATTCAGTTATCAGAGTCTTAGTGAAAAAGGTAACACTA\n+TTAATCACAAATCAAGATGGGTGAGCGAGGTGGCTTATATTGATAATGAAGCTGTCGTTA\n+GACTTATTTTTGCCCCTGCTATTGTGCCTTTAATTA'..b'TCTTCAA\n+CGCCATCACACAAAACTTTCTTTTTCACGCACAGTCAACTTATTGGATGTTTTATTAACA\n+ACCCAAAAGGAGATATTTAGCGGGCGGCCGGAAGGTGAATGCTAGGCATGATCTAACCCT\n+CGGTCTCTGGCGTCGCGACTGCGAAATTTCGCGAGGGTTTCCGAGAAGGTGATTGCGCTT\n+CGCAGATCTCCAGGCGCGTGGGTGCGGACGTAGTCAGCGCCATTGCCGATCGCGTGAAGT\n+TCCGCCGCAAGGCTCGCTGGACCCAGATCCTTTACAGGAAGGCCAACGGTGGCGCCCAAG\n+AAGGATTTCCGCGACACCGAGACCAATAGCGGAAGCCCCAACGCCGACTTCAGCTTTTGA\n+AGGTTCGACAGCACGTGCAGCGATGTTTCCGGTGCGGGGCTCAAGAAAAATCCCATCCCC\n+GGATCGAGGATGAGCCGGTCGGCAGCGACCCCGCTCCGTCGCAAGGCGGAAACCCGCGCC\n+TCGAAGAACCGCACAATCTCGTCGAGCGCGTCTTCGGGTCGAAGGTGACCGGTGCGGGTG\n+GCGATGCCATCCCGCTGCGCTGAGTGCATAACCACCAGCCTGCAGTCCGCCTCAGCAATA\n+TCGGGATAGAGCGCAGGGTCAGGAAATCCTTGGATATCGTTCAGGTAGCCCACGCCGCGC\n+TTGAGCGCATAGCGCTGGGTTTCCGGTTGGAAGCTGTCGATTGAAACACGGTGCATCTGA\n+TCGGACAGGGCGTCTAAGAGCGGCGCAATACGTCTGATCTCATCGGCCGGCGATACAGGC\n+CTCGCGTCCGGATGGCTGGCGGCCGGTCCGACATCCACGACGTCTGATCCGACTCGCAGC\n+ATTTCGATCGCCGCGGTGACAGCGCCGGCGGGGTCTAGCCGCCGGCTCTCATCGAAGAAG\n+GAGTCCTCGGTGAGATTCAGAATGCCGAACACCGTCACCATGGCGTCGGCCTCCGCAGCG\n+ACTTCCACGATGGGGATCGGGCGAGCAAAAAGGCAGCAATTATGAGCCCCATACCTACAA\n+AGCCCCACGCATCAAGCTTTTGCCCATGAAGCAACCAGGCAATGGCTGTAATTATGACGA\n+CGCCGAGTCCCGACCAGACTGCATAAGCAACACCGACAGGGATGGATTTCAGAACCAGAG\n+AAAGAAAATAAAATGCGATGCCATAACCGATTATGACAACGGCGGAAGGGGCAAGCTTAG\n+TAAAGCCCTCGCTAGATTTTAATGCGGATGTTGCGATTACTTCGCCAACTATTGCGATAA\n+CAAGAAAAAGCCAGCCTTTCATGATATATCTCCCAATTTGTGTAGGGCTTATTATGCACG\n+CTTAAAAATAATAAAAGCAGACTTGACCTGATAGTTTGGCTGTGAGCAATTATGTGCTTA\n+GTGCATCTAACGCTTGAGTTAAGCCGCGCCGCGAAGCGGCGTCGGCTTGAACGAATTGTT\n+AGACATTATTTGCCGACTACCTTGGTGATCTCGCCTTTCACGTAGTGGACAAATTCTTCC\n+AACTGATCTGCGCGCGAGGCCAAGCGATCTTCTTCTTGTCCAAGATAAGCCTGTCTAGCT\n+TCAAGTATGACGGGCTGATACTGGGCCGGCAGGCGCTCCATTGCCCAGTCGGCAGCGACA\n+TCCTTCGGCGCGATTTTGCCGGTTACTGCGCTGTACCAAATGCGGGACAACGTAAGCACT\n+ACATTTCGCTCATCGCCAGCCCAGTCGGGCGGCGAGTTCCATAGCGTTAAGGTTTCATTT\n+AGCGCCTCAAATAGATCCTGTTCAGGAACCGGATCAAAGAGTTCCTCCGCCGCTGGACCT\n+ACCAAGGCAACGCTATGTTCTCTTGCTTTTGTCAGCAAGATAGCCAGATCAATGTCGATC\n+GTGGCTGGCTCGAAGATACCTGCAAGAATGTCATTGCGCTGCCATTCTCCAAATTGCAGT\n+TCGCGCTTAGCTGGATAACGCCACGGAATGATGTCGTCGTGCACAACAATGGTGACTTCT\n+ACAGCGCGGAGAATCTCGCTCTCTCCAGGGGAAGCCGAAGTTTCCAAAAGGTCGTTGATC\n+AAAGCTCGCCGCGTTGTTTCATCAAGCCTTACGGTCACCGTAACCAGCAAATCAATATCA\n+CTGTGTGGCTTCAGGCCGCCATCCACTGCGGAGCCGTACAAATGTACGGCCAGCAACGTC\n+GGTTCGAGATGGCGCTCGATGACGCCAACTACCTCTGATAGTTGAGTCGATACTTCGGCG\n+ATCACCGCTTCCCTCATGATGTTTAACGCCCAGCTTCAGACGCGCGGAGGCCGTAAGGCC\n+GTAGCGTCGGCTGGAAGCATTGGTTAGAGCATGAGCGATTTACTGTATTCATGGCTTTCG\n+AAAAATTGTATCTGCACAGGTTGCTAGTACGACGTACACAATAGGCCCGAGCAGTATGAG\n+CGCCGCCCAGCCCTGAGGAGAACTTGGCGCTTTACCCGCGTAGGTGACGATCTCCACCAC\n+CAGTAGCGCCCAGGCCGCAAGGAATATGGCGATGTTTCGCGGCCTTAACCAAGTGCGCTT\n+CTGAGCCTTGTCTAGAAGATTCACCACGTCACTACCGTCAAAGAAGTGGTGGCCGCAGTG\n+AGCGCAACGATGTGCATCTACGAAATTCTGGCGGCCACAGCGTGCGCAGTTCATTTTTGC\n+TCTAACGCCCTAGCTAAGCCGACGGACAGCCCGCAGGGCTGGCCGGTCGGCTTGAGCGCC\n+ATGTTGGGCGACAACTGCCTTGCGCATTGCATACCTACGGAACATGACGCCTCCACGGGA\n+GACATTTTGCTCCTCAACTACACTGAAACCATGCCGCAGGAAAAAGGGCTTGGCGACCAG\n+ACTGGCTTCTGTGAAGAGCGAAACACCTGGGAGGGCTTTCTCAACCTCACGGTACAGAAC\n+AGACGCGACGCCCCGACGCTCGGAACCCGGTGCGGTGTAAAGAAACTCGATGTGGCCGCT\n+AAGCTCGTAAGAGATGAACCCGATAACCGCATCTCCCTCAATTGCTAGAAGAGTCTGTAG\n+GCCAGATAAGCGAGCTGACCAAGCCTCTATATCTGCGGGACGCGGTGCCCACGCATTCCT\n+TTGCGAAGCGTCATAGTGAGACGCTCCAAGTACATGAATAGACTCAGTAAATACGACTGC\n+GATAGAGGCGACGTCAGATTCAGTGCAAGTGCGTACGTTCATATCGGTTTTCTTGTTGCC\n+CAACGCCTGAGTTAAGCCGGAGCGCTTTGCGGCCGCGGCGTTGTGACAATTTTTCCGAAC\n+AACTCCGCGGCCGCGAAGCGATCTCGGCTTGAACGAATTGTTAGGTGGCGGTACTTGGGT\n+CGATATCAAAGTGCATCACTTCTTCCCGTATGCCCAACTTTGTATAGAGAGCCACTGCGG\n+GATCGTCACCGTAATCTGCTTGCACGTAGATCACATAAGCACCAAGCGCGTTGGCCTCAT\n+GCTTGAGGAGATTGATGAGCGCGGTGGCAATGCCTTGCCTCCGGTGCTCGCCGGAGACTG\n+CGAGATCATAGATATAGATCTCACTACGCGCCTGCTCAAACTTTGGCAGAACGTAAGCCG\n+CGAGAGCGCCAACAACCGCTTCTTGGTCGAAGGCAGCAAGCGCGATGAATGTCTTACTAC\n+GGAGCAAGTTCCCGAGGTAATCGGAGTCCGGCTGATGTTGGGAGTAGGTGGCTACGTCTC\n+CGAACTCACGACCGAAAAGATCAAGAGCAGCCCTCATGGATTTGACTTGGTCAGGGCCGA\n+GCCTACATGTGCGAATGATGCCCATACTTGAGCCACCTAACTTTGTTTTAGGGCGACTGC\n+CCTGCTGCGTAACATCGTTGCTGCTGCGTAACATCGTTGCTGCTCCATAACATCAAACAT\n+CGACCCACGGCGTAACGCGCT\n' |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/integron_log --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/integron_log Thu Sep 22 13:51:14 2022 +0000 |
[ |
@@ -0,0 +1,73 @@ + +************************************************************************** + ___ _ _____ _ _ +|_ _|_ __ | |_ ___ __ _ _ __ ___ _ __ | ___(_)_ __ __| | ___ _ __ + | || '_ \| __/ _ \/ _` | '__/ _ \| '_ \ | |_ | | '_ \ / _` |/ _ \ '__| + | || | | | || __/ (_| | | | (_) | | | | | _| | | | | | (_| | __/ | +|___|_| |_|\__\___|\__, |_| \___/|_| |_| |_| |_|_| |_|\__,_|\___|_| + |___/ + +************************************************************************** + +integron_finder version 2.0.2 +Using: + - Python 3.9.13 | packaged by conda-forge | (main, May 27 2022, 16:58:50) [GCC 10.3.0] + - numpy 1.19.4 + - pandas 1.1.5 + - matplolib 3.3.3 + - biopython 1.78 + + - Prodigal V2.6.3: February, 2016 + - INFERNAL 1.1.4 (Dec 2020) + - HMMER 3.3.2 (Nov 2020); http://hmmer.org/ + +Authors: + - Jean Cury, Bertrand Neron, Eduardo Rocha, + +Citation: + + Néron, B.; Littner, E.; Haudiquet, M.; Perrin, A.; Cury, J.; Rocha, E.P.C. + IntegronFinder 2.0: Identification and Analysis of Integrons across Bacteria, with a Focus on Antibiotic Resistance in Klebsiella. + Microorganisms 2022, 10, 700. https://doi.org/10.3390/microorganisms10040700 + + If you use --func-annot in conjunction with file NCBIfam-AMRFinder.hmm please also cite + + Haft, DH et al., Nucleic Acids Res. 2018 Jan 4;46(D1):D851-D860 + PMID: 29112715 + + + ======================= + +integron_finder is free software: you can redistribute it and/or modify +it under the terms of the GNU General Public License as published by +the Free Software Foundation, either version 3 of the License, or +(at your option) any later version. + +integron_finder is distributed in the hope that it will be useful, +but WITHOUT ANY WARRANTY; without even the implied warranty of +MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +GNU General Public License for more details. + +You should have received a copy of the GNU General Public License +along with this program (COPYING file). +If not, see <http://www.gnu.org/licenses/>. + + ======================= + +command used: integron_finder /tmp/tmp3_ir6t5a/files/7/8/a/dataset_78ad162b-8ddf-4d54-a7e8-be6ee3804d0a.dat --cpu 1 --keep-tmp -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 + + ======================= + +[0m +INFO : ############ Processing replicon ACBA.007.P01_13 (1/1) ############ + +INFO : Starting Default search ... : +INFO : Default search done... : +INFO : In replicon ACBA.007.P01_13, there are: +INFO : - 1 complete integron(s) found with a total 3 attC site(s) +INFO : - 0 CALIN element(s) found with a total of 0 attC site(s) +INFO : - 0 In0 element(s) found with a total of 0 attC site +INFO : Adding proteins ... : +INFO : Writing out results for replicon ACBA.007.P01_13 +INFO : Merging integrons results. + |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/integrons_table.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/integrons_table.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,10 @@ +# cmd: integron_finder /tmp/tmpkclck5y7/files/3/6/4/dataset_3649b3c6-dc10-47e0-9968-13ce47e5dce0.dat --cpu 1 --keep-tmp -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 --union-integrases --func-annot +ID_integron ID_replicon element pos_beg pos_end strand evalue type_elt annotation model type default distance_2attC considered_topology +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_1 55 1014 1 1.9000000000000001e-25 protein intI intersection_tyr_intI complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_20 17375 17722 -1 9.799999999999998e-65 protein SMR_qac_E-NCBIFAM NF000276.2 complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_001 17825 17884 -1 1e-09 attC attC attc_4 complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_21 17886 18665 -1 2.7999999999999994e-183 protein ANT_3pp_AadA1-NCBIFAM NF033126.1 complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_002 19080 19149 -1 0.0001 attC attC attc_4 complete Yes 1196.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_22 19090 19749 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_003 19618 19726 -1 1.1e-07 attC attC attc_4 complete Yes 469.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_23 19721 20254 -1 7.899999999999999e-69 protein AAC_3_I-NCBIFAM NF033083.0 complete Yes NA circ |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/summary.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/summary.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,3 @@ +# cmd: integron_finder /tmp/tmp3_ir6t5a/files/c/d/d/dataset_cdd097ee-d7c0-4424-9c3c-3ddd5d20887a.dat --cpu 1 --keep-tmp -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 --union-integrases --func-annot +ID_replicon CALIN complete In0 topology size +ACBA.007.P01_13 0 1 0 circ 20301 |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test10_integrons_table.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test10_integrons_table.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,10 @@ +# cmd: integron_finder /tmp/tmp3_ir6t5a/files/c/d/d/dataset_cdd097ee-d7c0-4424-9c3c-3ddd5d20887a.dat --cpu 1 --keep-tmp -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 --union-integrases --func-annot +ID_integron ID_replicon element pos_beg pos_end strand evalue type_elt annotation model type default distance_2attC considered_topology +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_1 55 1014 1 1.9000000000000001e-25 protein intI intersection_tyr_intI complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_20 17375 17722 -1 9.799999999999998e-65 protein SMR_qac_E-NCBIFAM NF000276.2 complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_001 17825 17884 -1 1e-09 attC attC attc_4 complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_21 17886 18665 -1 2.7999999999999994e-183 protein ANT_3pp_AadA1-NCBIFAM NF033126.1 complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_002 19080 19149 -1 0.0001 attC attC attc_4 complete Yes 1196.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_22 19090 19749 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_003 19618 19726 -1 1.1e-07 attC attC attc_4 complete Yes 469.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_23 19721 20254 -1 7.899999999999999e-69 protein AAC_3_I-NCBIFAM NF033083.0 complete Yes NA circ |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test1_integron_log --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test1_integron_log Thu Sep 22 13:51:14 2022 +0000 |
[ |
@@ -0,0 +1,73 @@ + +************************************************************************** + ___ _ _____ _ _ +|_ _|_ __ | |_ ___ __ _ _ __ ___ _ __ | ___(_)_ __ __| | ___ _ __ + | || '_ \| __/ _ \/ _` | '__/ _ \| '_ \ | |_ | | '_ \ / _` |/ _ \ '__| + | || | | | || __/ (_| | | | (_) | | | | | _| | | | | | (_| | __/ | +|___|_| |_|\__\___|\__, |_| \___/|_| |_| |_| |_|_| |_|\__,_|\___|_| + |___/ + +************************************************************************** + +integron_finder version 2.0.2 +Using: + - Python 3.9.13 | packaged by conda-forge | (main, May 27 2022, 16:58:50) [GCC 10.3.0] + - numpy 1.19.4 + - pandas 1.1.5 + - matplolib 3.3.3 + - biopython 1.78 + + - Prodigal V2.6.3: February, 2016 + - INFERNAL 1.1.4 (Dec 2020) + - HMMER 3.3.2 (Nov 2020); http://hmmer.org/ + +Authors: + - Jean Cury, Bertrand Neron, Eduardo Rocha, + +Citation: + + Néron, B.; Littner, E.; Haudiquet, M.; Perrin, A.; Cury, J.; Rocha, E.P.C. + IntegronFinder 2.0: Identification and Analysis of Integrons across Bacteria, with a Focus on Antibiotic Resistance in Klebsiella. + Microorganisms 2022, 10, 700. https://doi.org/10.3390/microorganisms10040700 + + If you use --func-annot in conjunction with file NCBIfam-AMRFinder.hmm please also cite + + Haft, DH et al., Nucleic Acids Res. 2018 Jan 4;46(D1):D851-D860 + PMID: 29112715 + + + ======================= + +integron_finder is free software: you can redistribute it and/or modify +it under the terms of the GNU General Public License as published by +the Free Software Foundation, either version 3 of the License, or +(at your option) any later version. + +integron_finder is distributed in the hope that it will be useful, +but WITHOUT ANY WARRANTY; without even the implied warranty of +MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +GNU General Public License for more details. + +You should have received a copy of the GNU General Public License +along with this program (COPYING file). +If not, see <http://www.gnu.org/licenses/>. + + ======================= + +command used: integron_finder /tmp/tmpz_euzvww/files/1/d/e/dataset_1dee618f-a951-40e4-8697-ae8f535f1e8b.dat --cpu 1 --keep-tmp -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 + + ======================= + +[0m +INFO : ############ Processing replicon ACBA.007.P01_13 (1/1) ############ + +INFO : Starting Default search ... : +INFO : Default search done... : +INFO : In replicon ACBA.007.P01_13, there are: +INFO : - 1 complete integron(s) found with a total 3 attC site(s) +INFO : - 0 CALIN element(s) found with a total of 0 attC site(s) +INFO : - 0 In0 element(s) found with a total of 0 attC site +INFO : Adding proteins ... : +INFO : Writing out results for replicon ACBA.007.P01_13 +INFO : Merging integrons results. + |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test1_integrons_table.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test1_integrons_table.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,10 @@ +# cmd: integron_finder /tmp/tmp3_ir6t5a/files/7/8/a/dataset_78ad162b-8ddf-4d54-a7e8-be6ee3804d0a.dat --cpu 1 --keep-tmp -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 +ID_integron ID_replicon element pos_beg pos_end strand evalue type_elt annotation model type default distance_2attC considered_topology +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_1 55 1014 1 1.9000000000000001e-25 protein intI intersection_tyr_intI complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_20 17375 17722 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_001 17825 17884 -1 1e-09 attC attC attc_4 complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_21 17886 18665 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_002 19080 19149 -1 0.0001 attC attC attc_4 complete Yes 1196.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_22 19090 19749 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_003 19618 19726 -1 1.1e-07 attC attC attc_4 complete Yes 469.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_23 19721 20254 -1 NA protein protein NA complete Yes NA circ |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test1_summary.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test1_summary.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,3 @@ +# cmd: integron_finder /tmp/tmpz_euzvww/files/1/d/e/dataset_1dee618f-a951-40e4-8697-ae8f535f1e8b.dat --cpu 1 --keep-tmp -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 +ID_replicon CALIN complete In0 topology size +ACBA.007.P01_13 0 1 0 circ 20301 |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test2_integron_log --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test2_integron_log Thu Sep 22 13:51:14 2022 +0000 |
[ |
@@ -0,0 +1,79 @@ + +************************************************************************** + ___ _ _____ _ _ +|_ _|_ __ | |_ ___ __ _ _ __ ___ _ __ | ___(_)_ __ __| | ___ _ __ + | || '_ \| __/ _ \/ _` | '__/ _ \| '_ \ | |_ | | '_ \ / _` |/ _ \ '__| + | || | | | || __/ (_| | | | (_) | | | | | _| | | | | | (_| | __/ | +|___|_| |_|\__\___|\__, |_| \___/|_| |_| |_| |_|_| |_|\__,_|\___|_| + |___/ + +************************************************************************** + +integron_finder version 2.0.2 +Using: + - Python 3.9.13 | packaged by conda-forge | (main, May 27 2022, 16:58:50) [GCC 10.3.0] + - numpy 1.19.4 + - pandas 1.1.5 + - matplolib 3.3.3 + - biopython 1.78 + + - Prodigal V2.6.3: February, 2016 + - INFERNAL 1.1.4 (Dec 2020) + - HMMER 3.3.2 (Nov 2020); http://hmmer.org/ + +Authors: + - Jean Cury, Bertrand Neron, Eduardo Rocha, + +Citation: + + Néron, B.; Littner, E.; Haudiquet, M.; Perrin, A.; Cury, J.; Rocha, E.P.C. + IntegronFinder 2.0: Identification and Analysis of Integrons across Bacteria, with a Focus on Antibiotic Resistance in Klebsiella. + Microorganisms 2022, 10, 700. https://doi.org/10.3390/microorganisms10040700 + + If you use --func-annot in conjunction with file NCBIfam-AMRFinder.hmm please also cite + + Haft, DH et al., Nucleic Acids Res. 2018 Jan 4;46(D1):D851-D860 + PMID: 29112715 + + + ======================= + +integron_finder is free software: you can redistribute it and/or modify +it under the terms of the GNU General Public License as published by +the Free Software Foundation, either version 3 of the License, or +(at your option) any later version. + +integron_finder is distributed in the hope that it will be useful, +but WITHOUT ANY WARRANTY; without even the implied warranty of +MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +GNU General Public License for more details. + +You should have received a copy of the GNU General Public License +along with this program (COPYING file). +If not, see <http://www.gnu.org/licenses/>. + + ======================= + +command used: integron_finder /tmp/tmpz_euzvww/files/e/9/9/dataset_e996a731-6537-452b-87d7-09654e6d628a.dat --cpu 1 --keep-tmp --local-max -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 + + ======================= + +[0m +INFO : ############ Processing replicon ACBA.007.P01_13 (1/1) ############ + +INFO : Starting Default search ... : +INFO : Default search done... : +INFO : In replicon ACBA.007.P01_13, there are: +INFO : - 1 complete integron(s) found with a total 3 attC site(s) +INFO : - 0 CALIN element(s) found with a total of 0 attC site(s) +INFO : - 0 In0 element(s) found with a total of 0 attC site +INFO : Starting search with local_max...: +INFO : Search with local_max done... : +INFO : In replicon ACBA.007.P01_13, there are: +INFO : - 1 complete integron(s) found with a total 4 attC site(s) +INFO : - 0 CALIN element(s) found with a total of 0 attC site(s) +INFO : - 0 In0 element(s) found with a total of 0 attC site +INFO : Adding proteins ... : +INFO : Writing out results for replicon ACBA.007.P01_13 +INFO : Merging integrons results. + |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test2_integrons_table.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test2_integrons_table.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,18 @@ +# cmd: integron_finder /tmp/tmp3_ir6t5a/files/d/8/b/dataset_d8bd8cc0-78f5-4a59-b73a-d6819c72d20b.dat --cpu 1 --keep-tmp --local-max --linear -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 +ID_integron ID_replicon element pos_beg pos_end strand evalue type_elt annotation model type default distance_2attC considered_topology +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_1 55 1014 1 1.9000000000000001e-25 protein intI intersection_tyr_intI complete No NA lin +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_2 905 1609 -1 NA protein protein NA complete No NA lin +integron_01 ACBA.007.P01_13 attc_001 1453 1504 1 0.31 attC attC attc_4 complete No NA lin +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_3 1722 2537 -1 NA protein protein NA complete No NA lin +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_4 2667 2900 1 NA protein protein NA complete No NA lin +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_5 2791 3495 -1 NA protein protein NA complete No NA lin +integron_01 ACBA.007.P01_13 attc_002 3339 3390 1 0.31 attC attC attc_4 complete No 1835.0 lin +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_6 3546 4313 1 NA protein protein NA complete No NA lin +integron_02 ACBA.007.P01_13 ACBA.007.P01_13_20 17375 17722 -1 NA protein protein NA CALIN No NA lin +integron_02 ACBA.007.P01_13 attc_001 17825 17884 -1 5.1e-10 attC attC attc_4 CALIN No NA lin +integron_02 ACBA.007.P01_13 ACBA.007.P01_13_21 17886 18665 -1 NA protein protein NA CALIN No NA lin +integron_02 ACBA.007.P01_13 attc_002 18681 18749 -1 0.016 attC attC attc_4 CALIN No 797.0 lin +integron_02 ACBA.007.P01_13 attc_003 19079 19149 -1 3.3e-05 attC attC attc_4 CALIN No 330.0 lin +integron_02 ACBA.007.P01_13 ACBA.007.P01_13_22 19090 19749 -1 NA protein protein NA CALIN No NA lin +integron_02 ACBA.007.P01_13 attc_004 19618 19726 -1 5.5e-08 attC attC attc_4 CALIN No 469.0 lin +integron_02 ACBA.007.P01_13 ACBA.007.P01_13_23 19721 20254 -1 NA protein protein NA CALIN No NA lin |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test2_summary.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test2_summary.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,3 @@ +# cmd: integron_finder /tmp/tmpz_euzvww/files/e/9/9/dataset_e996a731-6537-452b-87d7-09654e6d628a.dat --cpu 1 --keep-tmp --local-max -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 +ID_replicon CALIN complete In0 topology size +ACBA.007.P01_13 0 1 0 circ 20301 |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test3_integron_log --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test3_integron_log Thu Sep 22 13:51:14 2022 +0000 |
[ |
@@ -0,0 +1,73 @@ + +************************************************************************** + ___ _ _____ _ _ +|_ _|_ __ | |_ ___ __ _ _ __ ___ _ __ | ___(_)_ __ __| | ___ _ __ + | || '_ \| __/ _ \/ _` | '__/ _ \| '_ \ | |_ | | '_ \ / _` |/ _ \ '__| + | || | | | || __/ (_| | | | (_) | | | | | _| | | | | | (_| | __/ | +|___|_| |_|\__\___|\__, |_| \___/|_| |_| |_| |_|_| |_|\__,_|\___|_| + |___/ + +************************************************************************** + +integron_finder version 2.0.2 +Using: + - Python 3.9.13 | packaged by conda-forge | (main, May 27 2022, 16:58:50) [GCC 10.3.0] + - numpy 1.19.4 + - pandas 1.1.5 + - matplolib 3.3.3 + - biopython 1.78 + + - Prodigal V2.6.3: February, 2016 + - INFERNAL 1.1.4 (Dec 2020) + - HMMER 3.3.2 (Nov 2020); http://hmmer.org/ + +Authors: + - Jean Cury, Bertrand Neron, Eduardo Rocha, + +Citation: + + Néron, B.; Littner, E.; Haudiquet, M.; Perrin, A.; Cury, J.; Rocha, E.P.C. + IntegronFinder 2.0: Identification and Analysis of Integrons across Bacteria, with a Focus on Antibiotic Resistance in Klebsiella. + Microorganisms 2022, 10, 700. https://doi.org/10.3390/microorganisms10040700 + + If you use --func-annot in conjunction with file NCBIfam-AMRFinder.hmm please also cite + + Haft, DH et al., Nucleic Acids Res. 2018 Jan 4;46(D1):D851-D860 + PMID: 29112715 + + + ======================= + +integron_finder is free software: you can redistribute it and/or modify +it under the terms of the GNU General Public License as published by +the Free Software Foundation, either version 3 of the License, or +(at your option) any later version. + +integron_finder is distributed in the hope that it will be useful, +but WITHOUT ANY WARRANTY; without even the implied warranty of +MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the +GNU General Public License for more details. + +You should have received a copy of the GNU General Public License +along with this program (COPYING file). +If not, see <http://www.gnu.org/licenses/>. + + ======================= + +command used: integron_finder /tmp/tmpz_euzvww/files/4/3/f/dataset_43f32a10-119c-4fb5-bdaf-498b2d3b61b3.dat --cpu 1 --keep-tmp --linear -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 + + ======================= + +[0m +INFO : ############ Processing replicon ACBA.007.P01_13 (1/1) ############ + +INFO : Starting Default search ... : +INFO : Default search done... : +INFO : In replicon ACBA.007.P01_13, there are: +INFO : - 0 complete integron(s) found with a total 0 attC site(s) +INFO : - 1 CALIN element(s) found with a total of 3 attC site(s) +INFO : - 1 In0 element(s) found with a total of 0 attC site +INFO : Adding proteins ... : +INFO : Writing out results for replicon ACBA.007.P01_13 +INFO : Merging integrons results. + |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test3_integrons_table.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test3_integrons_table.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,10 @@ +# cmd: integron_finder /tmp/tmp3_ir6t5a/files/2/9/7/dataset_2978faa9-7392-48d8-9759-c12e419d7fe1.dat --cpu 1 --keep-tmp --circ -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 +ID_integron ID_replicon element pos_beg pos_end strand evalue type_elt annotation model type default distance_2attC considered_topology +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_1 55 1014 1 1.9000000000000001e-25 protein intI intersection_tyr_intI complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_20 17375 17722 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_001 17825 17884 -1 1e-09 attC attC attc_4 complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_21 17886 18665 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_002 19080 19149 -1 0.0001 attC attC attc_4 complete Yes 1196.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_22 19090 19749 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_003 19618 19726 -1 1.1e-07 attC attC attc_4 complete Yes 469.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_23 19721 20254 -1 NA protein protein NA complete Yes NA circ |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test4_integrons_table.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test4_integrons_table.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,10 @@ +# cmd: integron_finder /tmp/tmp3_ir6t5a/files/8/8/3/dataset_883ade04-f62d-4f17-85e7-122e7b43d339.dat --cpu 1 --keep-tmp --topology-file /tmp/tmp3_ir6t5a/files/d/7/c/dataset_d7c8e07c-4b44-480f-9059-a9bff8bf5be6.dat -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 +ID_integron ID_replicon element pos_beg pos_end strand evalue type_elt annotation model type default distance_2attC considered_topology +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_1 55 1014 1 1.9000000000000001e-25 protein intI intersection_tyr_intI In0 Yes NA lin +integron_02 ACBA.007.P01_13 ACBA.007.P01_13_20 17375 17722 -1 NA protein protein NA CALIN Yes NA lin +integron_02 ACBA.007.P01_13 attc_001 17825 17884 -1 1e-09 attC attC attc_4 CALIN Yes NA lin +integron_02 ACBA.007.P01_13 ACBA.007.P01_13_21 17886 18665 -1 NA protein protein NA CALIN Yes NA lin +integron_02 ACBA.007.P01_13 attc_002 19080 19149 -1 0.0001 attC attC attc_4 CALIN Yes 1196.0 lin +integron_02 ACBA.007.P01_13 ACBA.007.P01_13_22 19090 19749 -1 NA protein protein NA CALIN Yes NA lin +integron_02 ACBA.007.P01_13 attc_003 19618 19726 -1 1.1e-07 attC attC attc_4 CALIN Yes 469.0 lin +integron_02 ACBA.007.P01_13 ACBA.007.P01_13_23 19721 20254 -1 NA protein protein NA CALIN Yes NA lin |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test5_integrons_table.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test5_integrons_table.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,11 @@ +# cmd: integron_finder /tmp/tmp3_ir6t5a/files/a/8/c/dataset_a8c83ef3-ab8b-416f-adb8-54a6ba99e378.dat --cpu 1 --keep-tmp --promoter-attI -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 +ID_integron ID_replicon element pos_beg pos_end strand evalue type_elt annotation model type default distance_2attC considered_topology +integron_01 ACBA.007.P01_13 Pc_int1 25 51 -1 NA Promoter Pc_1 NA complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_1 55 1014 1 1.9000000000000001e-25 protein intI intersection_tyr_intI complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_20 17375 17722 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_001 17825 17884 -1 1e-09 attC attC attc_4 complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_21 17886 18665 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_002 19080 19149 -1 0.0001 attC attC attc_4 complete Yes 1196.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_22 19090 19749 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_003 19618 19726 -1 1.1e-07 attC attC attc_4 complete Yes 469.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_23 19721 20254 -1 NA protein protein NA complete Yes NA circ |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test5_summary.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test5_summary.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,3 @@ +# cmd: integron_finder /tmp/tmpz_euzvww/files/4/3/f/dataset_43f32a10-119c-4fb5-bdaf-498b2d3b61b3.dat --cpu 1 --keep-tmp --linear -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 +ID_replicon CALIN complete In0 topology size +ACBA.007.P01_13 1 0 1 lin 20301 |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test6_integrons_table.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test6_integrons_table.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,10 @@ +# cmd: integron_finder /tmp/tmp3_ir6t5a/files/4/3/2/dataset_432b6fe2-79b8-45f0-a295-e5ab18425476.dat --cpu 1 --keep-tmp -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 --gbk --pdf +ID_integron ID_replicon element pos_beg pos_end strand evalue type_elt annotation model type default distance_2attC considered_topology +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_1 55 1014 1 1.9000000000000001e-25 protein intI intersection_tyr_intI complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_20 17375 17722 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_001 17825 17884 -1 1e-09 attC attC attc_4 complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_21 17886 18665 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_002 19080 19149 -1 0.0001 attC attC attc_4 complete Yes 1196.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_22 19090 19749 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_003 19618 19726 -1 1.1e-07 attC attC attc_4 complete Yes 469.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_23 19721 20254 -1 NA protein protein NA complete Yes NA circ |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test7_integrons_table.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test7_integrons_table.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,10 @@ +# cmd: integron_finder /tmp/tmp3_ir6t5a/files/7/e/3/dataset_7e32f99d-dba8-4527-9e8f-4ac9ca88d7db.dat --cpu 1 --keep-tmp -dt 2000 --calin-threshold 3 --max-attc-size 188 --min-attc-size 30 +ID_integron ID_replicon element pos_beg pos_end strand evalue type_elt annotation model type default distance_2attC considered_topology +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_1 55 1014 1 1.9000000000000001e-25 protein intI intersection_tyr_intI complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_20 17375 17722 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_001 17825 17884 -1 1e-09 attC attC attc_4 complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_21 17886 18665 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_002 19080 19149 -1 0.0001 attC attC attc_4 complete Yes 1196.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_22 19090 19749 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_003 19618 19726 -1 1.1e-07 attC attC attc_4 complete Yes 469.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_23 19721 20254 -1 NA protein protein NA complete Yes NA circ |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test8_integrons_table.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test8_integrons_table.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,10 @@ +# cmd: integron_finder /tmp/tmp3_ir6t5a/files/e/4/5/dataset_e459a473-6554-4525-9ec1-505e63711366.dat --cpu 1 --keep-tmp -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 --attc-model /tmp/tmp3_ir6t5a/files/3/0/3/dataset_303db187-2a98-45e2-8c99-3d5694175a98.dat +ID_integron ID_replicon element pos_beg pos_end strand evalue type_elt annotation model type default distance_2attC considered_topology +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_1 55 1014 1 1.9000000000000001e-25 protein intI intersection_tyr_intI complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_20 17375 17722 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_001 17825 17884 -1 1e-09 attC attC dataset_303db187-2a98-45e2-8c99-3d5694175a98 complete Yes NA circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_21 17886 18665 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_002 19080 19149 -1 0.0001 attC attC dataset_303db187-2a98-45e2-8c99-3d5694175a98 complete Yes 1196.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_22 19090 19749 -1 NA protein protein NA complete Yes NA circ +integron_01 ACBA.007.P01_13 attc_003 19618 19726 -1 1.1e-07 attC attC dataset_303db187-2a98-45e2-8c99-3d5694175a98 complete Yes 469.0 circ +integron_01 ACBA.007.P01_13 ACBA.007.P01_13_23 19721 20254 -1 NA protein protein NA complete Yes NA circ |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test9_integrons_table.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test9_integrons_table.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,5 @@ +# cmd: integron_finder /tmp/tmp3_ir6t5a/files/5/5/a/dataset_55aed596-7c76-44f2-817c-e12d708ca8b9.dat --cpu 1 --keep-tmp -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 --no-proteins +ID_integron ID_replicon element pos_beg pos_end strand evalue type_elt annotation model type default distance_2attC considered_topology +integron_01 ACBA.007.P01_13 attc_001 17825 17884 -1 1e-09 attC attC attc_4 CALIN Yes NA circ +integron_01 ACBA.007.P01_13 attc_002 19080 19149 -1 0.0001 attC attC attc_4 CALIN Yes 1196.0 circ +integron_01 ACBA.007.P01_13 attc_003 19618 19726 -1 1.1e-07 attC attC attc_4 CALIN Yes 469.0 circ |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/test9_summary.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test9_summary.tsv Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,3 @@ +# cmd: integron_finder /tmp/tmp3_ir6t5a/files/5/5/a/dataset_55aed596-7c76-44f2-817c-e12d708ca8b9.dat --cpu 1 --keep-tmp -dt 4000 --calin-threshold 2 --max-attc-size 200 --min-attc-size 40 --no-proteins +ID_replicon CALIN complete In0 topology size +ACBA.007.P01_13 1 0 0 circ 20301 |
b |
diff -r 000000000000 -r 1ae00120dd24 test-data/topology.txt --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/topology.txt Thu Sep 22 13:51:14 2022 +0000 |
b |
@@ -0,0 +1,4 @@ +# topology data for testing integron_finder on galaxy server +ACBA.007.P01_13 lin +LIAN.001.C02_10 circ +PSSU.001.C01_13 circ |