Previous changeset 3:9047a1d3d8ea (2018-08-14) Next changeset 5:930893c83a1a (2019-02-19) |
Commit message:
planemo upload for repository https://github.com/phac-nml/staramr commit fd6c4338e65d6a33900da6fe7ae6f507105d3446 |
modified:
staramr_search.xml |
added:
test-data/genes_to_exclude.tsv test-data/test-aminoglycoside.fsa test-data/test5-summary.tsv test-data/test6-summary.tsv |
b |
diff -r 9047a1d3d8ea -r 1e8ec0f861ff staramr_search.xml --- a/staramr_search.xml Tue Aug 14 10:04:19 2018 -0400 +++ b/staramr_search.xml Thu Nov 22 13:38:58 2018 -0500 |
[ |
@@ -1,7 +1,7 @@ -<tool id="staramr_search" name="staramr" version="0.2.2"> +<tool id="staramr_search" name="staramr" version="0.3.0"> <description>Scans genome assemblies against the ResFinder and PointFinder databases searching for AMR genes.</description> <requirements> - <requirement type="package" version="0.2.2">staramr</requirement> + <requirement type="package" version="0.3.0">staramr</requirement> </requirements> <command detect_errors="exit_code"><![CDATA[ #import re @@ -28,6 +28,12 @@ $advanced.exclude_negatives $advanced.exclude_resistance_phenotypes + #if str($advanced.exclude_genes.exclude_genes_condition) == 'custom' + --exclude-genes-file '${advanced.exclude_genes.exclude_genes_file}' + #elif str($advanced.exclude_genes.exclude_genes_condition) == 'none' + --no-exclude-genes + #end if + --output-summary $summary --output-resfinder $resfinder #if $use_pointfinder.enable @@ -66,6 +72,18 @@ help="Report all BLAST results (includes overlapping hits, mainly for debugging)" /> <param name="exclude_negatives" type="boolean" label="Exclude negative (non-resistant) results" truevalue="--exclude-negatives" falsevalue="" /> <param name="exclude_resistance_phenotypes" type="boolean" label="Exclude resistance phenotypes" truevalue="--exclude-resistance-phenotypes" falsevalue="" /> + <conditional name="exclude_genes"> + <param name="exclude_genes_condition" type="select" label="Exclude certain AMR genes from the results"> + <option value="default" selected="true">Exclude default list of AMR genes</option> + <option value="custom">Provide a custom list of AMR genes to exclude</option> + <option value="none">Do not exclude any AMR genes</option> + </param> + <when value="default" /> + <when value="custom"> + <param type="data" name="exclude_genes_file" format="txt,tabular" label="Exclude genes file" help="Pass a file containing a list of genes to exclude from the ResFinder/PointFinder results" /> + </when> + <when value="none" /> + </conditional> </section> </inputs> <outputs> @@ -117,6 +135,24 @@ <output name="summary" file="test4-summary.tsv" ftype="tabular" /> </test> + <test> + <param name="genomes" value="test-aminoglycoside.fsa" /> + + <output name="summary" file="test5-summary.tsv" ftype="tabular" /> + </test> + <test> + <param name="genomes" value="test-aminoglycoside.fsa" /> + <param name="exclude_genes_condition" value="none" /> + + <output name="summary" file="test6-summary.tsv" ftype="tabular" /> + </test> + <test> + <param name="genomes" value="test-aminoglycoside.fsa" /> + <param name="exclude_genes_condition" value="custom" /> + <param name="exclude_genes_file" value="genes_to_exclude.tsv" /> + + <output name="summary" file="test5-summary.tsv" ftype="tabular" /> + </test> </tests> <help><![CDATA[ staramr @@ -131,6 +167,24 @@ 2. Select whether or not you wish to scan your genome for point mutations giving antimicrobial resistance using the PointFinder database. This requires you to specify the specific organism you are scanning (currently only *salmonella* is supported). 3. Run the tool. +Input +----- + +Genomes +``````` + +staramr_ takes as input one or more assembled genomes (in FASTA format) to search for AMR genes. + +Exclude genes file +`````````````````` + +Setting **Provide a custom list of AMR genes to exclude** in the **Advanced options** allows you to pass a file containing a list of genes to exclude from the results. The file must start with a line **#gene_id** and the gene names must correspond to the sequence IDs in the ResFinder/PointFinder databases. For example: + +:: + + #gene_id + aac(6')-Iaa_1_NC_003197 + Output ------ |
b |
diff -r 9047a1d3d8ea -r 1e8ec0f861ff test-data/genes_to_exclude.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/genes_to_exclude.tsv Thu Nov 22 13:38:58 2018 -0500 |
b |
@@ -0,0 +1,2 @@ +#gene_id +aac(6')-Iaa_1_NC_003197 |
b |
diff -r 9047a1d3d8ea -r 1e8ec0f861ff test-data/test-aminoglycoside.fsa --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-aminoglycoside.fsa Thu Nov 22 13:38:58 2018 -0500 |
b |
@@ -0,0 +1,9 @@ +>aac(6')-Iaa_1_NC_003197 +ATGGACATCAGGCAAATGAACAGAACCCATCTGGATCACTGGCGCGGATTGCGAAAACAG +CTCTGGCCTGGTCACCCGGATGACGCCCATCTGGCGGACGGCGAAGAAATTCTGCAAGCC +GATCATCTGGCATCATTTATTGCGATGGCAGACGGGGTGGCGATTGGCTTTGCGGATGCC +TCAATCCGCCACGATTATGTCAATGGCTGTGACAGTTCGCCCGTGGTTTTCCTTGAAGGT +ATTTTTGTTCTCCCCTCATTCCGTCAACGCGGCGTAGCGAAACAATTGATTGCAGCGGTG +CAACGATGGGGAACGAATAAAGGGTGTCGGGAAATGGCCTCCGATACCTCGCCGGAAAAT +ACAATTTCCCAGAAAGTTCATCAGGCGTTAGGATTTGAGGAAACAGAGCGCGTCATTTTC +TACCGAAAGCGTTGTTGA |
b |
diff -r 9047a1d3d8ea -r 1e8ec0f861ff test-data/test5-summary.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test5-summary.tsv Thu Nov 22 13:38:58 2018 -0500 |
b |
@@ -0,0 +1,2 @@ +Isolate ID Genotype Predicted Phenotype +test-aminoglycoside.fsa None Sensitive |
b |
diff -r 9047a1d3d8ea -r 1e8ec0f861ff test-data/test6-summary.tsv --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test6-summary.tsv Thu Nov 22 13:38:58 2018 -0500 |
b |
@@ -0,0 +1,2 @@ +Isolate ID Genotype Predicted Phenotype +test-aminoglycoside.fsa aac(6')-Iaa gentamicin |