| Next changeset 1:cc56d01a0b36 (2023-05-14) |
|
Commit message:
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/cnvkit commit c35b83e4b65b211377c9f616c77d7306da48a984 |
|
added:
call.xml macros.xml test-data/access-excludes.bed test-data/capture.antitarget.bed test-data/capture.bed test-data/capture.split.bed test-data/capture.target.bed test-data/excludes.bed test-data/excludes_1.bed test-data/fasta_indexes.loc test-data/genome.fasta test-data/genome.fasta.fai test-data/multible_capture.antitarget.bed test-data/normal.antitargetcoverage.cnn test-data/normal.bam test-data/normal.targetcoverage.cnn test-data/ref-tas.cnn test-data/reference.antitarget-tmp.bed test-data/reference.cnn test-data/reference.target-tmp.bed test-data/sample-diagram.pdf test-data/sample-heatmap.png test-data/sample-scatter.png test-data/sample.cnr test-data/sample.cns test-data/sample.targetcoverage.cnn test-data/tumor-diagram.pdf test-data/tumor-heatmap.png test-data/tumor-scatter.png test-data/tumor.antitargetcoverage.cnn test-data/tumor.bam test-data/tumor.bintest.cns test-data/tumor.call.cns test-data/tumor.cnr test-data/tumor.cns test-data/tumor.targetcoverage.cnn test-data/tumor_1.bam tool-data/fasta_indexes.loc.sample tool_data_table_conf.xml.sample tool_data_table_conf.xml.test |
| b |
| diff -r 000000000000 -r 2120d778cfde call.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/call.xml Sun May 14 20:08:32 2023 +0000 |
| [ |
| @@ -0,0 +1,128 @@ +<tool id="cnvkit_call" name="CNVkit Call" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@" profile="21.05"> + <description>Call copy number variants from segmented log2 ratios</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="xrefs"/> + <expand macro="requirements"/> + <command detect_errors="exit_code"><![CDATA[ + ln -s '$input_sample_file' ./tumor.cns && + #if $additional_SNP_allelic_process.vcf + ln -s '$additional_SNP_allelic_process.vcf' ./vcf_file.vcf && + #end if + cnvkit.py call + ./tumor.cns + #if $advanced_settings.method == "threshold" + #set $method_val = "threshold" + --method '$method_val' + #else + --method '$advanced_settings.method' + #end if + #if $advanced_settings.center == "median" + #set $center_val = "median" + --center '$center_val' + #else + --center '$advanced_settings.center' + #end if + #if str($advanced_settings.thresholds) + --thresholds'$advanced_settings.thresholds' + #end if + #if str($advanced_settings.center_at) + --center-at '$advanced_settings.center_at' + #end if + #if str($advanced_settings.add_filter.Filter) == "yes": + #if '$advanced_settings.add_filter.filter' == "ampdel" + #set $filter_val = "ampdel" + --filter '$filter_val' + #else + --filter '$advanced_settings.add_filter.filter' + #end if + #end if + #if str($advanced_settings.ploidy) + --ploidy $advanced_settings.ploidy + #end if + #if str($advanced_settings.purity) + --purity $advanced_settings.purity + #end if + $advanced_settings.drop_low_coverage + #if str($advanced_settings.Sample_sex.sex) == "yes": + #if '$advanced_settings.Sample_sex.sample_sex' == "Male" + #set $sample_sex_val = "Male" + --sample-sex '$segment_method_val' + #else + --sample-sex '$advanced_settings.Sample_sex.sample_sex' + #end if + #end if + $advanced_settings.male_reference + #if $additional_SNP_allelic_process.vcf + --vcf ./vcf_file.vcf + #end if + #if $additional_SNP_allelic_process.sample_id + --sample-id '$additional_SNP_allelic_process.sample_id' + #end if + #if $additional_SNP_allelic_process.normal_id + --normal-id '$additional_SNP_allelic_process.normal_id' + #end if + #if str($additional_SNP_allelic_process.min_variant_depth) + --min-variant-depth $additional_SNP_allelic_process.min_variant_depth + #end if + #if str($additional_SNP_allelic_process.zygosity_freq) + --zygosity-freq $additional_SNP_allelic_process.zygosity_freq + #end if + ]]></command> + <inputs> + <param name="input_sample_file" type="data" format="tabular" label="CNS file" help="" /> + <section name="additional_SNP_allelic_process" title="additional SNP b_allele frequencies process" expanded="false"> + <expand macro="additionally_SNP_process" /> + </section> + <section name="advanced_settings" title="Advanced settings" expanded="false"> + <expand macro="call_optional" /> + <expand macro="sample_sex_condition" /> + <conditional name="add_filter"> + <param name="Filter" type="select" label="Add filters" help=""> + <option value="yes">Add filters</option> + <option value="no">don't add filters</option> + </param> + <when value="yes"> + <expand macro="filter" /> + </when> + <when value="no"> + </when> + </conditional> + </section> + </inputs> + <outputs> + <data name="out_sample_Bintest" format="tabular" label="${tool.name} on ${on_string}: Sample Bintest " from_work_dir="tumor.call.cns" /> + </outputs> + <tests> + <test expect_num_outputs="1"> + <param name="input_sample_file" ftype="tabular" value="tumor.cns" /> + <param name="zygosity_freq" value="0.25" /> + <param name="min_variant_depth" value="40" /> + <param name="purity" value="1" /> + <output name="out_sample_Bintest"> + <assert_contents><has_text_matching expression="chrM"/></assert_contents> + </output> + </test> + <test expect_num_outputs="1"> + <conditional name="Sample_sex"> + <param name="sex" value="yes" /> + </conditional> + <param name="input_sample_file" ftype="tabular" value="tumor.cns" /> + <param name="min_variant_depth" value="40" /> + <param name="purity" value="1" /> + <output name="out_sample_Bintest"> + <assert_contents><has_text_matching expression="chrM"/></assert_contents> + </output> + </test> + </tests> + <help><![CDATA[ + Given segmented log2 ratio estimates (.cns), derive each segment’s absolute integer copy number using either: + A list of threshold log2 values for each copy number state (-m threshold), or rescaling - for a given known + tumor cell fraction and normal ploidy, then simple rounding to the nearest integer copy number (-m clonal). + + The output is Segmented log2 ratios (.cns) file with those columns + chromosome, Start, end, gene, log2, depth, weight and number of bins covered by the segment (probes) + ]]></help> + <expand macro="citations" /> +</tool> |
| b |
| diff -r 000000000000 -r 2120d778cfde macros.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Sun May 14 20:08:32 2023 +0000 |
| b |
| b'@@ -0,0 +1,221 @@\n+<macros>\n+ <token name="@VERSION_SUFFIX@">0</token>\n+ <token name="@TOOL_VERSION@">0.9.10</token>\n+ <xml name="requirements">\n+ <requirements>\n+ <requirement type="package" version="@TOOL_VERSION@">cnvkit</requirement>\n+ <requirement type="package" version="1.0.2">scikit-learn</requirement>\n+ </requirements>\n+ </xml>\n+ <xml name="reference_interface">\n+ <conditional name="reference_source">\n+ <param name="ref_selector" type="select" label="Choose the source for the reference genome">\n+ <option value="cached">Locally cached</option>\n+ <option value="history">History</option>\n+ </param>\n+ <when value="cached">\n+ <param argument="--fasta" optional="true" type="select" label="Reference genome">\n+ <options from_data_table="fasta_indexes">\n+ <validator type="no_options" message="A built-in reference genome is not available for the build associated with the selected input file" />\n+ </options>\n+ </param>\n+ </when>\n+ <when value="history">\n+ <param argument="--fasta" type="data" optional="true" format="fasta" label="Reference" help="Reference sequence" />\n+ </when>\n+ </conditional>\n+ </xml>\n+ <xml name="xrefs">\n+ <xrefs>\n+ <xref type="bio.tools">cnvkit</xref>\n+ </xrefs>\n+ </xml>\n+ <xml name="shared">\n+ <param argument="--method" type="select" label="Select the sequencing method of the input files" help="">\n+ <option value="hybrid" selected="True">hybridization capture </option>\n+ <option value="amplicon">targeted amplicon sequencing </option>\n+ <option value="wgs">whole genome sequencing </option>\n+ </param>\n+ <param argument="--segment-method" type="select" label="Method used in the \'segment\' step" help="">\n+ <option value="cbs" selected="True">Circular Binary Segmentation CBS</option>\n+ <option value="flasso">Fused lasso, hybrid flasso</option>\n+ <option value="haar">a pure-Python implementation of HaarSeg, a wavelet-based method. Very fast and performs reasonably well on small panels, but tends to over-segment large datasets., hybrid haar</option>\n+ <option value="none">simply calculate the weighted mean log2 value of each chromosome arm. Useful for testing or debugging, or as a baseline for benchmarking other methods., hybrid none</option>\n+ <option value="hmm">experimental \xe2\x80\x93 a 3-state Hidden Markov Model suitable for most samples. Faster than CBS, and slower but more accurate than Haar. Requires the Python package pomegranate, as do the next two thods., hybrid hmm</option>\n+ <option value="hmm-tumor">experimental \xe2\x80\x93 a 5-state HMM suitable for finer-grained segmentation of good-quality tumor samples. In particular, this method can detect focal amplifications within a larger-scale, smaller-amplitude copy number gain, or focal deep deletions within a larger-scale hemizygous loss. Training this model takes a bit more CPU time than the simpler hmm method., hybrid hmm-tumor</option>\n+ <option value="hmm-germline">experimental \xe2\x80\x93 a 3-state HMM with fixed amplitude for the loss, neutral, and gain states corresponding to absolute copy numbers of 1, 2, and 3. Suitable for germline samples and single-cell sequencing of samples with mostly-diploid genomes that are not overly aneuploid., hybrid hmm-germline</option>\n+ </param>\n+ <param argument="--male-reference" type="boolean" checked="false" truevalue="--male-reference" falsevalue="" label="Use or assume a male reference" help="female samples will have +1 log-CNR of chrX; otherwise male samples would have -1 chrX" />\n+ <param argument="--countreads" type="b'..b'the scatter plot" help=""/>\n+ <param argument="--y-max" optional="true" type="integer" label="y-axis upper limit" min="1" value="" help=""/>\n+ <param argument="--y-min" optional="true" type="integer" label="y-axis lower limit" min="1" value="" help=""/>\n+ <param argument="--fig-size" optional="true" type="float" label="Width and height of the plot in inches" value="" help="Example 6.4 4.8, the space between the two inputs is important"/>\n+ </xml>\n+ <xml name="segment_optional">\n+ <param argument="--dataframe" type="text" optional="true" label="Data frame" value="" help="File name to save the raw R dataframe emitted by CBS or Fused Lasso, example dataframe.r"/>\n+ <param argument="--method" type="select" label="Segmentation method" help="">\n+ <option value="cbs" selected="True">Circular Binary Segmentation CBS method,hybrid CBS</option>\n+ <option value="flasso">Fused lasso, hybrid flasso</option>\n+ <option value="haar">A pure-Python implementation of HaarSeg, a wavelet-based method. Very fast and performs reasonably well on small panels, but tends to over-segment large datasets., hybrid haar</option>\n+ <option value="none">simply calculate the weighted mean log2 value of each chromosome arm. Useful for testing or debugging, or as a baseline for benchmarking other methods., hybrid none</option>\n+ <option value="hmm">experimental \xe2\x80\x93 a 3-state Hidden Markov Model suitable for most samples. Faster than CBS, and slower but more accurate than Haar. Requires the Python package pomegranate, as do the next two methods., hybrid hmm</option>\n+ <option value="hmm-tumor">experimental \xe2\x80\x93 a 5-state HMM suitable for finer-grained segmentation of good-quality tumor samples. In particular, this method can detect focal amplifications within a larger-scale, smaller-amplitude copy number gain, or focal deep deletions within a larger-scale hemizygous loss. Training this model takes a bit more CPU time than the simpler hmm method., hybrid hmm-tumor</option>\n+ <option value="hmm-germline">experimental \xe2\x80\x93 a 3-state HMM with fixed amplitude for the loss, neutral, and gain states corresponding to absolute copy numbers of 1, 2, and 3. Suitable for germline samples and single-cell sequencing of samples with mostly-diploid genomes that are not overly aneuploid., hybrid hmm-germline</option>\n+ </param>\n+ <param argument="--threshold" optional="true" type="integer" label="Significance threshold" min="1" help="To accept breakpoints during segmentation. For HMM methods, this is the smoothing window size"/>\n+ <param argument="--drop-low-coverage" type="boolean" checked="false" truevalue="--drop-low-coverage" falsevalue="" label="Drop very-low-coverage bins before segmentation" help="To avoid false-positive deletions in poor-quality tumor samples"/>\n+ <param argument="--drop-outliers" optional="true" type="integer" label="Drop outliers" min="1" value="10" help=""/>\n+ <param argument="--smooth-cbs" type="boolean" checked="false" truevalue="--smooth-cbs" falsevalue="" label="Perform an additional smoothing before CBS segmentations" help=""/>\n+ </xml>\n+ <xml name="sample_sex_condition">\n+ <conditional name="Sample_sex">\n+ <param name="sex" type="select" label="Sample sex availabel" help="">\n+ <option value="no" selected="True">Sample sex unknown</option>\n+ <option value="yes">Select sample sex</option>\n+ </param>\n+ <when value="yes">\n+ <expand macro="sample_sex" />\n+ </when>\n+ <when value="no">\n+ </when>\n+ </conditional>\n+ </xml>\n+ <xml name="citations">\n+ <citations>\n+ <citation type="doi">10.1371/journal.pcbi.1004873</citation>\n+ </citations>\n+ </xml>\n+</macros>\n\\ No newline at end of file\n' |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/capture.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/capture.bed Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,37 @@ +chrM 576 647 +chrM 647 1601 +chrM 1601 1670 +chrM 1670 3229 +chrM 3229 3304 +chrM 3306 4262 +chrM 4262 4331 +chrM 4328 4400 +chrM 4401 4469 +chrM 4469 5511 +chrM 5511 5579 +chrM 5586 5655 +chrM 5656 5729 +chrM 5760 5826 +chrM 5825 5891 +chrM 5903 7445 +chrM 7445 7514 +chrM 7517 7585 +chrM 7585 8269 +chrM 8294 8364 +chrM 8365 8572 +chrM 8526 9207 +chrM 9206 9990 +chrM 9990 10058 +chrM 10058 10404 +chrM 10404 10469 +chrM 10469 10766 +chrM 10759 12137 +chrM 12137 12206 +chrM 12206 12265 +chrM 12265 12336 +chrM 12336 14148 +chrM 14148 14673 +chrM 14673 14742 +chrM 14746 15887 +chrM 15887 15953 +chrM 15955 16023 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/capture.split.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/capture.split.bed Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,37 @@ +chrM 576 647 - +chrM 647 1601 - +chrM 1601 1670 - +chrM 1670 3229 - +chrM 3229 3304 - +chrM 3306 4262 - +chrM 4262 4331 - +chrM 4328 4400 - +chrM 4401 4469 - +chrM 4469 5511 - +chrM 5511 5579 - +chrM 5586 5655 - +chrM 5656 5729 - +chrM 5760 5826 - +chrM 5825 5891 - +chrM 5903 7445 - +chrM 7445 7514 - +chrM 7517 7585 - +chrM 7585 8269 - +chrM 8294 8364 - +chrM 8365 8572 - +chrM 8526 9207 - +chrM 9206 9990 - +chrM 9990 10058 - +chrM 10058 10404 - +chrM 10404 10469 - +chrM 10469 10766 - +chrM 10759 12137 - +chrM 12137 12206 - +chrM 12206 12265 - +chrM 12265 12336 - +chrM 12336 14148 - +chrM 14148 14673 - +chrM 14673 14742 - +chrM 14746 15887 - +chrM 15887 15953 - +chrM 15955 16023 - |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/capture.target.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/capture.target.bed Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,12 @@ +chrM 576 3304 - +chrM 3306 4400 - +chrM 4401 5579 - +chrM 5586 5655 - +chrM 5656 5729 - +chrM 5760 5891 - +chrM 5903 7514 - +chrM 7517 8269 - +chrM 8294 8364 - +chrM 8365 14742 - +chrM 14746 15953 - +chrM 15955 16023 - |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/fasta_indexes.loc --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fasta_indexes.loc Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,26 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a fasta_indexes.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The fasta_indexes.loc +#file has this format (white space characters are TAB characters): +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +#So, for example, if you had hg19 Canonical indexed stored in +# +# /depot/data2/galaxy/hg19/sam/, +# +#then the fasta_indexes.loc entry would look like this: +# +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +# +#and your /depot/data2/galaxy/hg19/sam/ directory +#would contain hg19canon.fa and hg19canon.fa.fai files. +# +#Your fasta_indexes.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +test_buildid hg17 test_displayname ${__HERE__}/genome.fasta |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/genome.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/genome.fasta Sun May 14 20:08:32 2023 +0000 |
| b |
| b'@@ -0,0 +1,333 @@\n+>chrM\n+NNNCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT\n+TTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTG\n+GAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATT\n+CTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACCTACTA\n+AAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAAT\n+GTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAAAATTTCCACCA\n+AACCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGC\n+CAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAAT\n+TTTATCTTTAGGCGGTATGCACTTTTAACAGTCACCCCCCAACTAACACA\n+TTATTTTCCCCTCCCACTCCCATACTACTAATCTCATCAATACAACCCCC\n+GCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAAC\n+CAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCCTCA\n+AAGCAATACACTGAAAATGTTTAGACGGGCTCACATCACCCCATAAACAA\n+ATAGGTTTGGTCCTAGCCTTTCTATTAGCTCTTAGTAAGATTACACATGC\n+AAGCATCCCCGTTCCAGTGAGTTCACCCTCTAAATCACCACGATCAAAAG\n+GGACAAGCATCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCC\n+ACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGT\n+TTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACC\n+GCGGTCACACGATTAACCCAAGTCAATAGAAGCCGGCGTAAAGAGTGTTT\n+TAGATCACCCCCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAA\n+CTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAAC\n+ACACAATAGCTAAGACCCAAACTGGGATTAGATACCCCACTATGCTTAGC\n+CCTAAACCTCAACAGTTAAATCAACAAAACTGCTCGCCAGAACACTACGA\n+GCCACAGCTTAAAACTCAAAGGACCTGGCGGTGCTTCATATCCCTCTAGA\n+GGAGCCTGTTCTGTAATCGATAAACCCCGATCAACCTCACCACCTCTTGC\n+TCAGCCTATATACCGCCATCTTCAGCAAACCCTGATGAAGGCTACAAAGT\n+AAGCGCAAGTACCCACGTAAAGACGTTAGGTCAAGGTGTAGCCCATGAGG\n+TGGCAAGAAATGGGCTACATTTTCTACCCCAGAAAACTACGATAGCCCTT\n+ATGAAACTTAAGGGTCGAAGGTGGATTTAGCAGTAAACTGAGAGTAGAGT\n+GCTTAGTTGAACAGGGCCCTGAAGCGCGTACACACCGCCCGTCACCCTCC\n+TCAAGTATACTTCAAAGGACATTTAACTAAAACCCCTACGCATTTATATA\n+GAGGAGACAAGTCGTAACATGGTAAGTGTACTGGAAAGTGCACTTGGACG\n+AACCAGAGTGTAGCTTAACACAAAGCACCCAACTTACACTTAGGAGATTT\n+CAACTTAACTTGACCGCTCTGAGCTAAACCTAGCCCCAAACCCACTCCAC\n+CTTACTACCAGACAACCTTAGCCAAACCATTTACCCAAATAAAGTATAGG\n+CGATAGAAATTGAAACCTGGCGCAATAGATATAGTACCGCAAGGGAAAGA\n+TGAAAAATTATAACCAAGCATAATATAGCAAGGACTAACCCCTATACCTT\n+CTGCATAATGAATTAACTAGAAATAACTTTGCAAGGAGAGCCAAAGCTAA\n+GACCCCCGAAACCAGACGAGCTACCTAAGAACAGCTAAAAGAGCACACCC\n+GTCTATGTAGCAAAATAGTGGGAAGATTTATAGGTAGAGGCGACAAACCT\n+ACCGAGCCTGGTGATAGCTGGTTGTCCAAGATAGAATCTTAGTTCAACTT\n+TAAATTTGCCCACAGAACCCTCTAAATCCCCTTGTAAATTTAACTGTTAG\n+TCCAAAGAGGAACAGCTCTTTGGACACTAGGAAAAAACCTTGTAGAGAGA\n+GTAAAAAATTTAACACCCATAGTAGGCCTAAAAGCAGCCACCAATTAAGA\n+AAGCGTTCAAGCTCAACACCCACTACCTAAAAAATCCCAAACATATAACT\n+GAACTCCTCACACCCAATTGGACCAATCTATCACCCTATAGAAGAACTAA\n+TGTTAGTATAAGTAACATGAAAACATTCTCCTCCGCATAAGCCTGCGTCA\n+GATCAAAACACTGAACTGACAATTAACAGCCCAATATCTACAATCAACCA\n+ACAAGTCATTATTACCCTCACTGTCAACCCAACACAGGCATGCTCATAAG\n+GAAAGGTTAAAAAAAGTAAAAGGAACTCGGCAAACCTTACCCCGCCTGTT\n+TACCAAAAACATCACCTCTAGCATCACCAGTATTAGAGGCACCGCCTGCC\n+CAGTGACACATGTTTAACGGCCGCGGTACCCTAACCGTGCAaaggtagca\n+taatcacttgttccttaaatagggacctgtatgaatggctccacgagggt\n+tcagctgtctcttacttttaaccagtgaaattgacctgcccgtgaagagg\n+cgggcatgacacagcaagacgagaagaccctatggagctttaatttaTTA\n+ATGCAAACAGTACCTAACAAACCCACAGGTCCTAAACTACCAAACCTGCA\n+TTAAAAATTTCGGTTGGGGCGACCTCGGAGCAGAACCCAACCTCCGAGCA\n+GTACATGCTAAGACTTCACCAGTCAAAGCGAACTACTATACTCAATTGAT\n+CCAATAACTTGACCAACGGAACAAGTTACCCTAGGGATAACAGCGCAATC\n+CTATTCTAGAGTCCATATCAACAATAGGGTTTACGACCTCGATGTTGGAT\n+CAGGACATCCCGATGGTGCAGCCGCTATTAAAGGTTCGTTTGTTCAACGA\n+TTAAAGTCCTACGTGATCTGAGTTCAGACCGGAGTAATCCAGGTCGGTTT\n+CTATCTACTTCAAATTCCTCCCTGTACGAAAGGACAAGAGAAATAAGGCC\n+TACTTCACAAAGCGCCTTCCCCCGTAAATGATATCATCTCAACTTAGTAT\n+TATACCCACACCCACCCAAGAACAGGGTTTgttaagatggcagagcccgg\n+taatcgcataaaacttaaaactttacagtcagaggttcaattcctcttct\n+taacaacaTACCCATGGCCAACCTCCTACTCCTCATTGTACCCATTCTAA\n+TCGCAATGGCATTCCTAATGCTTACCGAACGAAAAATTCTAGGCTATATA\n+CAACTACGCAAAGGCCCCAACGTTGTAGGCCCCTACGGGCTACTACAACC\n+CTTCGCTGACGCCATAAAACTCTTCACCAAAGAGCCCCTAAAACCCGCCA\n+CATCTACCATCACCCTCTACATCACCGCCCCGACCTTAGCTCTCACCATC\n+GCTCTTCTACTATGAACCCCCCTCCCCATACCCAACCCCCTGGTCAACCT\n+CAACCTAGGCCTCCTATTTATTCTAGCCACCTCTAGCCTAGCCGTTTACT\n+CAATCCTCTGATCAGGGTGAGCATCAAACTCAAACTACGCCCTGATCGGC\n+GCACTGCGAGCAGTAGCCCAAACAATCTCATATGAAGTCACCCTAGCCAT\n+CATTCTACTATCAACATTACTAATAAGTGGCTCCTTTAACCTCTCCACCC\n+TTATCACAACACAAGAACACC'..b'TTAGTTACCGCTAACAACCTATT\n+CCAACTGTTCATCGGCTGAGAGGGCGTAGGAATTATATCCTTCTTGCTCA\n+TCAGTTGATGATACGCCCGAGCAGATGCCAACACAGCAGCCATTCAAGCA\n+GTCCTATACAACCGTATCGGCGATATCGGTTTCATCCTCGCCTTAGCATG\n+ATTTATCCTACACTCCAACTCATGAGACCCACAACAAATAGCCCTTCTAA\n+ACGCTAATCCAAGCCTCACCCCACTACTAGGCCTCCTCCTAGCAGCAGCA\n+GGCAAATCAGCCCAATTAGGTCTCCACCCCTGACTCCCCTCAGCCATAGA\n+AGGCCCCACCCCAGTCTCAGCCCTACTCCACTCAAGCACTATAGTTGTAG\n+CAGGAATCTTCTTACTCATCCGCTTCCACCCCCTAGCAGAAAATAGCCCA\n+CTAATCCAAACTCTAACACTATGCTTAGGCGCTATCACCACTCTGTTCGC\n+AGCAGTCTGCGCCCTTACACAAAATGACATCAAAAAAATCGTAGCCTTCT\n+CCACTTCAAGTCAACTAGGACTCATAATAGTTACAATCGGCATCAACCAA\n+CCACACCTAGCATTCCTGCACATCTGTACCCACGCCTTCTTCAAAGCCAT\n+ACTATTTATGTGCTCCGGGTCCATCATCCACAACCTTAACAATGAACAAG\n+ATATTCGAAAAATAGGAGGACTACTCAAAACCATACCTCTCACTTCAACC\n+TCCCTCACCATTGGCAGCCTAGCATTAGCAGGAATACCTTTCCTCACAGG\n+TTTCTACTCCAAAGACCACATCATCGAAACCGCAAACATATCATACACAA\n+ACGCCTGAGCCCTATCTATTACTCTCATCGCTACCTCCCTGACAAGCGCC\n+TATAGCACTCGAATAATTCTTCTCACCCTAACAGGTCAACCTCGCTTCCC\n+CACCCTTACTAACATTAACGAAAATAACCCCACCCTACTAAACCCCATTA\n+AACGCCTGGCAGCCGGAAGCCTATTCGCAGGATTTCTCATTACTAACAAC\n+ATTTCCCCCGCATCCCCCTTCCAAACAACAATCCCCCTCTACCTAAAACT\n+CACAGCCCTCGCTGTCACTTTCCTAGGACTTCTAACAGCCCTAGACCTCA\n+ACTACCTAACCAACAAACTTAAAATAAAATCCCCACTATGCACATTTTAT\n+TTCTCCAACATACTCGGATTCTACCCTAGCATCACACACCGCACAATCCC\n+CTATCTAGGCCTTCTTACGAGCCAAAACCTGCCCCTACTCCTCCTAGACC\n+TAACCTGACTAGAAAAGCTATTACCTAAAACAATTTCACAGCACCAAATC\n+TCCACCTCCATCATCACCTCAACCCAAAAAGGCATAATTAAACTTTACTT\n+CCTCTCTTTCTTCTTCCCACTCATCCTAACCCTACTCCTAATCACATAAC\n+CTATTCCCCCGAGCAATCTCAATTACAATATATACACCAACAAACAATGT\n+TCAACCAGTAACCACTACTAATCAACGCCCATAATCATACAAAGCCCCCG\n+CACCAATAGGATCCTCCCGAATCAACCCTGACCCCTCTCCTTCATAAATT\n+ATTCAGCTTCCTACACTATTAAAGTTTACCACAACCACCACCCCATCATA\n+CTCTTTCACCCACAGCACCAATCCTACCTCCATCGCTAACCCCACTAAAA\n+CACTCACCAAGACCTCAACCCCTGACCCCCATGCCTCAGGATACTCCTCA\n+ATAGCCATCGCTGTAGTATATCCAAAGACAACCATCATTCCCCCTAAATA\n+AATTAAAAAAACTATTAAACCCATATAACCTCCCCCAAAATTCAGAATAA\n+TAACACACCCGACCACACCGCTAACAATCAGTACTAAACCCCCATAAATA\n+GGAGAAGGCTTAGAAGAAAACCCCACAAACCCCATTACTAAACCCACACT\n+CAACAGAAACAAAGCATACATCATTATTCTCGCACGGACTACAACCACGA\n+CCAATGATATGAAAAACCATCGTTGTATTTCAACTACAAGAACACCAATG\n+ACCCCAATACGCAAAATTAACCCCCTAATAAAATTAATTAACCACTCATT\n+CATCGACCTCCCCACCCCATCCAACATCTCCGCATGATGAAACTTCGGCT\n+CACTCCTTGGCGCCTGCCTGATCCTCCAAATCACCACAGGACTATTCCTA\n+GCCATACACTACTCACCAGACGCCTCAACCGCCTTTTCATCAATCGCCCA\n+CATCACTCGAGACGTAAATTATGGCTGAATCATCCGCTACCTTCACGCCA\n+ATGGCGCCTCAATATTCTTTATCTGCCTCTTCCTACACATCGGGCGAGGC\n+CTATATTACGGATCATTTCTCTACTCAGAAACCTGAAACATCGGCATTAT\n+CCTCCTGCTTGCAACTATAGCAACAGCCTTCATAGGCTATGTCCTCCCGT\n+GAGGCCAAATATCATTCTGAGGGGCCACAGTAATTACAAACTTACTATCC\n+GCCATCCCATACATTGGGACAGACCTAGTTCAATGAATCTGAGGAGGCTA\n+CTCAGTAGACAGTCCCACCCTCACACGATTCTTTACCTTTCACTTCATCT\n+TACCCTTCATTATTGCAGCCCTAGCAGCACTCCACCTCCTATTCTTGCAC\n+GAAACGGGATCAAACAACCCCCTAGGAATCACCTCCCATTCCGATAAAAT\n+CACCTTCCACCCTTACTACACAATCAAAGACGCCCTCGGCTTACTTCTCT\n+TCCTTCTCTCCTTAATGACATTAACACTATTCTCACCAGACCTCCTAGGC\n+GACCCAGACAATTATACCCTAGCCAACCCCTTAAACACCCCTCCCCACAT\n+CAAGCCCGAATGATATTTCCTATTCGCCTACACAATTCTCCGATCCGTCC\n+CTAACAAACTAGGAGGCGTCCTTGCCCTATTACTATCCATCCTCATCCTA\n+GCAATAATCCCCATCCTCCATATATCCAAACAACAAAGCATAATATTTCG\n+CCCACTAAGCCAATCACTTTATTGACTCCTAGCCGCAGACCTCCTCATTC\n+TAACCTGAATCGGAGGACAACCAGTAAGCTACCCTTTTACCATCATTGGA\n+CAAGTAGCATCCGTACTATACTTCACAACAATCCTAATCCTAATACCAAC\n+TATCTCCCTAATTGAAAACAAAATACTCAAATGGGCCTGTCCTTGTAGTA\n+TAAACTAATACACCAGTCTTGTAAACCGGAGACGAAAACCTTTTTCCAAG\n+GACAAATCAGAGAAAAAGTCTTTAACTCCACCATTAGCACCCAAAGCTAA\n+GATTCTAATTTAAACTATTCTCTGTTCTTTCATGGGGAAGCAGATTTGGG\n+TACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTAC\n+ATTACTGCCAGCCACCATGAATATTGTACGGTACCATAAATACTTGACCA\n+CCTGTAGTACATAAAAACCCAACCCACATCAAACCCCCCCCCCCCATGCT\n+TACAAGCAAGTACAGCAATCAACCTTCAACTATCACACATCAACTGCAAC\n+TCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCACCCTT\n+AACAGTACATAGTACATAAAGTCATTTACCGTACATAGCACATTACAGTC\n+AAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTG\n+ACCACCATCCTCCGTGAAATCAATATCCCGCACAAGAGTGCTACTCTCCT\n+CGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGAC\n+ATCTGGTTCCTACTTCAGGGCCATAAAGCCTAAATAGCCCACACGTTCCC\n+CTTAAATAAGACATCACGATG\n' |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/genome.fasta.fai --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/genome.fasta.fai Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,1 @@ +chrM 16571 6 50 51 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/normal.antitargetcoverage.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/normal.antitargetcoverage.cnn Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,1 @@ +chromosome start end gene log2 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/normal.bam |
| b |
| Binary file test-data/normal.bam has changed |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/normal.targetcoverage.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/normal.targetcoverage.cnn Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,62 @@ +chromosome start end gene depth log2 +chrM 576 848 - 493.485 8.94686 +chrM 848 1121 - 22.4469 4.48844 +chrM 1121 1394 - 4.59341 2.19956 +chrM 1394 1667 - 11.022 3.46231 +chrM 1667 1940 - 7.45055 2.89735 +chrM 1940 2212 - 1.36029 0.443919 +chrM 2212 2485 - 10.6081 3.40709 +chrM 2485 2758 - 31.7436 4.98839 +chrM 2758 3031 - 5.35531 2.42097 +chrM 3031 3304 - 7.55678 2.91777 +chrM 3306 3579 - 10.9817 3.45703 +chrM 3579 3853 - 12.719 3.66891 +chrM 3853 4126 - 7.17949 2.84388 +chrM 4126 4400 - 1.65693 0.728516 +chrM 4401 4695 - 5.18707 2.37492 +chrM 4695 4990 - 17.7458 4.1494 +chrM 4990 5284 - 5.94218 2.57099 +chrM 5284 5579 - 20.8136 4.37945 +chrM 5586 5655 - 9.37681 3.2291 +chrM 5656 5729 - 4.76712 2.25312 +chrM 5760 5891 - 10.5954 3.40537 +chrM 5903 6171 - 13.8097 3.78761 +chrM 6171 6440 - 13.5353 3.75866 +chrM 6440 6708 - 11.3657 3.50661 +chrM 6708 6977 - 7.80669 2.96471 +chrM 6977 7245 - 15.3321 3.93848 +chrM 7245 7514 - 2.52045 1.33368 +chrM 7517 7767 - 8.152 3.02715 +chrM 7767 8018 - 19.2311 4.26537 +chrM 8018 8269 - 6.7251 2.74956 +chrM 8294 8364 - 0 -20 +chrM 8365 8630 - 2.89811 1.53511 +chrM 8630 8896 - 7.87594 2.97745 +chrM 8896 9162 - 13.5451 3.7597 +chrM 9162 9427 - 9.68302 3.27546 +chrM 9427 9693 - 3.43233 1.77919 +chrM 9693 9959 - 5.87594 2.55482 +chrM 9959 10224 - 3.59623 1.84648 +chrM 10224 10490 - 2.99624 1.58315 +chrM 10490 10756 - 7.1015 2.82812 +chrM 10756 11022 - 4.00376 2.00136 +chrM 11022 11287 - 11.2377 3.49028 +chrM 11287 11553 - 10.2932 3.36362 +chrM 11553 11819 - 11.109 3.47366 +chrM 11819 12084 - 11.1509 3.47909 +chrM 12084 12350 - 10.1353 3.34132 +chrM 12350 12616 - 9.23684 3.2074 +chrM 12616 12882 - 9.39474 3.23185 +chrM 12882 13147 - 15.834 3.98495 +chrM 13147 13413 - 8.90226 3.15417 +chrM 13413 13679 - 12.218 3.61094 +chrM 13679 13944 - 4.30943 2.1075 +chrM 13944 14210 - 8.87218 3.14929 +chrM 14210 14476 - 9.2218 3.20505 +chrM 14476 14742 - 33.8872 5.08267 +chrM 14746 14987 - 28.1369 4.81439 +chrM 14987 15228 - 14.2531 3.83321 +chrM 15228 15470 - 9.3719 3.22834 +chrM 15470 15711 - 11.2946 3.49756 +chrM 15711 15953 - 6.29752 2.65478 +chrM 15955 16023 - 4.13235 2.04696 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/ref-tas.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/ref-tas.cnn Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,38 @@ +chromosome start end gene log2 depth spread +chrM 576 647 - 13.2947 96.2958 19.7107 +chrM 647 1601 - 1.74063 22.022 2.58065 +chrM 1601 1670 - 0.474375 3.10145 0.703308 +chrM 1670 3229 - -0.147713 1.6068 0.218999 +chrM 3229 3304 - 0 1.57333 0 +chrM 3306 4262 - 0.0246175 1.8295 0.0364979 +chrM 4262 4331 - -10.4357 0 15.472 +chrM 4328 4400 - -2.11465 0.0972222 3.13518 +chrM 4401 4469 - 0.106455 1.82353 0.157829 +chrM 4469 5511 - 0.501029 3.54127 0.742825 +chrM 5511 5579 - 0.394622 3.20588 0.585067 +chrM 5586 5655 - -10.4457 0 15.4869 +chrM 5656 5729 - 0 0 0 +chrM 5760 5826 - 0 1.06061 0 +chrM 5825 5891 - 0.627211 2.5303 0.929902 +chrM 5903 7445 - 0.845795 2.01297 1.25398 +chrM 7445 7514 - 0.118826 1.85507 0.176171 +chrM 7517 7585 - -0.884742 0.544118 1.31172 +chrM 7585 8269 - 0 1.85088 0 +chrM 8294 8364 - -10.0424 0 14.8889 +chrM 8365 8572 - -0.774496 0.623188 1.14827 +chrM 8526 9207 - 2.12113 2.88693 3.14479 +chrM 9206 9990 - 0 1.97194 0 +chrM 9990 10058 - -10.5541 0 15.6474 +chrM 10058 10404 - -0.412764 1.11272 0.611965 +chrM 10404 10469 - -10.5842 0 15.6921 +chrM 10469 10766 - 0 1.69024 0 +chrM 10759 12137 - 0.227328 2.3164 0.337036 +chrM 12137 12206 - -0.173094 1.76812 0.256628 +chrM 12206 12265 - 0 0.152542 0 +chrM 12265 12336 - -8.64364 0 12.8151 +chrM 12336 14148 - 0.0642475 2.15563 0.0952533 +chrM 14148 14673 - 0.148476 2.24762 0.220131 +chrM 14673 14742 - 1.10758 8.5942 1.64209 +chrM 14746 15887 - 0.490853 3.49167 0.727739 +chrM 15887 15953 - -10.4334 0 15.4685 +chrM 15955 16023 - 0 0 0 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/reference.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/reference.cnn Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,62 @@ +chromosome start end gene log2 depth gc rmask spread +chrM 576 848 - 2.75864 493.485 0.444853 4.08996 +chrM 848 1121 - 0.525695 22.4469 0.428571 0.779395 +chrM 1121 1394 - -0.84681 4.59341 0.483516 1.25548 +chrM 1394 1667 - 0.38341 11.022 0.450549 0.568444 +chrM 1667 1940 - -0.04005 7.45055 0.406593 0.0593781 +chrM 1940 2212 - -1.22672 1.36029 0.411765 1.81873 +chrM 2212 2485 - 0.21482 10.6081 0.388278 0.318492 +chrM 2485 2758 - 0.64779 31.7436 0.479853 0.960413 +chrM 2758 3031 - -0.27752 5.35531 0.457875 0.411451 +chrM 3031 3304 - 0.359575 7.55678 0.424908 0.533106 +chrM 3306 3579 - 0.03537 10.9817 0.509158 0.0524396 +chrM 3579 3853 - 0.026615 12.719 0.485401 0.0394594 +chrM 3853 4126 - 0 7.17949 0.450549 0 +chrM 4126 4400 - -0.485607 1.65693 0.423358 0.719961 +chrM 4401 4695 - -0.343535 5.18707 0.442177 0.509325 +chrM 4695 4990 - 0.603865 17.7458 0.427119 0.89529 +chrM 4990 5284 - -0.43303 5.94218 0.428571 0.64201 +chrM 5284 5579 - 0.5605 20.8136 0.410169 0.830997 +chrM 5586 5655 - -0.008305 9.37681 0.449275 0.012313 +chrM 5656 5729 - -0.462405 4.76712 0.410959 0.685562 +chrM 5760 5891 - 0.02536 10.5954 0.442748 0.0375987 +chrM 5903 6171 - 0.008305 13.8097 0.473881 0.012313 +chrM 6171 6440 - 0.19261 13.5353 0.498141 0.285564 +chrM 6440 6708 - 0 11.3657 0.470149 0 +chrM 6708 6977 - -0.132195 7.80669 0.457249 0.195992 +chrM 6977 7245 - 0.107015 15.3321 0.458955 0.15866 +chrM 7245 7514 - -0.50723 2.52045 0.420074 0.752019 +chrM 7517 7767 - 0.316705 8.152 0.372 0.469547 +chrM 7767 8018 - 0.49084 19.2311 0.501992 0.727719 +chrM 8018 8269 - -0.371965 6.7251 0.446215 0.551475 +chrM 8294 8364 - -11.0488 0 0.342857 16.381 +chrM 8365 8630 - -0.331755 2.89811 0.426415 0.49186 +chrM 8630 8896 - 0.13461 7.87594 0.406015 0.199573 +chrM 8896 9162 - -0.03223 13.5451 0.466165 0.0477842 +chrM 9162 9427 - -0.31024 9.68302 0.498113 0.459962 +chrM 9427 9693 - -0.712625 3.43233 0.466165 1.05654 +chrM 9693 9959 - -0.272205 5.87594 0.443609 0.403571 +chrM 9959 10224 - -0.26954 3.59623 0.377358 0.39962 +chrM 10224 10490 - -0.09971 2.99624 0.349624 0.14783 +chrM 10490 10756 - -0.241135 7.1015 0.43985 0.357507 +chrM 10756 11022 - -0.2582 4.00376 0.424812 0.382807 +chrM 11022 11287 - 0.01037 11.2377 0.430189 0.0153746 +chrM 11287 11553 - 0.06726 10.2932 0.443609 0.0997197 +chrM 11553 11819 - 0 11.109 0.466165 0 +chrM 11819 12084 - 0.28666 11.1509 0.441509 0.425002 +chrM 12084 12350 - 0.40266 10.1353 0.417293 0.596984 +chrM 12350 12616 - 0 9.23684 0.428571 0 +chrM 12616 12882 - 0.16725 9.39474 0.406015 0.247965 +chrM 12882 13147 - 0.13976 15.834 0.520755 0.207208 +chrM 13147 13413 - -0.026615 8.90226 0.432331 0.0394594 +chrM 13413 13679 - 0.00138 12.218 0.462406 0.00204599 +chrM 13679 13944 - -0.82452 4.30943 0.467925 1.22243 +chrM 13944 14210 - 0.317015 8.87218 0.413534 0.470006 +chrM 14210 14476 - -0.24388 9.2218 0.477444 0.361576 +chrM 14476 14742 - 0.87922 33.8872 0.383459 1.30353 +chrM 14746 14987 - 0.43224 28.1369 0.481328 0.640839 +chrM 14987 15228 - 0.289845 14.2531 0.46888 0.429724 +chrM 15228 15470 - -0.008065 9.3719 0.466942 0.0119572 +chrM 15470 15711 - 0.01195 11.2946 0.46473 0.0177171 +chrM 15711 15953 - -0.03537 6.29752 0.404959 0.0524396 +chrM 15955 16023 - 0 4.13235 0.323529 0 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/reference.target-tmp.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/reference.target-tmp.bed Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,61 @@ +chrM 576 848 - +chrM 848 1121 - +chrM 1121 1394 - +chrM 1394 1667 - +chrM 1667 1940 - +chrM 1940 2212 - +chrM 2212 2485 - +chrM 2485 2758 - +chrM 2758 3031 - +chrM 3031 3304 - +chrM 3306 3579 - +chrM 3579 3853 - +chrM 3853 4126 - +chrM 4126 4400 - +chrM 4401 4695 - +chrM 4695 4990 - +chrM 4990 5284 - +chrM 5284 5579 - +chrM 5586 5655 - +chrM 5656 5729 - +chrM 5760 5891 - +chrM 5903 6171 - +chrM 6171 6440 - +chrM 6440 6708 - +chrM 6708 6977 - +chrM 6977 7245 - +chrM 7245 7514 - +chrM 7517 7767 - +chrM 7767 8018 - +chrM 8018 8269 - +chrM 8294 8364 - +chrM 8365 8630 - +chrM 8630 8896 - +chrM 8896 9162 - +chrM 9162 9427 - +chrM 9427 9693 - +chrM 9693 9959 - +chrM 9959 10224 - +chrM 10224 10490 - +chrM 10490 10756 - +chrM 10756 11022 - +chrM 11022 11287 - +chrM 11287 11553 - +chrM 11553 11819 - +chrM 11819 12084 - +chrM 12084 12350 - +chrM 12350 12616 - +chrM 12616 12882 - +chrM 12882 13147 - +chrM 13147 13413 - +chrM 13413 13679 - +chrM 13679 13944 - +chrM 13944 14210 - +chrM 14210 14476 - +chrM 14476 14742 - +chrM 14746 14987 - +chrM 14987 15228 - +chrM 15228 15470 - +chrM 15470 15711 - +chrM 15711 15953 - +chrM 15955 16023 - |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/sample-diagram.pdf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample-diagram.pdf Sun May 14 20:08:32 2023 +0000 |
| [ |
| @@ -0,0 +1,86 @@ +%PDF-1.4 +%���� ReportLab Generated PDF document http://www.reportlab.com +1 0 obj +<< +/F1 2 0 R /F2 3 0 R /F3 4 0 R /F4 5 0 R +>> +endobj +2 0 obj +<< +/BaseFont /Helvetica /Encoding /WinAnsiEncoding /Name /F1 /Subtype /Type1 /Type /Font +>> +endobj +3 0 obj +<< +/BaseFont /Times-Roman /Encoding /WinAnsiEncoding /Name /F2 /Subtype /Type1 /Type /Font +>> +endobj +4 0 obj +<< +/BaseFont /Helvetica-Bold /Encoding /WinAnsiEncoding /Name /F3 /Subtype /Type1 /Type /Font +>> +endobj +5 0 obj +<< +/BaseFont /Times-BoldItalic /Encoding /WinAnsiEncoding /Name /F4 /Subtype /Type1 /Type /Font +>> +endobj +6 0 obj +<< +/Contents 10 0 R /MediaBox [ 0 0 792 612 ] /Parent 9 0 R /Resources << +/Font 1 0 R /ProcSet [ /PDF /Text /ImageB /ImageC /ImageI ] +>> /Rotate 0 /Trans << + +>> + /Type /Page +>> +endobj +7 0 obj +<< +/PageMode /UseNone /Pages 9 0 R /Type /Catalog +>> +endobj +8 0 obj +<< +/Author (anonymous) /CreationDate (D:20230324160042+00'00') /Creator (ReportLab PDF Library - www.reportlab.com) /Keywords () /ModDate (D:20230324160042+00'00') /Producer (ReportLab PDF Library - www.reportlab.com) + /Subject (unspecified) /Title (untitled) /Trapped /False +>> +endobj +9 0 obj +<< +/Count 1 /Kids [ 6 0 R ] /Type /Pages +>> +endobj +10 0 obj +<< +/Filter [ /ASCII85Decode /FlateDecode ] /Length 4990 +>> +stream +Gau0G9<TX#&`2DPd7]9`j0Hk3D'Xpj_?-)F@M'%m+j*L""N93\qu#aERm*af&/8]'DRnM5f=SW:Z8qh1mGGDA[dDO&gTQ)WS+uBqh_rkf[l9pt^NoGArJR2;Hu\Po+$Tl*htZ5Uq#?hM5Q:nk^Q,i8?bNhsr$JSKk/UZWclZ]k^-<Gm.=BLcT'QLpE/Som(.-el.9haUqVCk'5CN(i+5_OXrUXCb^AIECmEITERnrhE*ub,#S`Ka8dcPW-CW?8?[]I(\It-5Q<q1OfPdg"&bot4F^#t:nhJPpYk`aTkB>gjk$gk.*gtV5^QhP>ElQFNPr;P5ag?r2t3H)Y,h$6Z<X*:=PC/l$QW7T0NX$XA=4S'nQ=>TehU[5K$(gYh.rqk(1R\UE+.?2_LR?/4CEH\U@UAuP.)R>f8t-jSFZog[,\F"]n"A*Wa"t1&(11RMZUQ-lQ/DG"6P0b(LW?O+f0Lt)#R]<SY4'36Je9CZ$tY!._C@_K!=F$5_l!E6lLu9*M?9V\d'nK`U#ob>DQ\u-"r(1=R[1&VVViJ8H^RT@'bUC6'9)V&J(`.:_Y8l0W\'m2jhVG!5l"ukF80rN-E*:%o*P#$D/h.K%'7m#I?[U!bO$GA;L;;6HR1V_p0D%TmG(j%,/:e$5>@+&Wm)-"j;H:\rtfo*X`47:`U(;;hoqN3/3%2IN/HQ>d8^u[+e5n'.2*/"T&3@G#3d"n1dJ7G1'et0f[u'.]fc_'UhXRJE[R.nf<Iu".Oo<?G(@saFg7%J9GWHcZr$[d_L&QFr7"Y5;e\]AN/HL0/RSSU%#=q/ITOUn#DNU"'0eAGZV`LdNqT\lnbG(UOuV1%SAor*%d>uI="q=-)DfM::lVHOA^oZ2Ba$c"]:%b,]$HWENpqt0`qj.F`kJ>F<$q^EU/R*?r\[Y%_mCkZ,92r_&B6LGUt5BK'%lA`UR'I-MUicF!Z$4"@_icEKl@k;M[4h;TM!=O*M9D4/(_\2kGZ_i>!p^LPXYmNXt*ENpf:%.lN7G.s\82_e=$4-Pa3(P'0sM3=lD^EM8"oFBlOlX;2!K1?8bBd-FXl$jVSBWXbhmY6k[kXKKGIS.(bmO;bnKlJL6U$=<5+1XSXIZgXOqrJ(i#Z6!J1V3(L"-=%UP77S5MIcJ?qFVo:Tc,#/%0L_\QY[=sER/X%`Fr5m="(4s1'&-0S*O5/Hd%-,F3ir+b*&bh>2GblfRg;ZU;N;b%70%rb<"/9G@1$-]XH7G^?&1#d/n)05ou(M2"SDHeA;R/`)i-2ldL?@f72)Uo=A!!a#?k(f3s]Qg4&3#1TM'ndaO4L))0nN'SL+c:.b+_RZ1EaR5seoh:8P5(]2JQ_GcW/R9nFjXa\]<7ggRKZ++jt'"oFleRu3FJVl.d0=A;s?HcQJV!=*op#)it,_22d^)*CkYOVTRN_UY/Y!4s(Jc`D`SO\#<cQGUCLQt+<bpeYcdS-1*6hODk3JctfOUSK8g$VcWH8MHiaQ&98Z(bR33HBRkbImh-mFU0frN+id(J_'n0lUeWpMr<728I7Nrjs^dGojepuB2ol,5b#YGWXj%+4f43mJF19Eb/oa\aQM\jN5:(hS;\'iI,XXOi;tRBS5'9K!F.'U_AGUcHQL#U97T@iNf7*E$m>fp\M:jLM3#JVBn/Gc;/=Ah.H=2^+!<OIDWGaGJ:Zh4>8I?C/<5KM>YS[D)JMYOQNS/$!$Z,^(LXJhWlDq&)Yak=NY!n+M'rjh)&YRsT'UEtJ/-GjjF@9S#YEQ-C;Lt!?l_:9$(aSeis.+>EMid;0\,;jN^/1$:Z/8_2urP=MiC@8Epu%HI#4*&k&?>7#;@P2q07Q[&NUD5X#=c<9UKR^n-UjW'lUuD^bTHh'Wr#P3R/tO!sk#S'c[&_et_FR8-B@T`93.g&hrg4;;Dh+&dHXNckI&8Bf5E26*S-_b)J5`#sr'P@DZK(0USN$0O_bG`7=npaCPEl6K",FPYR>#;b&A\.5'9Xr.H3Ro/80CbVMpMkl[-L*^q/b#%>',@+,_)Os;uI["U1[),,?D)!&Nf1l*jT.bJjB_8(&S<=oA:"e0lsR.t'QZu[;`mE;+q(AK<R>OR(^*m*<?27B-_`_%Ao)R%WE^'<A^1)*n:KS`_Fq<=ZRgJ(`ti<K;Vm8pM;+<-""_jB,UT6-#,D?ltjC!.3G3>1A)WI'R*,P_IPXn7Dh_;dC2N7V#&(hlC0?kh84\/cdu87'2Y4`u[f^_8iJ=9>6"7SX8mCQ8kap!c.E%"nBf,@qB_b5@F=TD'i[`dW)ci5p-:_/.,7KZfd1I*njaq#koI%9)=HqRZm"2odQ*QW*Vq@BN?Bb:?0-Y)t!Fm`HH[Ug6aOA%^29!",'HTgK5Ea,]\1l5nu$D*":$Tad1]D2fj.3b8-(e1J\!^t<+LS[THp[`Ka^/]r-nOU/.'md\[8+8EL$X0FM+!Ua]tS>W6aI;CaRT";t0rR2E(P!NO\(Rt6jD3"">f2MD\P<;%ga!b/(OLJ7Y>bq1F?83@^L?r6jK%U%QB\n7:KZ1l3(BheCbYpokJ`cYCX%]^<3H^B;f^4TtYKWo^3nlA58P4Hacc`;7K`37*NmWq'U)KH:Xg'(6E8Ac%R(C=_ZELH,=<^Wu8E:a&8_;>>jMB>/4r<;%#sfshc7pN*Lj:K4e^Q1j<4tCS+u2_<cE?.?1:0'M,@41%,@lDspkWmP9MbJ(Q<DBN4&IZ/mP/<t_W]gtp*:p;:usR#>+*@=R.GXh*b.7iduu,qN:;JR)@J[rn/i1<mdY!C:GC@%Phl\.=355o;KFj>O,r1K%)*o5MB\kfXp(#!/Bo#[ok<J/h^cZYn9KmL[Br@IEq2*]@.S-q*hTAn_3_4G(!@aUd;k3%cs0?%@s#OOUF<kjZqps(qD%[lkAoi',@Zo8pl$<Tc=1tYaVga6r'CnT:k!JQA(0f1WI'TG4l]IpGR(OhN`;bp=ig9c4[uRQ)9.?.3]!>TfW9$6]BETsh.$j^T?1PAQ>dBNH%%E:@um-4VsZ;9S=[i3G,a`/%jB8m]:b(=HYgbcIqC]_l)@K%Ehh`Qpp%gk'3@!!kd8?BWp@I8bh.<%3L8o9*_bC"UsXX=6K\\?2Q\]d`$=Yr0QiEg@K/-P.NB0p2TO$>D("WAe3-:P>b5?ql@]C5:91J$@D&2Ca7tmY.P<GaSg2)oUsRq5?VfK&<-`4O.S[in7t,q-hheM5mP2"BnJGaBNAkVUcXc7ZK;j3VXup9*jX9S.5e]?#pXR4\#KiL-`<c\f!h!.2G=gE=c?DEoO7AHH,+,3AgW2cbP<$W4:q.++>Ya*b6nnH?,P;qbe/C,@O:`p(R(C<T;`nJV\7)@?5j.jg"0mogYu11?l5h0SQ6)Xf@sgTKp'](01OR]0rqnX(WbIXj`sl@Y^S83Pa-V)!euB@C<j!#-^c1$Cp1XA=J%)WFl^dW+pA__Elfp9U0-@E8-Ug1`),f.Gl]mT8NF2cJqK(&9Kg58Ug#>Ip/9-LuK(pa@U%k*dM,sn\;/B+KCTA:">C>t7m_U0?.FS"<$<tIbF"dW%i;HODnNO57RS@)/HVZ/[:%cT6S6fh#M^9]'TQEe8lVO0QmGr,p$5j>_4\JnZXQ?#B>C/-U0+_kO3R<:ZX-#s_r&fBAdU4<hd(.qd5eg7SPi\\HgY@B4haq\hd:CFJ6=HijCc,$E.pE\:Ebf*97B"TL(POa>,fLNBKk3oFQ+pY,`5E]t/[ZBP"aj'+$_k?0.9bG,<a-ga<LVhP@kAG.!(la\j9j%>a.7=Y1b4.EH;8;`(Pqe9:1?i/iq)S-/TmA4+mk5WM_,s-kIW%o'!k+ZLn75d,->9?Crok6V=b/\V/;#+7,;EY!>hY\cG::="bMp7p/XJm(4HjWC('L<a]QZn5[W3)QfbonOC,83.h`rrrmF!MjD<QP+AsgOgH8<2&5CPRMa=MQ!h*sV6AmJ7T/ma.CdO8#B*8&&pt`r55Z$m1266,/J:/$j04B!%,TO/qGA=ZZA9BH[[UsK4'U#pG*+U%pPOWPZoP!rn=e+"R!lH94[/0@@2o;GEn^QbT_$OkuA$OF8!rA`K>$lTZMF.)CDC0&iZnt?MC0P$Z$<B$Fa*NLL9A8)mfW12?L9IILhUuiM]:U<IBJYW..f=Ng7upJbi.9lQVW6n=Bmi0rX_snfA$uIC2P'Y'3f\O@:ggC*<baGX74b=Jgc7@KO@"Pef2f#Gh+AjY.C9"_R[O3i#fLCulHN,/e6l>of%D;PR.h$G9J][ICH.6s1gL8_B>Jn8(1=-g`Q^5Zd924ZgM)Bm2>pm[g!M0Z=.0"t(>J1;Zb)\)Bm06WO3O8:p:FIBN4(]=[+RTTBfirn/.Z>OT&nMhg9Wm^c$boNZNniLaQsYKOu.LmXi/K@6R.u)7FB9Hk[_&04rYQF2U&m+X#6r-nkcL>Anc@+F^m$uSNWHCT4`)?;>]#IC9>D?'X^tPG*En\e%8A78Qr6q`bqmo<b(#fX/iLXX!?3JbLJUgm-<l?2>25PiZ;-H[Hem2HoCX9K>2_^NF,dN_T%),?=Mr-<mS&@8#nT%poW)`I(6Z9l"n#jlA.@TEck+rYIZcrNV?_LfZ$RfNc!h$=(f#4qPs_R6jKbkgdDaTUYJ6VZglfR-*'8d`%J*Oh8D:Rhqc4;X"W>J9WN["`)`qbhS`g&+5b"OX)7kBkuN#CM>YpV!#$NYgB&^b>dk&6`&[6,R(.6D:cO'YH&]Xn\EgSUM1jK_#SSqrb7dBR4`4Ahk^-XR0Hp;*XC22+EMLE>qs3*oaU-Ps&<f2WHR'rY=SGN`0!aoAR%.aD?ST+9ER3afJWBU]8$95%boA1_EP(AS]T-2U7tu1^!b[-e]>k&ReohW4:<D@2\q"/DDi1oICg`"6D&8`!If87"5J#K(MUp*PblGK]s$r?0X4TO0FS_`9!P&$!YRWc)Ddi"Hh]Q_7*"+p@@eL(VH)ljS7ABhI\%4d#ipZ>C*P-040DG?t+kp3[lMkkACeaTCIR!l#LEB:gjaZ%.IfMU*1o1~>endstream +endobj +xref +0 11 +0000000000 65535 f +0000000073 00000 n +0000000134 00000 n +0000000241 00000 n +0000000350 00000 n +0000000462 00000 n +0000000576 00000 n +0000000770 00000 n +0000000838 00000 n +0000001134 00000 n +0000001193 00000 n +trailer +<< +/ID +[<04f2ecb0275aa7db13f037200f131a46><04f2ecb0275aa7db13f037200f131a46>] +% ReportLab generated PDF document -- digest (http://www.reportlab.com) + +/Info 8 0 R +/Root 7 0 R +/Size 11 +>> +startxref +6275 +%%EOF |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/sample-heatmap.png |
| b |
| Binary file test-data/sample-heatmap.png has changed |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/sample-scatter.png |
| b |
| Binary file test-data/sample-scatter.png has changed |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/sample.cnr --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample.cnr Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,55 @@ +chromosome start end gene depth log2 weight +chrM 848 1121 - 5.9011 -0.545691 0.408064 +chrM 1394 1667 - 3.78022 0.488494 0.663959 +chrM 1667 1940 - 1.80586 0.0200539 0.951602 +chrM 2212 2485 - 1.65201 -0.234816 0.863481 +chrM 2485 2758 - 4.0696 0.153636 0.124621 +chrM 2758 3031 - 0.717949 -1.35597 0.802412 +chrM 3031 3304 - 1.33333 0.385198 0.698993 +chrM 3306 3579 - 0.626374 -1.37983 0.9523 +chrM 3579 3853 - 2.30292 0.471839 0.953456 +chrM 3853 4126 - 2.74359 0.444955 0.954775 +chrM 4126 4400 - 0.748175 0.465611 0.488348 +chrM 4401 4695 - 0.94898 -0.583114 0.722949 +chrM 4695 4990 - 5.01695 1.13235 0.235104 +chrM 4990 5284 - 1.73129 0.209867 0.585461 +chrM 5284 5579 - 5.97966 1.18493 0.334994 +chrM 5586 5655 - 0 -21.0389 0.909906 +chrM 5656 5729 - 0 -19.8096 0.489546 +chrM 5760 5891 - 1.79389 0 0.933441 +chrM 5903 6171 - 2.15299 -0.0283011 0.954219 +chrM 6171 6440 - 2.02974 -0.212606 0.881048 +chrM 6440 6708 - 1.51493 -0.38297 0.954355 +chrM 6708 6977 - 2.03717 -0.317296 0.919868 +chrM 6977 7245 - 3.05597 -0.127011 0.931699 +chrM 7245 7514 - 1.24907 0.72831 0.445461 +chrM 7517 7767 - 1.944 0.680162 0.754313 +chrM 7767 8018 - 2.24701 -0.510836 0.476217 +chrM 8018 8269 - 1.00797 -0.663743 0.679122 +chrM 8365 8630 - 1.0717 0.28099 0.736364 +chrM 8630 8896 - 2.07895 -0.154606 0.918337 +chrM 8896 9162 - 3.66165 0.147562 0.952129 +chrM 9162 9427 - 3.60755 0.937798 0.763689 +chrM 9693 9959 - 2.07143 0.459741 0.807601 +chrM 9959 10224 - 0.00377358 -8.75948 0.810371 +chrM 10224 10490 - 1.44361 0.509209 0.934515 +chrM 10490 10756 - 1.82331 0.0655732 0.839154 +chrM 10756 11022 - 1.12406 0.238204 0.822297 +chrM 11022 11287 - 4.27925 1.20043 0.953885 +chrM 11287 11553 - 2.93609 0.224804 0.945234 +chrM 11553 11819 - 1.06015 -1.50066 0.954184 +chrM 11819 12084 - 2.40377 0.0920864 0.791533 +chrM 12084 12350 - 0.736842 -1.15941 0.633433 +chrM 12350 12616 - 0.736842 -1.25242 0.954184 +chrM 12616 12882 - 2.48872 -0.187246 0.898846 +chrM 12882 13147 - 4.50943 0.419127 0.915456 +chrM 13147 13413 - 1.47368 -0.730007 0.952782 +chrM 13413 13679 - 2.95865 -0.0213761 0.95418 +chrM 13944 14210 - 0.890977 -0.337011 0.755369 +chrM 14210 14476 - 2.21053 -0.0427224 0.83652 +chrM 14746 14987 - 8.14523 0.722701 0.582259 +chrM 14987 15228 - 2.48133 -0.105067 0.78567 +chrM 15228 15470 - 1.11157 -0.96567 0.951837 +chrM 15470 15711 - 3.9751 0.576278 0.951583 +chrM 15711 15953 - 0.809917 -1.38778 0.949491 +chrM 15955 16023 - 0 -21.1972 0.909384 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/sample.cns --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample.cns Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,2 @@ +chromosome start end gene log2 depth probes weight +chrM 848 16023 - -1.39012 2.05471 54 42.33 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/sample.targetcoverage.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/sample.targetcoverage.cnn Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,38 @@ +chromosome start end gene depth log2 +chrM 576 647 - 96.2958 6.5894 +chrM 647 1601 - 22.022 4.46087 +chrM 1601 1670 - 3.10145 1.63294 +chrM 1670 3229 - 1.6068 0.68419 +chrM 3229 3304 - 1.57333 0.653824 +chrM 3306 4262 - 1.8295 0.871448 +chrM 4262 4331 - 0 -20 +chrM 4328 4400 - 0.0972222 -3.36257 +chrM 4401 4469 - 1.82353 0.866733 +chrM 4469 5511 - 3.54127 1.82427 +chrM 5511 5579 - 3.20588 1.68072 +chrM 5586 5655 - 0 -20 +chrM 5656 5729 - 0 -20 +chrM 5760 5826 - 1.06061 0.0848889 +chrM 5825 5891 - 2.5303 1.33931 +chrM 5903 7445 - 2.01297 1.00933 +chrM 7445 7514 - 1.85507 0.891476 +chrM 7517 7585 - 0.544118 -0.878009 +chrM 7585 8269 - 1.85088 0.888209 +chrM 8294 8364 - 0 -20 +chrM 8365 8572 - 0.623188 -0.68226 +chrM 8526 9207 - 2.88693 1.52954 +chrM 9206 9990 - 1.97194 0.979615 +chrM 9990 10058 - 0 -20 +chrM 10058 10404 - 1.11272 0.154086 +chrM 10404 10469 - 0 -20 +chrM 10469 10766 - 1.69024 0.757224 +chrM 10759 12137 - 2.3164 1.21188 +chrM 12137 12206 - 1.76812 0.822213 +chrM 12206 12265 - 0.152542 -2.71272 +chrM 12265 12336 - 0 -20 +chrM 12336 14148 - 2.15563 1.10811 +chrM 14148 14673 - 2.24762 1.1684 +chrM 14673 14742 - 8.5942 3.10336 +chrM 14746 15887 - 3.49167 1.80392 +chrM 15887 15953 - 0 -20 +chrM 15955 16023 - 0 -20 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/tumor-diagram.pdf --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor-diagram.pdf Sun May 14 20:08:32 2023 +0000 |
| [ |
| @@ -0,0 +1,86 @@ +%PDF-1.4 +%���� ReportLab Generated PDF document http://www.reportlab.com +1 0 obj +<< +/F1 2 0 R /F2 3 0 R /F3 4 0 R /F4 5 0 R +>> +endobj +2 0 obj +<< +/BaseFont /Helvetica /Encoding /WinAnsiEncoding /Name /F1 /Subtype /Type1 /Type /Font +>> +endobj +3 0 obj +<< +/BaseFont /Times-Roman /Encoding /WinAnsiEncoding /Name /F2 /Subtype /Type1 /Type /Font +>> +endobj +4 0 obj +<< +/BaseFont /Helvetica-Bold /Encoding /WinAnsiEncoding /Name /F3 /Subtype /Type1 /Type /Font +>> +endobj +5 0 obj +<< +/BaseFont /Times-BoldItalic /Encoding /WinAnsiEncoding /Name /F4 /Subtype /Type1 /Type /Font +>> +endobj +6 0 obj +<< +/Contents 10 0 R /MediaBox [ 0 0 792 612 ] /Parent 9 0 R /Resources << +/Font 1 0 R /ProcSet [ /PDF /Text /ImageB /ImageC /ImageI ] +>> /Rotate 0 /Trans << + +>> + /Type /Page +>> +endobj +7 0 obj +<< +/PageMode /UseNone /Pages 9 0 R /Type /Catalog +>> +endobj +8 0 obj +<< +/Author (anonymous) /CreationDate (D:20230303171528+00'00') /Creator (ReportLab PDF Library - www.reportlab.com) /Keywords () /ModDate (D:20230303171528+00'00') /Producer (ReportLab PDF Library - www.reportlab.com) + /Subject (unspecified) /Title (untitled) /Trapped /False +>> +endobj +9 0 obj +<< +/Count 1 /Kids [ 6 0 R ] /Type /Pages +>> +endobj +10 0 obj +<< +/Filter [ /ASCII85Decode /FlateDecode ] /Length 4990 +>> +stream +Gau0G9<TX#&`2DPd7]9`j0Hk3D'Xpj_?-)F@M'%m+j*L""N93\qu#aERm*af&/8]'DRnM5f=SW:Z8qh1mGGDA[dDO&gTQ)WS+uBqh_rkf[l9pt^NoGArJR2;Hu\Po+$Tl*htZ5Uq#?hM5Q:nk^Q,i8?bNhsr$JSKk/UZWclZ]k^-<Gm.=BLcT'QLpE/Som(.-el.9haUqVCk'5CN(i+5_OXrUXCb^AIECmEITERnrhE*ub,#S`Ka8dcPW-CW?8?[]I(\It-5Q<q1OfPdg"&bot4F^#t:nhJPpYk`aTkB>gjk$gk.*gtV5^QhP>ElQFNPr;P5ag?r2t3H)Y,h$6Z<X*:=PC/l$QW7T0NX$XA=4S'nQ=>TehU[5K$(gYh.rqk(1R\UE+.?2_LR?/4CEH\U@UAuP.)R>f8t-jSFZog[,\F"]n"A*Wa"t1&(11RMZUQ-lQ/DG"6P0b(LW?O+f0Lt)#R]<SY4'36Je9CZ$tY!._C@_K!=F$5_l!E6lLu9*M?9V\d'nK`U#ob>DQ\u-"r(1=R[1&VVViJ8H^RT@'bUC6'9)V&J(`.:_Y8l0W\'m2jhVG!5l"ukF80rN-E*:%o*P#$D/h.K%'7m#I?[U!bO$GA;L;;6HR1V_p0D%TmG(j%,/:e$5>@+&Wm)-"j;H:\rtfo*X`47:`U(;;hoqN3/3%2IN/HQ>d8^u[+e5n'.2*/"T&3@G#3d"n1dJ7G1'et0f[u'.]fc_'UhXRJE[R.nf<Iu".Oo<?G(@saFg7%J9GWHcZr$[d_L&QFr7"Y5;e\]AN/HL0/RSSU%#=q/ITOUn#DNU"'0eAGZV`LdNqT\lnbG(UOuV1%SAor*%d>uI="q=-)DfM::lVHOA^oZ2Ba$c"]:%b,]$HWENpqt0`qj.F`kJ>F<$q^EU/R*?r\[Y%_mCkZ,92r_&B6LGUt5BK'%lA`UR'I-MUicF!Z$4"@_icEKl@k;M[4h;TM!=O*M9D4/(_\2kGZ_i>!p^LPXYmNXt*ENpf:%.lN7G.s\82_e=$4-Pa3(P'0sM3=lD^EM8"oFBlOlX;2!K1?8bBd-FXl$jVSBWXbhmY6k[kXKKGIS.(bmO;bnKlJL6U$=<5+1XSXIZgXOqrJ(i#Z6!J1V3(L"-=%UP77S5MIcJ?qFVo:Tc,#/%0L_\QY[=sER/X%`Fr5m="(4s1'&-0S*O5/Hd%-,F3ir+b*&bh>2GblfRg;ZU;N;b%70%rb<"/9G@1$-]XH7G^?&1#d/n)05ou(M2"SDHeA;R/`)i-2ldL?@f72)Uo=A!!a#?k(f3s]Qg4&3#1TM'ndaO4L))0nN'SL+c:.b+_RZ1EaR5seoh:8P5(]2JQ_GcW/R9nFjXa\]<7ggRKZ++jt'"oFleRu3FJVl.d0=A;s?HcQJV!=*op#)it,_22d^)*CkYOVTRN_UY/Y!4s(Jc`D`SO\#<cQGUCLQt+<bpeYcdS-1*6hODk3JctfOUSK8g$VcWH8MHiaQ&98Z(bR33HBRkbImh-mFU0frN+id(J_'n0lUeWpMr<728I7Nrjs^dGojepuB2ol,5b#YGWXj%+4f43mJF19Eb/oa\aQM\jN5:(hS;\'iI,XXOi;tRBS5'9K!F.'U_AGUcHQL#U97T@iNf7*E$m>fp\M:jLM3#JVBn/Gc;/=Ah.H=2^+!<OIDWGaGJ:Zh4>8I?C/<5KM>YS[D)JMYOQNS/$!$Z,^(LXJhWlDq&)Yak=NY!n+M'rjh)&YRsT'UEtJ/-GjjF@9S#YEQ-C;Lt!?l_:9$(aSeis.+>EMid;0\,;jN^/1$:Z/8_2urP=MiC@8Epu%HI#4*&k&?>7#;@P2q07Q[&NUD5X#=c<9UKR^n-UjW'lUuD^bTHh'Wr#P3R/tO!sk#S'c[&_et_FR8-B@T`93.g&hrg4;;Dh+&dHXNckI&8Bf5E26*S-_b)J5`#sr'P@DZK(0USN$0O_bG`7=npaCPEl6K",FPYR>#;b&A\.5'9Xr.H3Ro/80CbVMpMkl[-L*^q/b#%>',@+,_)Os;uI["U1[),,?D)!&Nf1l*jT.bJjB_8(&S<=oA:"e0lsR.t'QZu[;`mE;+q(AK<R>OR(^*m*<?27B-_`_%Ao)R%WE^'<A^1)*n:KS`_Fq<=ZRgJ(`ti<K;Vm8pM;+<-""_jB,UT6-#,D?ltjC!.3G3>1A)WI'R*,P_IPXn7Dh_;dC2N7V#&(hlC0?kh84\/cdu87'2Y4`u[f^_8iJ=9>6"7SX8mCQ8kap!c.E%"nBf,@qB_b5@F=TD'i[`dW)ci5p-:_/.,7KZfd1I*njaq#koI%9)=HqRZm"2odQ*QW*Vq@BN?Bb:?0-Y)t!Fm`HH[Ug6aOA%^29!",'HTgK5Ea,]\1l5nu$D*":$Tad1]D2fj.3b8-(e1J\!^t<+LS[THp[`Ka^/]r-nOU/.'md\[8+8EL$X0FM+!Ua]tS>W6aI;CaRT";t0rR2E(P!NO\(Rt6jD3"">f2MD\P<;%ga!b/(OLJ7Y>bq1F?83@^L?r6jK%U%QB\n7:KZ1l3(BheCbYpokJ`cYCX%]^<3H^B;f^4TtYKWo^3nlA58P4Hacc`;7K`37*NmWq'U)KH:Xg'(6E8Ac%R(C=_ZELH,=<^Wu8E:a&8_;>>jMB>/4r<;%#sfshc7pN*Lj:K4e^Q1j<4tCS+u2_<cE?.?1:0'M,@41%,@lDspkWmP9MbJ(Q<DBN4&IZ/mP/<t_W]gtp*:p;:usR#>+*@=R.GXh*b.7iduu,qN:;JR)@J[rn/i1<mdY!C:GC@%Phl\.=355o;KFj>O,r1K%)*o5MB\kfXp(#!/Bo#[ok<J/h^cZYn9KmL[Br@IEq2*]@.S-q*hTAn_3_4G(!@aUd;k3%cs0?%@s#OOUF<kjZqps(qD%[lkAoi',@Zo8pl$<Tc=1tYaVga6r'CnT:k!JQA(0f1WI'TG4l]IpGR(OhN`;bp=ig9c4[uRQ)9.?.3]!>TfW9$6]BETsh.$j^T?1PAQ>dBNH%%E:@um-4VsZ;9S=[i3G,a`/%jB8m]:b(=HYgbcIqC]_l)@K%Ehh`Qpp%gk'3@!!kd8?BWp@I8bh.<%3L8o9*_bC"UsXX=6K\\?2Q\]d`$=Yr0QiEg@K/-P.NB0p2TO$>D("WAe3-:P>b5?ql@]C5:91J$@D&2Ca7tmY.P<GaSg2)oUsRq5?VfK&<-`4O.S[in7t,q-hheM5mP2"BnJGaBNAkVUcXc7ZK;j3VXup9*jX9S.5e]?#pXR4\#KiL-`<c\f!h!.2G=gE=c?DEoO7AHH,+,3AgW2cbP<$W4:q.++>Ya*b6nnH?,P;qbe/C,@O:`p(R(C<T;`nJV\7)@?5j.jg"0mogYu11?l5h0SQ6)Xf@sgTKp'](01OR]0rqnX(WbIXj`sl@Y^S83Pa-V)!euB@C<j!#-^c1$Cp1XA=J%)WFl^dW+pA__Elfp9U0-@E8-Ug1`),f.Gl]mT8NF2cJqK(&9Kg58Ug#>Ip/9-LuK(pa@U%k*dM,sn\;/B+KCTA:">C>t7m_U0?.FS"<$<tIbF"dW%i;HODnNO57RS@)/HVZ/[:%cT6S6fh#M^9]'TQEe8lVO0QmGr,p$5j>_4\JnZXQ?#B>C/-U0+_kO3R<:ZX-#s_r&fBAdU4<hd(.qd5eg7SPi\\HgY@B4haq\hd:CFJ6=HijCc,$E.pE\:Ebf*97B"TL(POa>,fLNBKk3oFQ+pY,`5E]t/[ZBP"aj'+$_k?0.9bG,<a-ga<LVhP@kAG.!(la\j9j%>a.7=Y1b4.EH;8;`(Pqe9:1?i/iq)S-/TmA4+mk5WM_,s-kIW%o'!k+ZLn75d,->9?Crok6V=b/\V/;#+7,;EY!>hY\cG::="bMp7p/XJm(4HjWC('L<a]QZn5[W3)QfbonOC,83.h`rrrmF!MjD<QP+AsgOgH8<2&5CPRMa=MQ!h*sV6AmJ7T/ma.CdO8#B*8&&pt`r55Z$m1266,/J:/$j04B!%,TO/qGA=ZZA9BH[[UsK4'U#pG*+U%pPOWPZoP!rn=e+"R!lH94[/0@@2o;GEn^QbT_$OkuA$OF8!rA`K>$lTZMF.)CDC0&iZnt?MC0P$Z$<B$Fa*NLL9A8)mfW12?L9IILhUuiM]:U<IBJYW..f=Ng7upJbi.9lQVW6n=Bmi0rX_snfA$uIC2P'Y'3f\O@:ggC*<baGX74b=Jgc7@KO@"Pef2f#Gh+AjY.C9"_R[O3i#fLCulHN,/e6l>of%D;PR.h$G9J][ICH.6s1gL8_B>Jn8(1=-g`Q^5Zd924ZgM)Bm2>pm[g!M0Z=.0"t(>J1;Zb)\)Bm06WO3O8:p:FIBN4(]=[+RTTBfirn/.Z>OT&nMhg9Wm^c$boNZNniLaQsYKOu.LmXi/K@6R.u)7FB9Hk[_&04rYQF2U&m+X#6r-nkcL>Anc@+F^m$uSNWHCT4`)?;>]#IC9>D?'X^tPG*En\e%8A78Qr6q`bqmo<b(#fX/iLXX!?3JbLJUgm-<l?2>25PiZ;-H[Hem2HoCX9K>2_^NF,dN_T%),?=Mr-<mS&@8#nT%poW)`I(6Z9l"n#jlA.@TEck+rYIZcrNV?_LfZ$RfNc!h$=(f#4qPs_R6jKbkgdDaTUYJ6VZglfR-*'8d`%J*Oh8D:Rhqc4;X"W>J9WN["`)`qbhS`g&+5b"OX)7kBkuN#CM>YpV!#$NYgB&^b>dk&6`&[6,R(.6D:cO'YH&]Xn\EgSUM1jK_#SSqrb7dBR4`4Ahk^-XR0Hp;*XC22+EMLE>qs3*oaU-Ps&<f2WHR'rY=SGN`0!aoAR%.aD?ST+9ER3afJWBU]8$95%boA1_EP(AS]T-2U7tu1^!b[-e]>k&ReohW4:<D@2\q"/DDi1oICg`"6D&8`!If87"5J#K(MUp*PblGK]s$r?0X4TO0FS_`9!P&$!YRWc)Ddi"Hh]Q_7*"+p@@eL(VH)ljS7ABhI\%4d#ipZ>C*P-040DG?t+kp3[lMkkACeaTCIR!l#LEB:gjaZ%.IfMU*1o1~>endstream +endobj +xref +0 11 +0000000000 65535 f +0000000073 00000 n +0000000134 00000 n +0000000241 00000 n +0000000350 00000 n +0000000462 00000 n +0000000576 00000 n +0000000770 00000 n +0000000838 00000 n +0000001134 00000 n +0000001193 00000 n +trailer +<< +/ID +[<a5e27b2ce92c0d3c0e7c3f705e84dabd><a5e27b2ce92c0d3c0e7c3f705e84dabd>] +% ReportLab generated PDF document -- digest (http://www.reportlab.com) + +/Info 8 0 R +/Root 7 0 R +/Size 11 +>> +startxref +6275 +%%EOF |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/tumor-heatmap.png |
| b |
| Binary file test-data/tumor-heatmap.png has changed |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/tumor-scatter.png |
| b |
| Binary file test-data/tumor-scatter.png has changed |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/tumor.antitargetcoverage.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor.antitargetcoverage.cnn Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,1 @@ +chromosome start end gene log2 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/tumor.bam |
| b |
| Binary file test-data/tumor.bam has changed |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/tumor.bintest.cns --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor.bintest.cns Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,34 @@ +chromosome start end gene depth log2 weight probes p_bintest +chrM 1394 1667 - 3.78022 1.83095 0.659673 1 0.00305626 +chrM 1667 1940 - 1.80586 1.51502 0.947315 1 2.21288e-10 +chrM 2212 2485 - 1.65201 1.13169 0.859195 1 0.0043234 +chrM 3579 3853 - 2.30292 1.39081 0.949177 1 3.36615e-09 +chrM 3853 4126 - 2.74359 1.7165 0.950488 1 8.22011e-14 +chrM 5284 5579 - 5.97966 3.04522 0.33087 1 0.000409792 +chrM 5586 5655 - 0 -19.5746 0.90138 1 0 +chrM 5656 5729 - 0 -18.4148 0.481257 1 6.28915e-143 +chrM 5760 5891 - 1.79389 1.41828 0.927253 1 4.90435e-07 +chrM 5903 6171 - 2.15299 1.33821 0.949892 1 9.37152e-09 +chrM 6708 6977 - 2.03717 1.04921 0.91555 1 0.000589447 +chrM 6977 7245 - 3.05597 1.2395 0.927373 1 1.2045e-05 +chrM 7517 7767 - 1.944 1.55628 0.749834 1 0.00324207 +chrM 8365 8630 - 1.0717 1.55444 0.732013 1 0.00437839 +chrM 8630 8896 - 2.07895 1.36838 0.913995 1 9.21442e-06 +chrM 8896 9162 - 3.66165 1.94013 0.947786 1 1.58627e-16 +chrM 9162 9427 - 3.60755 2.19544 0.759338 1 2.06073e-05 +chrM 9693 9959 - 2.07143 1.61872 0.803258 1 0.000525673 +chrM 9959 10224 - 0.00377358 -7.0323 0.80602 1 2.93745e-56 +chrM 10224 10490 - 1.44361 1.44622 0.930173 1 1.59322e-07 +chrM 10490 10756 - 1.82331 1.58765 0.834811 1 0.000230056 +chrM 10756 11022 - 1.12406 2.10303 0.817954 1 2.62602e-06 +chrM 11022 11287 - 4.27925 2.56694 0.949534 1 3.32731e-29 +chrM 11287 11553 - 2.93609 1.75192 0.940891 1 3.45973e-12 +chrM 12616 12882 - 2.48872 1.20906 0.894503 1 0.000409792 +chrM 12882 13147 - 4.50943 1.65031 0.911105 1 1.1997e-07 +chrM 13147 13413 - 1.47368 0.874788 0.94844 1 0.000274482 +chrM 13413 13679 - 2.95865 1.34513 0.949837 1 8.56465e-09 +chrM 14210 14476 - 2.21053 1.53132 0.832178 1 0.000409792 +chrM 14746 14987 - 8.14523 2.66335 0.577696 1 0.00010697 +chrM 15470 15711 - 3.9751 2.55959 0.947021 1 8.98929e-28 +chrM 15711 15953 - 0.809917 0.743495 0.944938 1 0.00285344 +chrM 15955 16023 - 0 -19.8307 0.900795 1 0 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/tumor.call.cns --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor.call.cns Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,2 @@ +chromosome start end gene log2 cn depth probes weight +chrM 848 16023 - 0 2 2.05471 54 42.33 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/tumor.cnr --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor.cnr Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,55 @@ +chromosome start end gene depth log2 weight +chrM 848 1121 - 5.9011 -0.545691 0.408064 +chrM 1394 1667 - 3.78022 0.488494 0.663959 +chrM 1667 1940 - 1.80586 0.0200539 0.951602 +chrM 2212 2485 - 1.65201 -0.234816 0.863481 +chrM 2485 2758 - 4.0696 0.153636 0.124621 +chrM 2758 3031 - 0.717949 -1.35597 0.802412 +chrM 3031 3304 - 1.33333 0.385198 0.698993 +chrM 3306 3579 - 0.626374 -1.37983 0.9523 +chrM 3579 3853 - 2.30292 0.471839 0.953456 +chrM 3853 4126 - 2.74359 0.444955 0.954775 +chrM 4126 4400 - 0.748175 0.465611 0.488348 +chrM 4401 4695 - 0.94898 -0.583114 0.722949 +chrM 4695 4990 - 5.01695 1.13235 0.235104 +chrM 4990 5284 - 1.73129 0.209867 0.585461 +chrM 5284 5579 - 5.97966 1.18493 0.334994 +chrM 5586 5655 - 0 -21.0389 0.909906 +chrM 5656 5729 - 0 -19.8096 0.489546 +chrM 5760 5891 - 1.79389 0 0.933441 +chrM 5903 6171 - 2.15299 -0.0283011 0.954219 +chrM 6171 6440 - 2.02974 -0.212606 0.881048 +chrM 6440 6708 - 1.51493 -0.38297 0.954355 +chrM 6708 6977 - 2.03717 -0.317296 0.919868 +chrM 6977 7245 - 3.05597 -0.127011 0.931699 +chrM 7245 7514 - 1.24907 0.72831 0.445461 +chrM 7517 7767 - 1.944 0.680162 0.754313 +chrM 7767 8018 - 2.24701 -0.510836 0.476217 +chrM 8018 8269 - 1.00797 -0.663743 0.679122 +chrM 8365 8630 - 1.0717 0.28099 0.736364 +chrM 8630 8896 - 2.07895 -0.154606 0.918337 +chrM 8896 9162 - 3.66165 0.147562 0.952129 +chrM 9162 9427 - 3.60755 0.937798 0.763689 +chrM 9693 9959 - 2.07143 0.459741 0.807601 +chrM 9959 10224 - 0.00377358 -8.75948 0.810371 +chrM 10224 10490 - 1.44361 0.509209 0.934515 +chrM 10490 10756 - 1.82331 0.0655732 0.839154 +chrM 10756 11022 - 1.12406 0.238204 0.822297 +chrM 11022 11287 - 4.27925 1.20043 0.953885 +chrM 11287 11553 - 2.93609 0.224804 0.945234 +chrM 11553 11819 - 1.06015 -1.50066 0.954184 +chrM 11819 12084 - 2.40377 0.0920864 0.791533 +chrM 12084 12350 - 0.736842 -1.15941 0.633433 +chrM 12350 12616 - 0.736842 -1.25242 0.954184 +chrM 12616 12882 - 2.48872 -0.187246 0.898846 +chrM 12882 13147 - 4.50943 0.419127 0.915456 +chrM 13147 13413 - 1.47368 -0.730007 0.952782 +chrM 13413 13679 - 2.95865 -0.0213761 0.95418 +chrM 13944 14210 - 0.890977 -0.337011 0.755369 +chrM 14210 14476 - 2.21053 -0.0427224 0.83652 +chrM 14746 14987 - 8.14523 0.722701 0.582259 +chrM 14987 15228 - 2.48133 -0.105067 0.78567 +chrM 15228 15470 - 1.11157 -0.96567 0.951837 +chrM 15470 15711 - 3.9751 0.576278 0.951583 +chrM 15711 15953 - 0.809917 -1.38778 0.949491 +chrM 15955 16023 - 0 -21.1972 0.909384 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/tumor.cns --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor.cns Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,2 @@ +chromosome start end gene log2 depth probes weight +chrM 848 16023 - -1.39012 2.05471 54 42.33 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/tumor.targetcoverage.cnn --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/tumor.targetcoverage.cnn Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,38 @@ +chromosome start end gene depth log2 +chrM 576 647 - 96.2958 6.5894 +chrM 647 1601 - 22.022 4.46087 +chrM 1601 1670 - 3.10145 1.63294 +chrM 1670 3229 - 1.6068 0.68419 +chrM 3229 3304 - 1.57333 0.653824 +chrM 3306 4262 - 1.8295 0.871448 +chrM 4262 4331 - 0 -20 +chrM 4328 4400 - 0.0972222 -3.36257 +chrM 4401 4469 - 1.82353 0.866733 +chrM 4469 5511 - 3.54127 1.82427 +chrM 5511 5579 - 3.20588 1.68072 +chrM 5586 5655 - 0 -20 +chrM 5656 5729 - 0 -20 +chrM 5760 5826 - 1.06061 0.0848889 +chrM 5825 5891 - 2.5303 1.33931 +chrM 5903 7445 - 2.01297 1.00933 +chrM 7445 7514 - 1.85507 0.891476 +chrM 7517 7585 - 0.544118 -0.878009 +chrM 7585 8269 - 1.85088 0.888209 +chrM 8294 8364 - 0 -20 +chrM 8365 8572 - 0.623188 -0.68226 +chrM 8526 9207 - 2.88693 1.52954 +chrM 9206 9990 - 1.97194 0.979615 +chrM 9990 10058 - 0 -20 +chrM 10058 10404 - 1.11272 0.154086 +chrM 10404 10469 - 0 -20 +chrM 10469 10766 - 1.69024 0.757224 +chrM 10759 12137 - 2.3164 1.21188 +chrM 12137 12206 - 1.76812 0.822213 +chrM 12206 12265 - 0.152542 -2.71272 +chrM 12265 12336 - 0 -20 +chrM 12336 14148 - 2.15563 1.10811 +chrM 14148 14673 - 2.24762 1.1684 +chrM 14673 14742 - 8.5942 3.10336 +chrM 14746 15887 - 3.49167 1.80392 +chrM 15887 15953 - 0 -20 +chrM 15955 16023 - 0 -20 |
| b |
| diff -r 000000000000 -r 2120d778cfde test-data/tumor_1.bam |
| b |
| Binary file test-data/tumor_1.bam has changed |
| b |
| diff -r 000000000000 -r 2120d778cfde tool-data/fasta_indexes.loc.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/fasta_indexes.loc.sample Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,29 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a fasta_indexes.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The fasta_indexes.loc +#file has this format (white space characters are TAB characters): +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +#So, for example, if you had hg19 Canonical indexed stored in +# +# /depot/data2/galaxy/hg19/sam/, +# +#then the fasta_indexes.loc entry would look like this: +# +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +# +#and your /depot/data2/galaxy/hg19/sam/ directory +#would contain hg19canon.fa and hg19canon.fa.fai files. +# +#Your fasta_indexes.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +#hg18canon hg18 Human (Homo sapiens): hg18 Canonical /depot/data2/galaxy/hg18/sam/hg18canon.fa +#hg18full hg18 Human (Homo sapiens): hg18 Full /depot/data2/galaxy/hg18/sam/hg18full.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /depot/data2/galaxy/hg19/sam/hg19full.fa |
| b |
| diff -r 000000000000 -r 2120d778cfde tool_data_table_conf.xml.sample --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> +<tables> + <!-- Location of SAMTools indexes for FASTA files --> + <table name="fasta_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/fasta_indexes.loc" /> + </table> +</tables> \ No newline at end of file |
| b |
| diff -r 000000000000 -r 2120d778cfde tool_data_table_conf.xml.test --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Sun May 14 20:08:32 2023 +0000 |
| b |
| @@ -0,0 +1,7 @@ +<tables> + <!-- Location of SAMTools indexed FASTA files --> + <table name="fasta_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/fasta_indexes.loc" /> + </table> +</tables> \ No newline at end of file |
