| Next changeset 1:9a811adb714f (2023-01-25) |
|
Commit message:
planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559 |
|
added:
fastaregexfinder.py fastaregexfinder.xml test-data/TestSeqGroup-G4-sub.bed test-data/TestSeqGroup-G4.bed test-data/TestSeqGroup-G4.fasta test-data/test-1.bed test-data/test-2.bed test-data/test-3.bed test-data/test-4.bed test-data/test.fas |
| b |
| diff -r 000000000000 -r 269c627ae9f4 fastaregexfinder.py --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastaregexfinder.py Wed Jun 20 11:06:57 2018 -0400 |
| [ |
| b'@@ -0,0 +1,254 @@\n+#!/usr/bin/env python\n+\n+import re\n+import sys\n+import string\n+import argparse\n+import operator\n+\n+VERSION=\'0.1.1\'\n+\n+parser = argparse.ArgumentParser(description="""\n+\n+DESCRIPTION\n+ \n+ Search a fasta file for matches to a regex and return a bed file with the\n+ coordinates of the match and the matched sequence itself. \n+ \n+ Output bed file has columns:\n+ 1. Name of fasta sequence (e.g. chromosome)\n+ 2. Start of the match\n+ 3. End of the match\n+ 4. ID of the match\n+ 5. Length of the match\n+ 6. Strand \n+ 7. Matched sequence as it appears on the forward strand\n+ \n+ For matches on the reverse strand it is reported the start and end position on the\n+ forward strand and the matched string on the forward strand (so the G4 \'GGGAGGGT\'\n+ present on the reverse strand is reported as ACCCTCCC).\n+ \n+ Note: Fasta sequences (chroms) are read in memory one at a time along with the\n+ matches for that chromosome.\n+ The order of the output is: chroms as they are found in the inut fasta, matches\n+ sorted within chroms by positions.\n+\n+EXAMPLE:\n+ ## Test data:\n+ echo \'>mychr\' > /tmp/mychr.fa\n+ echo \'ACTGnACTGnACTGnTGAC\' >> /tmp/mychr.fa\n+ \n+ fastaRegexFinder.py -f /tmp/mychr.fa -r \'ACTG\'\n+ mychr\t0\t4\tmychr_0_4_for\t4\t+\tACTG\n+ mychr\t5\t9\tmychr_5_9_for\t4\t+\tACTG\n+ mychr\t10\t14\tmychr_10_14_for\t4\t+\tACTG\n+\n+ fastaRegexFinder.py -f /tmp/mychr.fa -r \'ACTG\' --maxstr 3\n+ mychr\t0\t4\tmychr_0_4_for\t4\t+\tACT[3,4]\n+ mychr\t5\t9\tmychr_5_9_for\t4\t+\tACT[3,4]\n+ mychr\t10\t14\tmychr_10_14_for\t4\t+\tACT[3,4]\n+ \n+ less /tmp/mychr.fa | fastaRegexFinder.py -f - -r \'A\\w\\wGn\'\n+ mychr\t0\t5\tmychr_0_5_for\t5\t+\tACTGn\n+ mychr\t5\t10\tmychr_5_10_for\t5\t+\tACTGn\n+ mychr\t10\t15\tmychr_10_15_for\t5\t+\tACTGn\n+\n+DOWNLOAD\n+ fastaRegexFinder.py is hosted at https://github.com/dariober/bioinformatics-cafe/tree/master/fastaRegexFinder\n+\n+ """, formatter_class= argparse.RawTextHelpFormatter)\n+\n+parser.add_argument(\'--fasta\', \'-f\',\n+ type= str,\n+ help=\'\'\'Input fasta file to search. Use \'-\' to read the file from stdin.\n+ \n+ \'\'\',\n+ required= True)\n+\n+parser.add_argument(\'--regex\', \'-r\',\n+ type= str,\n+ help=\'\'\'Regex to be searched in the fasta input.\n+Matches to the reverse complement will have - strand.\n+The default regex is \'([gG]{3,}\\w{1,7}){3,}[gG]{3,}\' which searches\n+for G-quadruplexes. \n+ \'\'\',\n+ default= \'([gG]{3,}\\w{1,7}){3,}[gG]{3,}\')\n+\n+parser.add_argument(\'--matchcase\', \'-m\',\n+ action= \'store_true\',\n+ help=\'\'\'Match case while searching for matches. Default is\n+to ignore case (I.e. \'ACTG\' will match \'actg\').\n+ \'\'\')\n+\n+parser.add_argument(\'--noreverse\',\n+ action= \'store_true\',\n+ help=\'\'\'Do not search the reverse complement of the input fasta.\n+Use this flag to search protein sequences. \n+ \'\'\')\n+\n+parser.add_argument(\'--maxstr\',\n+ type= int,\n+ required= False,\n+ default= 10000,\n+ help=\'\'\'Maximum length of the match to report in the 7th column of the output.\n+Default is to report up to 10000nt.\n+Truncated matches are reported as <ACTG...ACTG>[<maxstr>,<tot length>]\n+ \'\'\')\n+\n+parser.add_argument(\'--seqnames\', \'-s\',\n+ type= str,\n+ nargs= \'+\',\n+ default= [None],\n+ required= False,\n+\t\t help=\'\'\'List of fasta sequences in --fasta to\n+search. E.g. use --seqnames chr1 chr2 chrM to search only these crhomosomes.\n+Default is to search all the sequences in input.\n+ \'\'\')\n+parser.add_argument(\'--quiet\', \'-q\',\n+ '..b'+ table: a list of lists (or tuple of tuples) where each inner list \n+ represents a row\n+ cols: a list (or tuple) specifying the column numbers to sort by\n+ e.g. (1,0) would sort by column 1, then by column 0\n+ """\n+ for col in reversed(cols):\n+ table = sorted(table, key=operator.itemgetter(col))\n+ return(table)\n+\n+def trimMatch(x, n):\n+ """ Trim the string x to be at most length n. Trimmed matches will be reported\n+ with the syntax ACTG[a,b] where Ns are the beginning of x, a is the length of\n+ the trimmed strng (e.g 4 here) and b is the full length of the match\n+ EXAMPLE:\n+ trimMatch(\'ACTGNNNN\', 4)\n+ >>>\'ACTG[4,8]\'\n+ trimMatch(\'ACTGNNNN\', 8)\n+ >>>\'ACTGNNNN\'\n+ """\n+ if len(x) > n and n is not None:\n+ m= x[0:n] + \'[\' + str(n) + \',\' + str(len(x)) + \']\'\n+ else:\n+ m= x\n+ return(m)\n+\n+def revcomp(x):\n+ """Reverse complement string x. Ambiguity codes are handled and case conserved.\n+ \n+ Test\n+ x= \'ACGTRYSWKMBDHVNacgtryswkmbdhvn\'\n+ revcomp(x)\n+ """\n+ compdict= {\'A\':\'T\',\n+ \'C\':\'G\',\n+ \'G\':\'C\',\n+ \'T\':\'A\',\n+ \'R\':\'Y\',\n+ \'Y\':\'R\',\n+ \'S\':\'W\',\n+ \'W\':\'S\',\n+ \'K\':\'M\',\n+ \'M\':\'K\',\n+ \'B\':\'V\',\n+ \'D\':\'H\',\n+ \'H\':\'D\',\n+ \'V\':\'B\',\n+ \'N\':\'N\',\n+ \'a\':\'t\',\n+ \'c\':\'g\',\n+ \'g\':\'c\',\n+ \'t\':\'a\',\n+ \'r\':\'y\',\n+ \'y\':\'r\',\n+ \'s\':\'w\',\n+ \'w\':\'s\',\n+ \'k\':\'m\',\n+ \'m\':\'k\',\n+ \'b\':\'v\',\n+ \'d\':\'h\',\n+ \'h\':\'d\',\n+ \'v\':\'b\',\n+ \'n\':\'n\'}\n+ xrc= []\n+ for n in x:\n+ xrc.append(compdict[n])\n+ xrc= \'\'.join(xrc)[::-1]\n+ return(xrc)\n+# -----------------------------------------------------------------------------\n+\n+psq_re_f= re.compile(args.regex, flags= flag)\n+## psq_re_r= re.compile(regexrev)\n+\n+if args.fasta != \'-\':\n+ ref_seq_fh= open(args.fasta)\n+else:\n+ ref_seq_fh= sys.stdin \n+\n+ref_seq=[]\n+line= (ref_seq_fh.readline()).strip()\n+chr= re.sub(\'^>\', \'\', line)\n+line= (ref_seq_fh.readline()).strip()\n+gquad_list= []\n+while True:\n+ if not args.quiet:\n+ sys.stderr.write(\'Processing %s\\n\' %(chr))\n+ while line.startswith(\'>\') is False:\n+ ref_seq.append(line)\n+ line= (ref_seq_fh.readline()).strip()\n+ if line == \'\':\n+ break\n+ ref_seq= \'\'.join(ref_seq)\n+ if args.seqnames == [None] or chr in args.seqnames:\n+ for m in re.finditer(psq_re_f, ref_seq):\n+ matchstr= trimMatch(m.group(0), args.maxstr)\n+ quad_id= str(chr) + \'_\' + str(m.start()) + \'_\' + str(m.end()) + \'_for\'\n+ gquad_list.append([chr, m.start(), m.end(), quad_id, len(m.group(0)), \'+\', matchstr])\n+ if args.noreverse is False:\n+ ref_seq= revcomp(ref_seq)\n+ seqlen= len(ref_seq)\n+ for m in re.finditer(psq_re_f, ref_seq):\n+ matchstr= trimMatch(revcomp(m.group(0)), args.maxstr)\n+ mstart= seqlen - m.end()\n+ mend= seqlen - m.start()\n+ quad_id= str(chr) + \'_\' + str(mstart) + \'_\' + str(mend) + \'_rev\'\n+ gquad_list.append([chr, mstart, mend, quad_id, len(m.group(0)), \'-\', matchstr])\n+ gquad_sorted= sort_table(gquad_list, (1,2,3))\n+ gquad_list= []\n+ for xline in gquad_sorted:\n+ xline= \'\\t\'.join([str(x) for x in xline])\n+ print(xline)\n+ chr= re.sub(\'^>\', \'\', line)\n+ ref_seq= []\n+ line= (ref_seq_fh.readline()).strip()\n+ if line == \'\':\n+ break\n+\n+#gquad_sorted= sort_table(gquad_list, (0,1,2,3))\n+#\n+#for line in gquad_sorted:\n+# line= \'\\t\'.join([str(x) for x in line])\n+# print(line)\n+sys.exit()\n' |
| b |
| diff -r 000000000000 -r 269c627ae9f4 fastaregexfinder.xml --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/fastaregexfinder.xml Wed Jun 20 11:06:57 2018 -0400 |
| [ |
| @@ -0,0 +1,161 @@ +<tool id="fasta_regex_finder" name="fasta_regex_finder" version="0.1.0"> + <description> + Search in fasta for regexp match + </description> + <requirements> + </requirements> + <version_command>python $__tool_directory__/fastaregexfinder.py --version</version_command> + <command detect_errors="exit_code"><![CDATA[ +python $__tool_directory__/fastaregexfinder.py +--fasta "$input" +--regex "$regex" +#if $settings.advanced == "advanced" + $settings.matchcase + $settings.noreverse + --maxstr $settings.maxstr + #if $settings.seqnames != "" + --seqnames $settings.seqnames + #end if +#end if +--quiet +> $output + ]]></command> + <inputs> + <param type="data" name="input" format="fasta" /> + <param name="regex" size="30" type="text" value="([gG]{3,}\w{1,7}){3,}[gG]{3,}" label="Regular expression" help="(--regex)"> + <sanitizer> + <valid initial="string.printable"> + <remove value="'"/> + </valid> + <mapping initial="none"> + <add source="'" target="__sq__"/> + </mapping> + </sanitizer> + </param> + <conditional name="settings"> + <param name="advanced" type="select" label="Specify advanced parameters"> + <option value="simple" selected="true">No, use program defaults.</option> + <option value="advanced">Yes, see full parameter list.</option> + </param> + <when value="simple"> + </when> + <when value="advanced"> + <param name="matchcase" type="boolean" label="Match case" truevalue="--matchcase" falsevalue="" help="(--matchcase)" /> + <param name="noreverse" type="boolean" label="Do not search the reverse complement" truevalue="--noreverse" falsevalue="" help="(--noreverse)" /> + <param name="maxstr" type="integer" label="Maximum length of the match to report" value="10000" min="1" help="(--maxstr)" /> + <param name="seqnames" size="30" type="text" value="" label="Space separated list of fasta sequences to search" help="--seqnames"/> + </when> + </conditional> + </inputs> + <outputs> + <data name="output" format="bed" from_work_dir="TestSeqGroup-G4.bed" /> + </outputs> + <tests> + <test> + <param name="input" value="TestSeqGroup-G4.fasta"/> + <output name="output" file="TestSeqGroup-G4.bed"/> + </test> + <test> + <param name="input" value="test.fas"/> + <param name="regex" value="ACTG"/> + <output name="output" file="test-1.bed"/> + </test> + <test> + <param name="input" value="test.fas"/> + <param name="regex" value="ACTG"/> + <param name="advanced" value="advanced"/> + <param name="matchcase" value="--matchcase"/> + <output name="output" file="test-2.bed"/> + </test> + <test> + <param name="input" value="test.fas"/> + <param name="regex" value="ACTG"/> + <param name="advanced" value="advanced"/> + <param name="noreverse" value="--noreverse"/> + <output name="output" file="test-3.bed"/> + </test> + <test> + <param name="input" value="test.fas"/> + <param name="regex" value="ACTG"/> + <param name="advanced" value="advanced"/> + <param name="maxstr" value="3"/> + <output name="output" file="test-4.bed"/> + </test> + <test> + <param name="input" value="TestSeqGroup-G4.fasta"/> + <param name="advanced" value="advanced"/> + <param name="seqnames" value="HJ24-Shp2_oncogenicProtein2 HJ24-Shp2_oncogenicProtein"/> + <output name="output" file="TestSeqGroup-G4-sub.bed"/> + </test> +</tests> + <help><![CDATA[ +DESCRIPTION + +Search a fasta file for matches to a regular expression and return a bed file with the +coordinates of the match and the matched sequence itself. + +Output bed file has columns: + +1. Name of fasta sequence (e.g. chromosome) +2. Start of the match +3. End of the match +4. ID of the match +5. Length of the match +6. Strand +7. Matched sequence as it appears on the forward strand + +For matches on the reverse strand it is reported the start and end position on the +forward strand and the matched string on the forward strand (so the G4 'GGGAGGGT' +present on the reverse strand is reported as ACCCTCCC). + + +Note: Fasta sequences (chroms) are read in memory one at a time along with the +matches for that chromosome. +The order of the output is: chroms as they are found in the inut fasta, matches +sorted within chroms by positions. + +ARGUMENTS: + +- regex Regex to be searched in the fasta input. Matches to the reverse complement will have - strand. The default regex is '([gG]{3,}\w{1,7}){3,}[gG]{3,}' which searches for G-quadruplexes. +- matchcase Match case while searching for matches. Default is to ignore case (I.e. 'ACTG' will match 'actg'). +- noreverse Do not search the reverse complement of the input fasta. Use this flag to search protein sequences. +- maxstr Maximum length of the match to report in the 7th column of the output. Default is to report up to 10000nt. Truncated matches are reported as <ACTG...ACTG>[<maxstr>,<tot length>] +- seqnames List of fasta sequences in the input to search. E.g. use --seqnames chr1 chr2 chrM to search only these crhomosomes. Default is to search all the sequences in input. + +EXAMPLE: + +Test data:: +>mychr +ACTGnACTGnACTGnTGAC + +Example1 regex=ACTG:: + + mychr 0 4 mychr_0_4_for 4 + ACTG + mychr 5 9 mychr_5_9_for 4 + ACTG + mychr 10 14 mychr_10_14_for 4 + ACTG + +Example2 regex=ACTG maxstr=3:: + + mychr 0 4 mychr_0_4_for 4 + ACT[3,4] + mychr 5 9 mychr_5_9_for 4 + ACT[3,4] + mychr 10 14 mychr_10_14_for 4 + ACT[3,4] + +Example3 regex=A\w\wG:: + + mychr 0 5 mychr_0_5_for 5 + ACTGn + mychr 5 10 mychr_5_10_for 5 + ACTGn + mychr 10 15 mychr_10_15_for 5 + ACTGn + + ]]></help> + <citations> + <citation type="bibtex"> +@misc{githubfastaRegexFinder, + author = {Dario Beraldi}, + year = {2017}, + title = {fastaRegexFinder}, + publisher = {GitHub}, + journal = {GitHub repository}, + url = {https://github.com/dariober/bioinformatics-cafe/tree/master/fastaRegexFinder}, +}</citation> + </citations> +</tool> |
| b |
| diff -r 000000000000 -r 269c627ae9f4 test-data/TestSeqGroup-G4-sub.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/TestSeqGroup-G4-sub.bed Wed Jun 20 11:06:57 2018 -0400 |
| b |
| @@ -0,0 +1,2 @@ +HJ24-Shp2_oncogenicProtein 17 58 HJ24-Shp2_oncogenicProtein_17_58_for 41 + GGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGG +HJ24-Shp2_oncogenicProtein2 17 58 HJ24-Shp2_oncogenicProtein2_17_58_for 41 + GGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGG |
| b |
| diff -r 000000000000 -r 269c627ae9f4 test-data/TestSeqGroup-G4.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/TestSeqGroup-G4.bed Wed Jun 20 11:06:57 2018 -0400 |
| b |
| @@ -0,0 +1,3 @@ +HJ24-Shp2_oncogenicProtein 17 58 HJ24-Shp2_oncogenicProtein_17_58_for 41 + GGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGG +HJ24-Shp2_oncogenicProtein2 17 58 HJ24-Shp2_oncogenicProtein2_17_58_for 41 + GGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGG +HJ24-Shp2_oncogenicProtein3 17 58 HJ24-Shp2_oncogenicProtein3_17_58_for 41 + GGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGG |
| b |
| diff -r 000000000000 -r 269c627ae9f4 test-data/TestSeqGroup-G4.fasta --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/TestSeqGroup-G4.fasta Wed Jun 20 11:06:57 2018 -0400 |
| b |
| @@ -0,0 +1,56 @@ +>PA#2/8 +ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG +>PA#14/89 +ATACCAGCTTATTCAATTGGGCACCACGGGAGTCGGCCACATTTGGAGTTGTTTTTGCACAATCGTAATCAGTTAG +>PA-C10 +ATACCAGCTTATTCAATTGCGCACCACGGGAGTTGGCCACATTTGGAGTTGTTTTTGCACAATCGTAATCAGTTAG +>PA#4/22 +ATACCAGCTTATTCAATTGCAGTACTGATGAGTGTAGCCGTATGATTATCGTTTGTGGACAATCGTAATCAGTTAG +>PA#4/34 +ATACCAGCTTATTCAATTCCCCAACGAGTCGATATGTAGCCCACACTCTGATTCGTCCACAATCGTAATCAGTTAG +>PA#2/11 +ATACCAGCTTATTCAATTGGAGACGACAAACTATTACGTACTACGGCATGCACTTGGTACAATCGTAATCAGTTAG +>PA-C8 +ATACCAGCTTATTCAATTAGGCCAGATGAGGGGTGCCCATGGCGGGGTGGCTGCTCCAACAATCGTAATCAGTTAG +>PA#14/82 +ATACCAGCTTATTCAATTCCACAACCGAACTCGTAAGACGTATGTAGCCGCCAACTGTACAATCGTAATCAGTTAG +>PA#2/3 +ATACCAGCTTATTCAATTCGACAAGTGGGCATTACGATTCTAGCCCTGATTATGTTCCACAATCGTAATCAGTTAG +>PA-C9 +ATACCAGCTTATTCAATTACCGAGGAGATAACGTTGTAGCCGTCCATCATCTGATTCGACAATCGTAATCAGTTAG +>PA#2/6 +ATACCAGCTTATTCAATTACCGATCACTAGCCGACTAATTGGTTTCCGATCGCAGTCCACAATCGTAATCAGTTAG +>PA-C11 +ATACCAGCTTATTCAATTCGATGGAGCTGATGATTGTTGCCGATCTGACTGTTGTTCCACAATCGTAATCAGTTAG +>PA-C13 +ATACCAGCTTATTCAATTCCCCTAACGTTACTGGATGTAGTCCGACTAACTTATGCGTACAATCGTAATCAGTTAG +>PA-C42 +ATACCAGCTTATTCAATTGCAGATTACGCCTTGTAGCCCGCACTGATCTCGATGTTTGGACAATCGTAATCAGTTAG +>PA-C16 +ATACCAGCTTATTCAATTCCCACGAGTGTAGCCGATTCTTCTGTACTCTTGTCCTCGTACAATCGTAATCAGTTAG +>PA-C15 +ATACCAGCTTATTCAATTACGTGTTGTAGCCGACCCCTGTTGATTGTTTTCCTGTACCACAATCGTAATCAGTTAG +>EA#14.3 +ATACCAGCTTATTCAATTTGAGGCGGGTGGGTGGGTTGAATACGCTGATTACCCCATCGGAGAACGTTAAGGCGCTTCAGATAGTAAGTGCAATCT +>EA#9.4 +ATACCAGCTTATTCAATTGCTGCGAGGTGGGTGGGTGGGAGCAATTGATCCTCGCTTAGCTTCTACGGTGGGCTATCTAGATAGTAAGTGCAATCT +>EA#5.10 +ATACCAGCTTATTCAATTCACCACACCTGCACCCCTGACTTCCCACTTATATCTACTACTCCGTCTCAAGCCCGTTTGAGATAGTAAGTGCAATCT +>EA#14.5 +ATACCAGCTTATTCAATTCCGAGTTTGGGTGGGAGTGGTGGGTTCGGAATTGTTAGTTATTTGGGTTTATGCGAGGTGAGATAGTAAGTGCAATCT +>EA#14.8 +ATACCAGCTTATTCAATTGACGGGGTGTTGTCGTATGCTGTAGAAGCCGTAATTTTTTTTGTTTTCCCTGCCCACCTAGATAGTAAGTGCAATCT +>EA#14.4 +ATACCAGCTTATTCAATTCCACAGGTTGTATGGGGAATAAGGTGGGTGCGCGAGATAGTAAGTGCAATCT +>EA#11.5 +ATACCAGCTTATTCAATTCCCACACCCTAACCGTAGAGCTAAGCTTTTCTTACTACTGACAGTGCTTTACCGTTTGCAAGATAGTAAGTGCAATCT +>HJ24-Shp2_oncogenicProtein +AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT +>HJ24-Shp2_oncogenicProtein2 +AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT +>HJ24-Shp2_oncogenicProtein3 +AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT +>RT6-HIVRT +ATCCGCCTGATTAGCGATACTCAGGCGTTAGGGAAGGGCGTCGAAAGCAGGGTGGGACTTGAGCAAAATCACCTGCAGGGG +>AptG4-HumanRNaseH1 +CGGTCGCTCCGTGTGGCTTGGGTTGGGTGTGGCAGTGAC |
| b |
| diff -r 000000000000 -r 269c627ae9f4 test-data/test-1.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-1.bed Wed Jun 20 11:06:57 2018 -0400 |
| b |
| @@ -0,0 +1,3 @@ +mychr 0 4 mychr_0_4_for 4 + ACTG +mychr 5 9 mychr_5_9_for 4 + actg +mychr 10 14 mychr_10_14_rev 4 - CAGT |
| b |
| diff -r 000000000000 -r 269c627ae9f4 test-data/test-2.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-2.bed Wed Jun 20 11:06:57 2018 -0400 |
| b |
| @@ -0,0 +1,2 @@ +mychr 0 4 mychr_0_4_for 4 + ACTG +mychr 10 14 mychr_10_14_rev 4 - CAGT |
| b |
| diff -r 000000000000 -r 269c627ae9f4 test-data/test-3.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-3.bed Wed Jun 20 11:06:57 2018 -0400 |
| b |
| @@ -0,0 +1,2 @@ +mychr 0 4 mychr_0_4_for 4 + ACTG +mychr 5 9 mychr_5_9_for 4 + actg |
| b |
| diff -r 000000000000 -r 269c627ae9f4 test-data/test-4.bed --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-4.bed Wed Jun 20 11:06:57 2018 -0400 |
| [ |
| @@ -0,0 +1,3 @@ +mychr 0 4 mychr_0_4_for 4 + ACT[3,4] +mychr 5 9 mychr_5_9_for 4 + act[3,4] +mychr 10 14 mychr_10_14_rev 4 - CAG[3,4] |
| b |
| diff -r 000000000000 -r 269c627ae9f4 test-data/test.fas --- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test.fas Wed Jun 20 11:06:57 2018 -0400 |
| b |
| @@ -0,0 +1,2 @@ +>mychr +ACTGnactgnCAGTnTGAC |